Next Article in Journal
The Impact of Antibiotic Prophylaxis on a Retrospective Cohort of Hospitalized Patients with COVID-19 Treated with a Combination of Steroids and Tocilizumab
Next Article in Special Issue
Chalcogen-Varied Imidazolone Derivatives as Antibiotic Resistance Breakers in Staphylococcus aureus Strains
Previous Article in Journal
Antimicrobial and Adjuvant Potencies of Di-n-alkyl Substituted Diazalariat Ethers
Previous Article in Special Issue
Repositioning of HMG-CoA Reductase Inhibitors as Adjuvants in the Modulation of Efflux Pump-Mediated Bacterial and Tumor Resistance
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Antibacterial and Anti-Efflux Activities of Cinnamon Essential Oil against Pan and Extensive Drug-Resistant Pseudomonas aeruginosa Isolated from Human and Animal Sources

by
Mohamed A. I. Abdelatti
1,*,†,
Norhan K. Abd El-Aziz
1,*,†,
El-sayed Y. M. El-Naenaeey
1,
Ahmed M. Ammar
1,
Nada K. Alharbi
2,
Afaf Alharthi
3,
Shadi A. Zakai
4 and
Adel Abdelkhalek
5
1
Department of Microbiology, Faculty of Veterinary Medicine, Zagazig University, Zagazig 44511, Egypt
2
Department of Biology, College of Science, Princess Nourah bint Abdulrahman University, Riyadh 11671, Saudi Arabia
3
Department of Clinical Laboratory Sciences, College of Applied Medical Sciences, Taif University, Taif 21944, Saudi Arabia
4
Department of Clinical Microbiology and Immunology, Faculty of Medicine, King Abdulaziz University, Jeddah 21589, Saudi Arabia
5
Food Safety, Hygiene and Technology Department, Faculty of Veterinary Medicine, Badr University in Cairo (BUC), Badr City 11829, Egypt
*
Authors to whom correspondence should be addressed.
These authors contributed equally to this work.
Antibiotics 2023, 12(10), 1514; https://doi.org/10.3390/antibiotics12101514
Submission received: 31 July 2023 / Revised: 29 September 2023 / Accepted: 29 September 2023 / Published: 5 October 2023

Abstract

Pseudomonas aeruginosa is notorious for its ability to develop a high level of resistance to antimicrobial agents. Resistance-nodulation-division (RND) efflux pumps could mediate drug resistance in P. aeruginosa. The present study aimed to evaluate the antibacterial and anti-efflux activities of cinnamon essential oil either alone or combined with ciprofloxacin against drug resistant P. aeruginosa originated from human and animal sources. The results revealed that 73.91% of the examined samples were positive for P. aeruginosa; among them, 77.78% were of human source and 72.73% were recovered from animal samples. According to the antimicrobial resistance profile, 48.73% of the isolates were multidrug-resistant (MDR), 9.2% were extensive drug-resistant (XDR), and 0.84% were pan drug-resistant (PDR). The antimicrobial potential of cinnamon oil against eleven XDR and one PDR P. aeruginosa isolates was assessed by the agar well diffusion assay and broth microdilution technique. The results showed strong antibacterial activity of cinnamon oil against all tested P. aeruginosa isolates with inhibition zones’ diameters ranging from 34 to 50 mm. Moreover, the minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) values of cinnamon oil against P. aeruginosa isolates ranged from 0.0562–0.225 µg/mL and 0.1125–0.225 µg/mL, respectively. The cinnamon oil was further used to evaluate its anti-efflux activity against drug-resistant P. aeruginosa by phenotypic and genotypic assays. The cartwheel test revealed diminished efflux pump activity post cinnamon oil exposure by two-fold indicating its reasonable impact. Moreover, the real-time quantitative polymerase chain reaction (RT-qPCR) results demonstrated a significant (p < 0.05) decrease in the expression levels of MexA and MexB genes of P. aeruginosa isolates treated with cinnamon oil when compared to the non-treated ones (fold changes values ranged from 0.4204–0.7474 for MexA and 0.2793–0.4118 for MexB). In conclusion, we suggested the therapeutic use of cinnamon oil as a promising antibacterial and anti-efflux agent against drug-resistant P. aeruginosa.

1. Introduction

Pseudomonas aeruginosa is a highly adaptive and robust organism. It can thrive in a wide range of environmental niches owing to its large and dynamic genome that provides extraordinary metabolic versatility and genetic plasticity [1]. P. aeruginosa is an opportunistic, Gram-negative bacillus that causes a variety of clinically important infections in compromised and critically ill individuals. It is commonly involved in patients with cystic fibrosis, severe burns, neutropenia, cancer, chronic obstructive pulmonary disorder (COPD), and severe infections necessitating ventilation, such as Coronavirus disease 2019 (COVID-19) [2]. P. aeruginosa causes a great variety of acute and chronic infections with high morbidity and mortality levels. These infections are particularly difficult to eradicate due to the expression of various virulence factors, the intrinsic antimicrobial resistance, and the owing ability to acquire resistance to numerous antimicrobial classes during therapy, which eventually leads to treatment failure [3]. The expression of multidrug efflux pumps within the resistance-nodulation-cell division (RND) family is largely responsible for P. aeruginosa’s inherent resistance [4,5]. These pumps are membrane proteins that are chromosomally encoded. They form tripartite complexes that include an outer-membrane channel protein, an inner membrane transporter protein, and a periplasmic adapter protein [6,7]. Together, these proteins create an efflux pump with a high level of efficiency that can remove a variety of structurally unrelated antimicrobial drugs from the cell [8]. However, the acquired resistance includes the development of resistance genes or mutations in the genes that code for penicillin-binding proteins, efflux pumps, porins, and chromosomal β-lactamase, all of which contribute to resistance to fluoroquinolones, aminoglycosides, β -lactams, and carbapenems [9]. A genomic study has discovered structural genes for at least twelve RND-type efflux systems, four of which have been demonstrated to play a role in multidrug resistance (MDR) (MexAB-OprM, MexCD-OprJ, MexEF-OprN, and MexXY-OprM) [10]. Of all, P. aeruginosa RND pumps, MexAB-OprM has the widest range of substrates and can pump out a variety of antimicrobials relating to different classes including β-lactams (carboxypenicillins, extended spectrum cephalosporins, aztreonam, and carbapenems such as meropenem and panipenem except imipenem and biapenem), tetracyclines, fluoroquinolones, macrolides, chloramphenicol, trimethoprim, sulfonamides, and novobiocin. It is produced constitutively in wild-type cells, and the overexpression of this specific pump can result in the MDR pattern [11]. Overexpression of the MexAB-OprM efflux pump is caused by the exposure to specific substrates or stressors (mostly through mutational alterations in the regulatory genes such as mexR, nalC, or nalD) [12]. Because of its efflux pump’s versatile substrate profile, the accumulation of many different substances such as antibiotics, disinfectants, detergents, and dyes will be reduced, resulting in MDR P. aeruginosa [13,14]. Ironically, very few effective antibiotics are available for treating P. aeruginosa infections, and in some cases, none at all [15]. All this necessitates the urgent need for fresh approaches to develop a new bactericidal to replenish the otherwise drying arsenal of anti-infective agents against drug-resistant P. aeruginosa strains [16].
As the active efflux of antibacterial drugs plays a substantial role in bacterial drug resistance, inhibiting efflux pumps looks to be a promising technique for restoring antibacterial efficacy. Therefore, the efflux pumps have been selected as possible targets for the development of therapeutic strategies using combinations of antibiotics and efflux pump inhibitors (EPIs) to restore the antibiotics efficiency [17]. Many EPIs of synthetic and natural origins have been discussed in the literature; however, none of them have entered clinical trials to date [18]. Natural products can be acquired from a variety of sources, including bacteria, fungi, algae, plants, and animals, but there is a growing interest in the bioactive substances produced by plants [19]. The essential oils account for a source of very promising natural compounds that can achieve efficient control of the antibiotic-resistant microorganisms [20,21]. Numerous studies have reported strong antibacterial activities of some essential oils, and their roles in efflux pumps inhibition [22]. The potential antibacterial effect of cinnamon oil has been documented frequently, but its activity against extensive drug-resistant (XDR) and pan drug-resistant (PDR) P. aeruginosa isolates is scare [23,24]. Therefore, we evaluated the antibacterial activity of cinnamon oil either alone or combined with ciprofloxacin against drug resistant P. aeruginosa (especially XDR and PDR). Thereafter, the anti-efflux potential of the subinhibitory concentration (SIC or SUB-MIC) of the essential oil against XDR and PDR P. aeruginosa isolates was investigated for the first time.

2. Results

2.1. Occurrence of P. aeruginosa in Animal and Human Samples

In all, 119 out of 161 (73.91%) examined samples were positive for P. aeruginosa. Out of 27 samples of human origin, 21 (77.78%) were positive, with the highest isolation rate from human burns (13 out of 16; 81.25%), followed by urine samples (8 out of 11; 72.73%). Regarding animal samples, P. aeruginosa was isolated from 80 out of 110 (72.73%) examined poultry samples with a high isolation rate from chicken liver (81.81%), followed by cloacal swabs (75%), lung and trachea (73.33% each), chicken heart (66.66%) and cecal parts (65.21%). While the existence of P. aeruginosa in mastitis milk was 75% (18 out of 24) (Table 1). Statistical analysis revealed a non-significant variation in the occurrence of P. aeruginosa in animal and human sources (p > 0.05).
Phenotypic identification of P. aeruginosa revealed Gram-negative bacilli arranged either singly or in groups, non-spore forming and non-capsulated. On pseudomonas agar media, Pseudomonas species appeared as circular, raised with an undulated margin surrounded by a blue to green zone due to pyocyanin formation. Biochemical series could identify P. aeruginosa simply. P. aeruginosa isolates were oxidase, catalase, and citrate tests positive. On TSI agar media, the expected results were alkaline slant (red) and alkaline butt (red). P. aeruginosa isolates were further confirmed by PCR-based detection of the genus (16S rRNA) and species-specific (oprL) genes, giving amplicons of 618 and 504 bp, respectively.

2.2. Antimicrobial Susceptibilities of P. aeruginosa Isolates

The antimicrobial susceptibilities of 119 P. aeruginosa isolates against 17 tested antimicrobial agents demonstrated that all isolates were resistant to fosfomycin. Moreover, high resistance rates were observed against polymixin B and colistin (74.78% each), followed by ceftazidime and cefepime (38.65% each). On the other hand, our results showed that ticarcillin-clavulanic acid (6.72%), piperacillin-tazobactam (5.88%) doripenem and meropenem (5.04% each) and imipenem (4.2%) had the lowest resistance rates against the tested isolates (Table 2). Statistical analysis showed non-significant differences (p > 0.05) in the antimicrobial susceptibilities of P. aeruginosa isolates to all tested antimicrobials except for carbapenems and polypeptides (p < 0.05).
According to the antimicrobial resistance profile, 48.73% (n = 58) of the isolates were MDR (MAR index = 0.23– 0.58) and 9.2% (n = 11) were XDR (MAR index = 0.58–0.88), of which eight isolates originated from poultry, only two were of human origin and one isolate was originated from cattle. Interestingly, one (0.84%) P. aeruginosa isolate originated from a chicken cloacal swab was PDR (MAR index = 1) (Table 2). Of note, nine XDR rather than the PDR P. aeruginosa isolates (10/12 = 83.33%) were CIP-resistant (MIC = 4–128 µg/mL).

2.3. Chemical Composition of Cinnamon Essential Oil

Gas Chromatography-Mass Spectrometry (GC-MS) analysis resulted in the identification of five chemical compounds for cinnamon essential oil, as indicated in Table 3. Cinnamaldehyde is the major chemical compound (78.1%), followed by benzyl alcohol (16.67%), linalyl iso-valerate (2.6%), eugenol (1.5%), and β-caryophyllene (1.13%).

2.4. Antimicrobial Activity of Cinnamon Oil and Ciprofloxacin against XDR and PDR P. aeruginosa Isolates

The antimicrobial potential of cinnamon oil against eleven XDR and one PDR P. aeruginosa isolates was assessed by the agar well diffusion assay and broth micro-dilution technique. The results revealed strong antimicrobial activity of cinnamon oil against all tested P. aeruginosa isolates with inhibition zones’ diameters ranging from 34 to 50 mm. Moreover, the MIC and MBC values of cinnamon oil against tested isolates ranged from 0.0562– 0.225 µg/mL and 0.1125–0.225 µg/mL, respectively. The MIC90 and MIC50 of cinnamon oil were the same value (0.25 µg/mL). On the other hand, ciprofloxacin showed lower antimicrobial activity against tested P. aeruginosa isolates (2–256 µg/mL). MIC90 and MIC50 of ciprofloxacin against tested isolates were 128 and 32 µg/mL, respectively.
The results of ΣFIC of the checkerboard assay showed synergistic antimicrobial interactions of cinnamon oil and ciprofloxacin against 10 out of 12 tested P. aeruginosa isolates (83.33%). The MIC results of both cinnamon oil and ciprofloxacin together decreased when compared with the MIC results of each alone. The MIC values of ciprofloxacin reduced by one–sixfold in the presence of cinnamon oil in six out of ten (60%) ciprofloxacin-resistant isolates. However, the synergistic ciprofloxacin/cinnamon oil combination resulting in switching of only two out of ten (20%) ciprofloxacin resistant isolates to be sensitive (MIC values = 128 → 2 and 32 → 1 µg/mL). Significant differences were observed between the MIC values of the checkerboard assay for ciprofloxacin and cinnamon oil (p = 0.0005, and 0.0001, respectively) (Figure 1A,B). As the best antibacterial activity was shown by cinnamon oil, it was further used to evaluate its anti-efflux activity against drug-resistant P. aeruginosa isolates by phenotypic and genotypic assays.

2.5. Determination of the Efflux Pump’s Activity Phenotypically

In order to measure the efflux activity of XDR (n = 11) and PDR (n = 1) P. aeruginosa isolates, the bacteria’s capacity to expel the EtBr out of the cell was detected using the cartwheel method. It was found that P. aeruginosa isolates fluoresced when they developed in a confluent mass along a radial line of TSA plates with increasing EtBr concentrations. Table 4 illustrates the minimal EtBr concentration and efflux activity index for each isolate of P. aeruginosa. At an EtBr concentration of 4 g/mL, seven isolates (7/12; 58.33 %) started to fluoresce, while the rest of isolates (5/12; 41.67%) fluoresced at EtBr concentrations below 4 g/mL.
The anti-efflux activities of cinnamon oil against drug-resistant P. aeruginosa isolates are shown in Table 4. Statistical analysis demonstrated that the MC EtBr and index differ significantly pre- and post-treatment with cinnamon essential oil (p < 0.0001 and 0.0005, respectively) (Figure 1C,D).

2.6. Quantification of the Expression Levels of Efflux Pump Genes Using RT-qPCR

To further confirm the inhibitory effects of the SIC of cinnamon oil on the efflux pump activity of drug-resistant P. aeruginosa isolates reported here (n = 3; code no. 9, 11, and 12 in Table 4), the transcript levels of efflux-associated genes; MexA and MexB genes, and their regulator (oprL) were determined by reverse transcriptase quantitative polymerase chain reaction (RT-qPCR) in triplicate (Supplementary Materials Figure S1). Data analysis indicated that P. aeruginosa isolates showed low transcript levels of the efflux-associated genes, MexA (fold change range = 0.4204–0.7474) and MexB (fold change range = 0.2793–0.4118), in all treatments when compared to the untreated isolates (Figure 2). The current findings revealed notable non-significant differences in the expression levels of the two efflux pump genes under investigation (p = 0.2030 and 0.1157 for MexA and MexB, respectively) across various sources including chicken cloacal swab, human burn, and mastitis milk.

3. Discussion

Pseudomonas aeruginosa, a leading nosocomial pathogen, is responsible for healthcare-associated infections. It has not only emerged as a MDR pathogen but evolved as an XDR and a PDR as well [25]. There are currently no new antimicrobials that can be used to treat these bacteria in place of the ones that already exist, and there is no widely accessible vaccination against such infections. The strategy to lessen the negative consequences is to control the spread of infections and dissemination of antimicrobial resistance [26,27], which could be achieved through understanding the dynamics, causes, and difficulty of the organism prevalence. Drug resistance evolution has drawn attention to conventional therapies, including herbal remedies. Both humans and animals around the world have received therapy for a variety of infectious ailments with natural alternatives [28]. The objective of the present study was to assess the antibacterial potential of cinnamon essential oil in combination with ciprofloxacin against drug resistant P. aeruginosa. Furthermore, the anti-efflux activity of cinnamon oil against XDR and PDR P. aeruginosa isolated from human and animal sources by phenotypic and genotypic assays.
Herein, the overall prevalence rate of P. aeruginosa was 73.91%, representing 77.78% from human, 72.73% from poultry, and 75% from mastitic milk. In the literature, nosocomial strains of P. aeruginosa appear to be more common everywhere, particularly as a cause of ventilator-associated pneumonia; they are also becoming more common in high-risk populations, such as patients with severe burn injuries [29]. Pseudomonas predominated the respiratory tract (42.8%), followed by wounds (skin/soft tissue, 26%), urine (13.5%) and blood cultures (6.5%) [30], which is lower than our results where the highest existence of the microorganism was in human burns (81.25%), followed by urine samples (72.73%). Furthermore, Mahmoud et al. stated that P. aeruginosa accounted for 32.3 % of infections in burn unit at Menofia University Hospitals [31].
For the purpose of determining the prevalence of P. aeruginosa infection among various flocks of chickens, various surveillance studies have been carried out. For instance, Shukla and Mishra [32] isolated P. aeruginosa from healthy chicks at a rate of 12% and from diseased ones at a rate of 30%. Furthermore, P. aeruginosa was recovered from broiler chicken flocks with low percentages; 21.6% [33] and 17.6% [34] from different Egyptian governorates. Moreover, P. aeruginosa has been detected in 42 of 480 (8.75%) broiler chicken samples [35]. Conversely, 32 of 46 broiler chicken farms (69.57%) were positive for P. aeruginosa [36], which is in line with our results.
P. aeruginosa is an environmentally abundant bacterium that causes severe diseases among immune compromised hosts. It is one of the common causes of mastitis [37]. Ibrahim and co-workers could isolate the pathogen from mastitic animals by a lower percentage (34%) [38]. The difference in isolation rates may be attributed to geographical areas, climatic circumstances, sample types, stress factors, and growth conditions.
P. aeruginosa strains are frequently and intrinsically resistant to a broad range of antibiotics. In this study, analysis of the antimicrobial resistance of P. aeruginosa isolates demonstrated absolute resistance for fosfomycin (100%), followed by polymixin B and colistin (74.78%). Whereas ticarcillin-clavulanic acid (6.72%), piperacillin-tazobactam (5.88%) doripenem and meropenem (5.04% each) and imipenem (4.2%) had the lowest resistance rates against the tested isolates. In contrast, Dorri and coworkers reported 100% susceptibility of P. aeruginosa isolates to colistin and polymixin B [39]. This variation in resistance may be related to the habitual utilization of certain antibiotics for the treatment of numerous diseases in various geographical regions. The overuse of antibiotics has led to the emergence of MDR strains; therefore, the first step in preventing the spread of antibiotic resistance is to continue reporting the resistance rates. Here, 48.73% of P. aeruginosa isolates were MDR, with alarming increase in XDR (9.2%) and PDR (0.84%) categories. Previous studies showed varies trends from other countries. Our MDR percentage was high in comparable to previous researches conducted by Gad et al. [40] in Egypt (36%) and Sabir et al. [41] in Pakistan (22.08%). On the contrary, Tartor and coauthors [42] in Egypt (100%), Inan et al. [43] in Turkey (60%) and Gill team [25] in India (50%) have reported a high prevalence of MDR P. aeruginosa isolates. However, 2.3% XDR and no PDR phenotypes were previously recorded [25].
P. aeruginosa is an obstinate microorganism in terms of resistance to various antimicrobials and possesses three main mechanisms of limited adsorption resistance and efflux, drug inactivation, and change in targets [44]. Efflux pumps play a key role in P. aeruginosa resistance. The ejection of hazardous chemicals and decreased antibiotic sensitivity are both caused by P. aeruginosa’s multidrug efflux pumps [45]. In addition, overexpression of these pumps in P. aeruginosa is directly linked to resistance to the majority of anti-pseudomonal remedies and may impair the effectiveness of novel types of anti-pathogen medications. The operon MexAB-OprM is regarded as the primary cause of antibiotic resistance and was the first multidrug efflux pump discovered in P. aeruginosa [46]. Quinolones, beta-lactams, and a wide variety of other anti-microorganisms are excreted by it.
In this study, cinnamon oil was examined against 12 drug-resistant P. aeruginosa isolates. It showed a strong antimicrobial activity against all tested isolates exhibiting inhibition zones ranging from 34–50 mm in diameter on agar well diffusion assay and low MIC and MBC values (0.0562–0.225 µg/mL and 0.1125–0.225 µg/mL, respectively) by the broth microdilution technique. These results were consistent with the study conducted by Utchariyakiat et al. in which cinnamon oil demonstrated the most inhibitory effectiveness against MDR P. aeruginosa clinical isolates with MIC range of 0.1125–0.225 µg/mL [47].
In this situation, combining essential oils with antibiotics may have a synergistic antibacterial effect, resulting in the creation of a novel treatment strategy. Ciprofloxacin demonstrated adequate antibacterial efficacy in this instance against the tested P. aeruginosa isolates (MIC range = 2–256 µg/mL). Limited reports have conducted on the combination of cinnamon with various antimicrobials or nanoparticles and the results demonstrated synergistic or additive effects against various MDR microorganisms [47,48,49,50]. In accordance with a previous study [47], the combination of cinnamon oil with ciprofloxacin showed partial synergism against clinical P. aeruginosa isolates. In 2012, Guerra et al. published an investigation on the antibacterial activity of Cinnamon zeylanicum essential oil in combination with gentamicin and amikacin against Actinobacter species showing additive and synergistic activities, respectively [51]. Furthermore, Yap et al. reached similar results, where the combination of cinnamon bark essential oil and piperacillin induced a considerable reduction in the registered MIC values of piperacillin presenting a synergistic effect against a clinical strain of beta-lactamase-producing E. coli [49]. Mahadlek et al. used the checkerboard assay to determine the activity of cinnamon oil associated with doxycycline hyclate, ciprofloxacin HCl and metronidazole. They observed an additive activity of cinnamon oil combinations with doxycycline hyclate, ciprofloxacin HCl, or metronidazole against S. aureus ATCC 6538P [48]. Thus, it could be possible that cinnamon oil may form complexes with ciprofloxacin that may increase its antibacterial activity. Moreover, cinnamon oil could also inhibit the efflux transporters, which leads to a rise in the efficacy of antibiotics against tested isolates.
In the present study, the expression of MexA and MexB genes before and after contact with efflux pump inhibitors (cinnamon oil) were investigated by the RT-qPCR technique. The relative expression of MexA and MexB genes in cinnamon oil-treated isolates were significantly more reduced than the non-treated ones (fold changes values ranged from 0.4204–0.7474 for MexA and 0.2793–0.4118 for MexB). According to the findings, the inhibitory effect of cinnamon oil on the MexB gene was higher than that of the MexA one. On the other hand, a previous study conducted in France demonstrated that using cinnamon bark oil or cinnamaldehyde as an additional therapy to treat P. aeruginosa infections could have antagonistic effects when taken with antibiotics. According to their explanation, Mex pump activation strongly increased the expression of operons that code for efflux systems MexXY/OprM, MexAB-OprM, MexCD-OprJ, and MexEF-OprN [52]. However, similar data were not available for comparison with other authors about the anti-efflux activity of cinnamon oil in PDR P. aeruginosa bacterial pathogen.

4. Materials and Methods

4.1. Sampling

One hundred and sixty-one samples were collected during the period between November 2020 to April 2022 from both animal (n = 134) and human (n = 27) origins. Animal samples included chicken organs (n = 110 comprising liver (22), heart (15), cloacal swabs (20), cecal contents (23), lung and trachea (30)), and mastitis milk (n = 24), which were collected from sporadic cases of mastitic dairy cows at Zagazig City, Sharkia Governorate, Egypt. Human samples included burns (n = 16) and urine (n = 11), those were collected from patients attending various hospitals and laboratories at Hehia City, Sharkia Governorate, Egypt. The samples were put aseptically into sterile containers, kept in an icebox, and transferred as soon as possible to the Bacteriology Laboratory, Department of Microbiology, Faculty of Veterinary Medicine, Zagazig University, for further examination. The study was approved by Zagazig University Institutional Animal Care and Use Committee (ZU-IACUC) (approval number ZU-IACUC/2/F/404/2022). Written informed consent was obtained from the owners for the participation of their animals in this study. The patients/participants provided their written informed consent to participate in this study.

4.2. Isolation and Identification of P. aeruginosa

For the isolation of P. aeruginosa, swabs samples were enriched in brain heart infusion broth (BHI; Oxoid, Hampshire, UK) then they were promptly cultivated onto pseudomonas agar base selective medium supplemented with pseudomonas selective supplements (Oxoid, Hampshire, UK). The colonial pigmentation and conventional biochemical assays involving oxidase, catalase, and citrate tests and the biochemical reactions on triple sugar iron (TSI, Oxoid, Hampshire, UK) agar presumptively identified the detected colonies as P. aeruginosa using standard microbiological techniques [53]. Genus- and species-specific oligonucleotide primers (Metabion, Planegg, Germany) were used for the identification of 16S rRNA and oprL genes, respectively [54]. All the isolates were stored frozen at −20 °C in individual aliquots in BHI broth with 25% glycerol until further analysis.

4.3. Antimicrobial Susceptibility Testing of P. aeruginosa Isolates

The antimicrobial susceptibilities of P. aeruginosa were evaluated against 17 commercially available antimicrobial agents representing eight different classes (Oxoid, Hampshire, UK) using the disk diffusion method [55]. The tested antimicrobials were gentamicin (GEN, 10 µg), tobramycin (TOB, 10 µg), amikacin (AK, 30 µg), netilmicin (NET, 30 µg), imipenem (IPM, 10 µg), meropenem (MRP, 10 µg), doripenem (DOR, 10 µg), cefepime (FEP, 30 µg), ceftazidime (CAZ, 30 µg), ciprofloxacin (CIP, 5 µg), levofloxacin (LEV, 5 µg), ticarcillin-clavulanic acid (TIC, 100/10 µg), piperacillin-tazobactam (PTZ,100/10 µg), fosfomycin (FF, 200 µg), aztreonam (ATM, 30 µg), polymyxin B (PB, 300 U) and colistin (CT, 10 µg). The inhibition zone diameters were measured and interpreted according to Clinical and Laboratory Standards Institute (CLSI) and European Committee on Antimicrobial Susceptibility Testing (EUCAST) guidelines [56,57]. The MDR was identified as acquired resistance of a microorganism to at least one antibiotic in three or more antimicrobial categories. Extensively drug-resistance (XDR) was identified as resistance of a single bacterium to all antibiotics except two or fewer antimicrobial categories, whereas pan drug-resistance (PDR) was identified as resistance of a microorganism to all antibiotics in all antimicrobial categories [58]. Each isolate’s multiple antibiotic resistance (MAR) index was determined as follows: number of antimicrobials that the isolate was resistant to the number of antimicrobials that the isolate had been tested; while the MAR index for each antimicrobial is calculated as follows: total number of resistance obtained/(total numbers of tested antimicrobials × total number of isolates) [59].

4.4. Cinnamon Oil

A stock solution of ≤ 100% commercially available cinnamon oil (Sigma, Berlin, Germany) was prepared in tryptic soy broth (TSB; Oxoid, Hampshire, UK) containing 1% (v/v) dimethylsulfoxide (DMSO; Sigma Aldrich, Seelze, Germany). Preliminary testing revealed that 1% DMSO in the final concentration did not demonstrate antimicrobial activity.

4.5. Characterization of Cinnamon Essential Oil by Gas Chromatography-Mass Spectrometry

Gas Chromatography-Mass Spectrometry (GC-MS system; Agilent Technologies, Santa Clara, CA, USA) was equipped with gas chromatograph (GC; 7890B) and mass spectrometer detector (5977A) at Central Laboratories Network, National Research Centre, Cairo, Egypt. Samples were diluted with hexane (1:19, v/v). The GC was equipped with HP-5MS column ((5%-phenyl)-methylpolysiloxane, 30 m × 0.25 mm internal diameter and 0.25 μm film thickness). Analyses were carried out using helium as the carrier gas at a flow rate of 1.0 mL/min at a split ratio of 1:10, injection volume of 1 µL and the following temperature program: 40 °C for 1 min; rising at 4 °C/min to 150 °C and held for 6 min; rising at 4 °C/min to 210 °C and held for 5 min. The injector and detector were held at 280 °C and 220 °C, respectively. Mass spectra were obtained by electron ionization (EI) at 70 eV; using a spectral range of m/z 50–550 and solvent delay of 3 min. Identification of different constituents was determined by comparing the spectrum fragmentation pattern with those stored in Wiley and National Institute of Standards and Technology (NIST) mass spectral library data [60].

4.6. Antimicrobial Activities of Cinnamon Oil and Ciprofloxacin against P. aeruginosa Isolates

The antimicrobial activities of cinnamon oil (100%) were determined against drug-resistant P. aeruginosa isolates. The agar well diffusion method was performed following Valgas et al. [61] and the susceptible isolates exhibited inhibition zones’ diameters ≥ 8 mm as reported previously [62]. The minimum inhibitory concentrations (MICs) and minimum bactericidal concentrations (MBCs) of each antimicrobial agent were detected using the broth microdilution technique [63]. Moreover, the orderly array method [64] was adopted to calculate the MIC50 and MIC90 of the antimicrobials against tested isolates.
The interactions between cinnamon oil and ciprofloxacin were evaluated against P. aeruginosa isolates using the checkerboard method in 96-well microtiter plates [24]. In brief, eight two-fold serial dilutions of cinnamon oil and ciprofloxacin were made in Mueller Hinton broth (MHB; Oxoid, Hampshire, UK) in the grid of eight rows by eight columns. Ciprofloxacin was placed in the wells of eight rows in descending concentrations starting at two times the MICs. Cinnamon oil was similarly distributed among the eight columns. The last four columns of the microtiter plate served as controls for P. aeruginosa growth and plate sterility. An aliquot of 100 µL of P. aeruginosa (5 × 105 CFU/mL) was added for each well. The plates were incubated at 37 °C for 24 h. The analysis of the combination was obtained by calculating the fractional inhibitory concentration index (FICI) [65] using the following formula:
  • The FICI = FICA + FICB;
  • FICA = MIC of A in combination/MIC of A alone;
  • FICB = MIC of B in combination/MIC of B alone.
Where A is cinnamon essential oil and B is ciprofloxacin. Interpretation of the FICI was as follows: synergistic effect ≤ 0.5; partial synergy > 0.5 to < 1; additive 1; indifference > 1 to < 4 and antagonism ≥ 4.

4.7. Phenotypic Detection of the Efflux Pump Activity by Ethidium Bromide Cartwheel (EtBr-CW) Method

By using the EtBr-CW method, the efflux pumps’ capacity to expel ethidium bromide was evaluated [66]. Concisely, freshly prepared trypticase soy agar (TSA; Oxoid, Hampshire, UK) plates containing ethidium bromide (EtBr; Sigma-Aldrich, Seelze, Germany) concentrations ranging from 0 to 4 mg/L (these concentrations were selected basing on the bacterial MICs of EtBr) were kept away from light on the day of the experiment. The tested bacterial isolates were grown in overnight cultures that were calibrated to a 0.5 McFarland turbidity standard (1.5 × 108 CFU/mL). Ten to twelve performed sectors were arranged onto the 9 cm diameter TSA plates in a cartwheel pattern. On the EtBr-TSA plates, the adjusted bacterial cultures were swabbed from the plate’s center to its edge. The plates were inspected under an ultra-violet (UV) transilluminator (Cole-parmer, Vemon Hills, Chicago, IL, USA) after being incubated at 37 °C for 16 h. The smallest amount of EtBr required to obtain the bacterial mass to fluoresce was recorded. The isolates were classified as EtBr-CW-negative, EtBr-CW intermediate, or EtBr-CW-positive depending on whether they emitted fluorescence at 0.5–1 mg/L, 2 mg/L, or only 3–4 mg/L EtBr, respectively.
The capacity of each P. aeruginosa isolate to expel EtBr substrate was graded relative to the control isolate (a pan susceptible P. aeruginosa isolated during this study) according to the following equation: Efflux activity index = MCEtBr (XDR) − MCEtBr (Reference)/MCEtBr (Reference).
Where MCEtBr (XDR) represents the minimum EtBr concentration that produces fluorescence of the test isolate. Meanwhile, MCEtBr (Reference) indicates the minimum EtBr concentration that produces fluorescence of the control isolate.

4.8. Transcriptional Analysis of the Efflux Pump Genes Using Real-Time Quantitative PCR (RT-qPCR)

Total RNA was extracted from non-treated and treated P. aeruginosa isolates with the SICs (concentrations lower than the MIC values) of cinnamon oil in the logarithmic growth phase using QIAamp RNeasy Mini kit (Qiagen, Hilden, Germany) following the manufacturer’s instructions. The transcription analysis of mexA and mexB efflux pump genes was determined in triplicate by one-step RT-qPCR using QuantiTect SYBR Green RT-PCR Kit (Qiagen, Hilden, Germany) in the MX3005P real-time PCR thermal cycler (Stratagene, La Jolla, CA, USA) according to the manufacturer’s instructions. The oligonucleotide primer pairs and cycling conditions are listed in Table 5. RNA extraction from P. aeruginosa ATCC 27853 was used as a positive control, while nuclease-free water was used as a negative control. The specificity of the amplified products was verified by generating melting curves. The relative quantitation of mRNA expression of each sample was normalized to the constitutive expression of the oprL housekeeping gene. The fold changes in the transcript levels of targeted genes in treated P. aeruginosa relative to their levels in the untreated ones were calculated according to the comparative 2−ΔΔCT method [67].

4.9. Statistical Analysis

Data were edited in Microsoft Excel (Microsoft Corporation, Redmond, WA, USA, accessed on 25 June 2023). The Levene and Shapiro–Wilk tests were used in order to check the normality and homogeneity of variance [71]. The differences between frequencies data were examined by fisher exact test according to the statistical analysis system [72]. The differences between means were assessed by Wilcoxon Signed-Ranks Test. Figures were fitted by the GraphPad Prism software 9.0 (GraphPad, La Jolla, CA, USA, accessed on 25 June 2023). Statistical significance was accepted as p < 0.05.

5. Conclusions

We provide a comprehensive overview of the antimicrobial and anti-efflux potential of cinnamon oil against PDR and XDR P. aeruginosa isolates for the first time. These findings highlight the promise of essential oils as a viable alternative for future dosing approaches to treat P. aeruginosa infections.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/antibiotics12101514/s1, Figure S1: Data sheet of RT-qPCR showing amplification curves of MexA (A) MexB (B) and OprL (C) genes of P. aeruginosa.

Author Contributions

Conceptualization, M.A.I.A., N.K.A.E.-A., E.-s.Y.M.E.-N. and A.M.A.; methodology, M.A.I.A. and N.K.A.E.-A.; validation, M.A.I.A., N.K.A.E.-A., E.-s.Y.M.E.-N., A.M.A., N.K.A., A.A. (Afaf Alharthi), S.A.Z. and A.A. (Adel Abdelkhalek); formal analysis, M.A.I.A. and N.K.A.E.-A., A.A. (Afaf Alharthi) and S.A.Z.; investigation, M.A.I.A., N.K.A.E.-A., E.-s.Y.M.E.-N., A.M.A., A.A. (Afaf Alharthi), S.A.Z. and A.A. (Adel Abdelkhalek); data curation, M.A.I.A., N.K.A.E.-A. and N.K.A.; writing—original draft preparation, M.A.I.A. and N.K.A.E.-A. writing—review and editing, E.-s.Y.M.E.-N., A.M.A., N.K.A., S.A.Z. and A.A. (Adel Abdelkhalek). All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

The Institutional Animal Care and Use Committee at Zagazig University, Zagazig, Egypt (ZU-IACUC/2/F/404/2022), approved the sampling and data collection protocol.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are available on request from the corresponding author.

Acknowledgments

We want to acknowledge Princess Nourah bint Abdulrahman University Researchers Supporting Project number (PNURSP2023R153), Princess Nourah bint Abdulrahman University, Riyadh, Saudi Arabia. The Researchers would like to acknowledge Deanship of Scientific Research, Taif University for Funding this work.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Klockgether, J.; Cramer, N.; Wiehlmann, L.; Davenport, C.F.; Tümmler, B. Pseudomonas aeruginosa genomic structure and diversity. Front. Microbiol. 2011, 2, 150. [Google Scholar] [CrossRef] [Scilit]
  2. Qin, S.; Xiao, W.; Zhou, C.; Pu, Q.; Deng, X.; Lan, L.; Liang, H.; Song, X.; Wu, M. Pseudomonas aeruginosa: Pathogenesis, virulence factors, antibiotic resistance, interaction with host, technology advances and emerging therapeutics. Signal Transduct. Target. Ther. 2022, 7, 1–27. [Google Scholar] [CrossRef] [Scilit]
  3. Tartor, Y.; El-Naenaeey, E. RT-PCR detection of exotoxin genes expression in multidrug resistant Pseudomonas aeruginosa. Cell. Mol. Biol. 2016, 62, 56–62. [Google Scholar]
  4. Arzanlou, M.; Chai, W.C.; Venter, H. Intrinsic, adaptive and acquired antimicrobial resistance in Gram-negative bacteria. Essays Biochem. 2017, 61, 49–59. [Google Scholar]
  5. Moradali, M.F.; Ghods, S.; Rehm, B.H. Pseudomonas aeruginosa lifestyle: A paradigm for adaptation, survival, and persistence. Front. Cell. Infect. Microbiol. 2017, 7, 39. [Google Scholar] [CrossRef] [Scilit]
  6. Dreier, J.; Ruggerone, P. Interaction of antibacterial compounds with RND efflux pumps in Pseudomonas aeruginosa. Front. Microbiol. 2015, 6, 660. [Google Scholar] [CrossRef] [Scilit]
  7. Venter, H.; Mowla, R.; Ohene-Agyei, T.; Ma, S. RND-type drug efflux pumps from Gram-negative bacteria: Molecular mechanism and inhibition. Front. Microbiol. 2015, 6, 377. [Google Scholar] [CrossRef] [Scilit]
  8. Poole, K. Pseudomonas aeruginosa: Resistance to the max. Front. Microbiol. 2011, 2, 65. [Google Scholar] [CrossRef] [Scilit]
  9. Oie, S.; Fukui, Y.; Yamamoto, M.; Masuda, Y.; Kamiya, A. In vitro antimicrobial effects of aztreonam, colistin, and the 3-drug combination of aztreonam, ceftazidime and amikacin on metallo-β-lactamase-producing Pseudomonas aeruginosa. BMC Infect. Dis. 2009, 9, 123. [Google Scholar] [CrossRef] [Scilit]
  10. Li, X.-Z.; Plésiat, P.; Nikaido, H. The challenge of efflux-mediated antibiotic resistance in Gram-negative bacteria. Clin. Microbiol. Rev. 2015, 28, 337–418. [Google Scholar] [CrossRef] [Scilit]
  11. Poole, K. Multidrug efflux pumps and antimicrobial resistance in Pseudomonas aeruginosa and related organisms. J. Mol. Microbiol. Biotechnol. 2001, 3, 255–264. [Google Scholar] [PubMed]
  12. Sobel, M.L.; Hocquet, D.; Cao, L.; Plesiat, P.; Poole, K. Mutations in PA3574 (nalD) lead to increased MexAB-OprM expression and multidrug resistance in laboratory and clinical isolates of Pseudomonas aeruginosa. Antimicrob. Agents Chemother. 2005, 49, 1782–1786. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  13. Blanco, P.; Hernando-Amado, S.; Reales-Calderon, J.A.; Corona, F.; Lira, F.; Alcalde-Rico, M.; Bernardini, A.; Sanchez, M.B.; Martinez, J.L. Bacterial multidrug efflux pumps: Much more than antibiotic resistance determinants. Microorganisms 2016, 4, 14. [Google Scholar] [CrossRef] [Scilit]
  14. Fernández, L.; Hancock, R.E. Adaptive and mutational resistance: Role of porins and efflux pumps in drug resistance. Clin. Microbiol. Rev. 2012, 25, 661–681. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  15. Peña, C.; Gómez-Zorrilla, S.; Suarez, C.; Dominguez, M.; Tubau, F.; Arch, O.; Oliver, A.; Pujol, M.; Ariza, J. Extensively drug-resistant Pseudomonas aeruginosa: Risk of bloodstream infection in hospitalized patients. Eur. J. Clin. Microbiol. Infect. Dis. 2012, 31, 2791–2797. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  16. Amirulhusni, A.N.; Palanisamy, N.K.; Mohd-Zain, Z.; Ping, L.J.; Durairaj, R. Antibacterial effect of silver nanoparticles on multi drug resistant Pseudomonas aeruginosa. Int. J. Med. Health Sci. 2012, 6, 291–294. [Google Scholar]
  17. Lomovskaya, O.; Zgurskaya, H.I.; Totrov, M.; Watkins, W.J. Waltzing transporters and “the dance macabre” between humans and bacteria. Nat. Rev. Drug Discov. 2007, 6, 56–65. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  18. Compagne, N.; Vieira Da Cruz, A.; Müller, R.T.; Hartkoorn, R.C.; Flipo, M.; Pos, K.M. Update on the Discovery of Efflux Pump Inhibitors against Critical Priority Gram-Negative Bacteria. Antibiotics 2023, 12, 180. [Google Scholar] [CrossRef] [Scilit]
  19. Rossiter, S.E.; Fletcher, M.H.; Wuest, W.M. Natural products as platforms to overcome antibiotic resistance. Chem. Rev. 2017, 117, 12415–12474. [Google Scholar] [CrossRef] [Scilit]
  20. Raut, J.S.; Karuppayil, S.M. A status review on the medicinal properties of essential oils. Ind. Crops Prod. 2014, 62, 250–264. [Google Scholar] [CrossRef] [Scilit]
  21. Veras, H.N.; Rodrigues, F.F.; Colares, A.V.; Menezes, I.R.; Coutinho, H.D.; Botelho, M.A.; Costa, J.G. Synergistic antibiotic activity of volatile compounds from the essential oil of Lippia sidoides and thymol. Fitoterapia 2012, 83, 508–512. [Google Scholar] [CrossRef] [Scilit]
  22. Marwa, C.; Fikri-Benbrahim, K.; Ou-Yahia, D.; Farah, A. African peppermint (Mentha piperita) from Morocco: Chemical composition and antimicrobial properties of essential oil. J. Adv. Pharm. Technol. Res. 2017, 8, 86. [Google Scholar]
  23. Vasconcelos, N.; Croda, J.; Simionatto, S. Antibacterial mechanisms of cinnamon and its constituents: A review. Microb. Pathog. 2018, 120, 198–203. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  24. Yadav, M.K.; Park, S.W.; Chae, S.W.; Song, J.J.; Kim, H.C. Antimicrobial activities of Eugenia caryophyllata extract and its major chemical constituent eugenol against Streptococcus pneumoniae. Acta Pathol. Microbiol. Immunol. 2013, 121, 1198–1206. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  25. Gill, J.; Arora, S.; Khanna, S.; Kumar, K.H. Prevalence of multidrug-resistant, extensively drug-resistant, and pandrug-resistant Pseudomonas aeruginosa from a tertiary level intensive care unit. J. Glob. Infect. Dis. 2016, 8, 155. [Google Scholar] [PubMed]
  26. Abd El-Aziz, N.K.; Ammar, A.M.; El Damaty, H.M.; Abd Elkader, R.A.; Saad, H.A.; El-Kazzaz, W.; Khalifa, E. Environmental Streptococcus uberis Associated with Clinical Mastitis in Dairy Cows: Virulence Traits, Antimicrobial and Biocide Resistance, and Epidemiological Typing. Animals 2021, 11, 1849. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  27. Elmowalid, G.A.; Ahmad, A.A.M.; Hassan, M.N.; Abd El-Aziz, N.K.; Abdelwahab, A.M.; Elwan, S.I. Molecular Detection of New SHV β-lactamase Variants in Clinical Escherichia coli and Klebsiella pneumoniae Isolates from Egypt. Comp. Immunol. Microbiol. Infect. Dis. 2018, 60, 35–41. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  28. Verma, S.; Singh, S. Current and future status of herbal medicines. Vet. World 2008, 1, 347. [Google Scholar] [CrossRef] [Scilit]
  29. Brusselaers, N.; Monstrey, S.; Snoeij, T.; Vandijck, D.; Lizy, C.; Hoste, E.; Lauwaert, S.; Colpaert, K.; Vandekerckhove, L.; Vogelaers, D. Morbidity and mortality of bloodstream infections in patients with severe burn injury. Am. J. Crit. Care 2010, 19, e81–e87. [Google Scholar] [CrossRef] [Scilit]
  30. De Francesco, M.A.; Ravizzola, G.; Peroni, L.; Bonfanti, C.; Manca, N. Prevalence of multidrug-resistant Acinetobacter baumannii and Pseudomonas aeruginosa in an Italian hospital. J. Infect. Public Health 2013, 6, 179–185. [Google Scholar] [CrossRef] [Scilit]
  31. Mahmoud, A.B.; Zahran, W.A.; Hindawi, G.R.; Labib, A.Z.; Galal, R. Prevalence of multidrug-resistant Pseudomonas aeruginosa in patients with nosocomial infections at a university hospital in Egypt, with special reference to typing methods. J. Virol. Microbiol. 2013, 2013, 1–13. [Google Scholar] [CrossRef] [Scilit]
  32. Shukla, S.; Mishra, P. Pseudomonas aeruginosa infection in broiler chicks in Jabalpur. Int. J. Ext. Res. 2015, 6, 37–39. [Google Scholar]
  33. Abd El-Ghany, W.A. Pseudomonas aeruginosa infection of avian origin: Zoonosis and one health implications. Vet. World. 2021, 14, 2155. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  34. Mohamed, H. Some studies on Pseudomonas species in chicken embryos and broilers in Assiut governorate. Ass. Univ. Bull. Environ. Res. 2004, 7, 23–30. [Google Scholar]
  35. Farghaly, E.; Roshdy, H.; Bakheet, A.; Abd El-Hafez, S.; Badr, H. Advanced studies on Pseudomonas aeruginosa infection in chicken. Anim. Health Res. J. 2017, 5, 207–217. [Google Scholar]
  36. Badr, J.; El Saidy, F.; Abdelfattah, A. Emergence of multi-drug resistant Pseudomonas aeruginosa in Broiler Chicks. Int. J. Microbiol Biotechnol. 2020, 5, 41. [Google Scholar]
  37. McVey, D.S.; Kennedy, M.; Chengappa, M. Veterinary Microbiology; John Wiley & Sons: Hoboken, NJ, USA, 2013. [Google Scholar]
  38. Ibrahim, N.A.; Farag, V.M.E.-M.; Abd-El-Moaty, A.M.; Atwa, S.M. Resistant gene of Pseudomonas aeruginosa in mastitic cattle with reference to some biochemical and immunological parameters. World’s Vet. J. 2017, 7, 5–13. [Google Scholar] [CrossRef] [Scilit]
  39. Dorri, K.; Modaresi, F.; Shakibaie, M.R.; Moazamian, E. Effect of gold nanoparticles on the expression of efflux pump mexA and mexB genes of Pseudomonas aeruginosa strains by Quantitative real-time PCR. Pharmacia 2022, 69, 125–133. [Google Scholar] [CrossRef] [Scilit]
  40. Gad, G.F.; El-Domany, R.A.; Zaki, S.; Ashour, H.M. Characterization of Pseudomonas aeruginosa isolated from clinical and environmental samples in Minia, Egypt: Prevalence, antibiogram and resistance mechanisms. J. Antimicrob. Chemother. 2007, 60, 1010–1017. [Google Scholar] [CrossRef] [Scilit]
  41. Sabir, R.; Alvi, S.F.D.; Fawwad, A. Antimicrobial susceptibility pattern of aerobic microbial isolates in a clinical laboratory in Karachi-Pakistan. Pak. J. Med. Sci. 2013, 29, 851. [Google Scholar] [CrossRef] [Scilit]
  42. Tartor, Y.H.; Gharieb, R.M.; Abd El-Aziz, N.K.; El Damaty, H.M.; Enany, S.; Khalifa, E.; Attia, A.S.; Abdellatif, S.S.; Ramadan, H. Virulence determinants and plasmid-mediated colistin resistance mcr genes in gram-negative bacteria isolated from bovine milk. Front. Cell. Infect. Microbiol. 2021, 11, 761417. [Google Scholar] [CrossRef] [Scilit]
  43. Inan, D.; Ogunc, D.; Gunseren, F.; Çolak, D.; Mamikoglu, L.; Gultekin, M. The resistance of Pseudomonas aeruginosa strains isolated from nosocomial infections against various antibiotics. Mikrobiyol Bul. 2000, 34, 255–260. [Google Scholar]
  44. Brinkman, F.S.; Bains, M.; Hancock, R.E. The amino terminus of Pseudomonas aeruginosa outer membrane protein OprF forms channels in lipid bilayer membranes: Correlation with a three-dimensional model. J. Bacteriol. 2000, 182, 5251–5255. [Google Scholar] [CrossRef] [Scilit]
  45. Colclough, A.L.; Alav, I.; Whittle, E.E.; Pugh, H.L.; Darby, E.M.; Legood, S.W.; McNeil, H.E.; Blair, J.M. RND efflux pumps in Gram-negative bacteria; regulation, structure and role in antibiotic resistance. Future Microbiol. 2020, 15, 143–157. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  46. Poole, K.; Krebes, K.; McNally, C.; Neshat, S. Multiple antibiotic resistance in Pseudomonas aeruginosa: Evidence for involvement of an efflux operon. J. Bacteriol. 1993, 175, 7363–7372. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  47. Utchariyakiat, I.; Surassmo, S.; Jaturanpinyo, M.; Khuntayaporn, P.; Chomnawang, M.T. Efficacy of cinnamon bark oil and cinnamaldehyde on anti-multidrug resistant Pseudomonas aeruginosa and the synergistic effects in combination with other antimicrobial agents. BMC Complement Altern. Med. 2016, 16, 158. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  48. Mahadlek, J.; Charoenteeraboon, J.; Phaechamud, T. Combination effects of the antimicrobial agents and cinnamon oil. Adv. Mat. Res. 2012, 506, 246–249. [Google Scholar] [CrossRef] [Scilit]
  49. Yap, P.S.X.; Lim, S.H.E.; Hu, C.P.; Yiap, B.C. Combination of essential oils and antibiotics reduce antibiotic resistance in plasmid-conferred multidrug resistant bacteria. Phytomedicine 2013, 20, 710–713. [Google Scholar] [CrossRef] [Scilit]
  50. Abd El-Aziz, N.K.; Ammar, A.M.; El-Naenaeey, E.Y.M.; El Damaty, H.M.; Elazazy, A.A.; Hefny, A.A.; Shaker, A.; Eldesoukey, I.E. Antimicrobial and antibiofilm potentials of cinnamon oil and silver nanoparticles against Streptococcus agalactiae isolated from bovine mastitis: New avenues for countering resistance. BMC Vet. Res. 2021, 17, 136. [Google Scholar] [CrossRef] [Scilit]
  51. Guerra, F.Q.S.; Mendes, J.M.; Sousa, J.P.d.; Morais-Braga, M.F.; Santos, B.H.C.; Melo Coutinho, H.D.; Lima, E.d.O. Increasing antibiotic activity against a multidrug-resistant Acinetobacter spp. by essential oils of Citrus limon and Cinnamomum zeylanicum. Nat. Prod. Res. 2012, 26, 2235–2238. [Google Scholar] [CrossRef] [Scilit]
  52. Tetard, A.; Zedet, A.; Girard, C.; Plésiat, P.; Llanes, C. Cinnamaldehyde induces expression of efflux pumps and multidrug resistance in Pseudomonas aeruginosa. Antimicrob. Agents Chemother. 2019, 63, e01081-19. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  53. Pankuch, G.A.; Lin, G.; Seifert, H.; Appelbaum, P.C. Activity of meropenem with and without ciprofloxacin and colistin against Pseudomonas aeruginosa and Acinetobacter baumannii. Antimicrob. Agents Chemother. 2008, 52, 333–336. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  54. Spilker, T.; Coenye, T.; Vandamme, P.; LiPuma, J.J. PCR-based assay for differentiation of Pseudomonas aeruginosa from other Pseudomonas species recovered from cystic fibrosis patients. J. Clin. Microbiol. 2004, 42, 2074–2079. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  55. Bauer, A. Antibiotic susceptibility testing by a standardized single disc method. Am. J. Clin. Pathol. 1966, 45, 149–158. [Google Scholar] [CrossRef] [Scilit]
  56. Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Susceptibility Testing; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2017. [Google Scholar]
  57. EUCAST. The European Committee on Antimicrobial Susceptibility Testing. Breakpoint Tables for Interpretation of MICs and Zone Diameters. Version 8.0. 2018. Available online: http://www.eucast.org/ast_of_bacteria/previous_versions_of_documents/ (accessed on 4 January 2023).
  58. Magiorakos, A.-P.; Srinivasan, A.; Carey, R.B.; Carmeli, Y.; Falagas, M.; Giske, C.; Harbarth, S.; Hindler, J.; Kahlmeter, G.; Olsson-Liljequist, B. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: An international expert proposal for interim standard definitions for acquired resistance. Clin. Microbiol. Infect. 2012, 18, 268–281. [Google Scholar] [CrossRef] [Scilit]
  59. Tambekar, D.; Dhanorkar, D.; Gulhane, S.; Khandelwal, V.; Dudhane, M. Antibacterial susceptibility of some urinary tract pathogens to commonly used antibiotics. Afr. J. Biotechnol. 2006, 5, 17. [Google Scholar]
  60. Ribeiro-Santos, R.; Andrade, M.; de Melo, N.R.; dos Santos, F.R.; de Araújo Neves, I.; de Carvalho, M.G.; Sanches-Silva, A. Biological activities and major components determination in essential oils intended for a biodegradable food packaging. Ind. Crops Prod. 2017, 97, 201–210. [Google Scholar] [CrossRef] [Scilit]
  61. Valgas, C.; de Souza, S.M.; Smânia, E.F.; Smânia, A., Jr. Screening methods to determine antibacterial activity of natural products. Braz. J. Microbiol. 2007, 38, 369–380. [Google Scholar] [CrossRef] [Scilit]
  62. Choi, O.; Cho, S.K.; Kim, J.; Park, C.G.; Kim, J. In vitro antibacterial activity and major bioactive components of Cinnamomum verum essential oils against cariogenic bacteria, Streptococcus mutans and Streptococcus sobrinus. Asian Pac. J. Trop. Biomed. 2016, 6, 308–314. [Google Scholar] [CrossRef] [Scilit]
  63. Rankin, I. MIC Testing. Manual of Antimicrobial Susceptibility Testing; American Society for Microbiology: Seattle, WA, USA, 2005; pp. 53–62. [Google Scholar]
  64. Hamilton-Miller, J. Calculating MIC50. J. Antimicrob. Chemother. 1991, 27, 863–864. [Google Scholar] [CrossRef] [Scilit]
  65. Moody, J. Synergism testing: Broth microdilution checkerboard and broth macrodilution method. In Clinical Microbiology Procedures Handbook; ASM Press: Washington, DC, USA, 2004; pp. 1–28. [Google Scholar]
  66. Martins, M.; Viveiros, M.; Couto, I.; Costa, S.S.; Pacheco, T.; Fanning, S.; Pages, J.-M.; Amaral, L. Identification of efflux pump-mediated multidrug-resistant bacteria by the ethidium bromide-agar cartwheel method. In Vivo 2011, 25, 171–178. [Google Scholar] [PubMed]
  67. Liu, W.-W.; Meng, J.; Cui, J.; Luan, Y.-S. Characterization and function of microRNA∗ s in plants. Front. Plant Sci. 2017, 8, 2200. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  68. Deschaght, P.; De Baere, T.; Van Simaey, L.; De Baets, F.; De Vos, D.; Pirnay, J.-P.; Vaneechoutte, M. Comparison of the sensitivity of culture, PCR and quantitative real-time PCR for the detection of Pseudomonas aeruginosa in sputum of cystic fibrosis patients. BMC Microbiol. 2009, 9, 244. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  69. Béatrice, J.; Maud, P.; Stéphane, A.; François, C.; Frédéric, G.; Benoit, G.; Marie-Odile, H. Relative expression of Pseudomonas aeruginosa virulence genes analyzed by a real time RT-PCR method during lung infection in rats. FEMS Microbiol. Lett. 2005, 243, 271–278. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  70. Pourakbari, B.; Yaslianifard, S.; Yaslianifard, S.; Mahmoudi, S.; Keshavarz-Valian, S.; Mamishi, S. Evaluation of efflux pumps gene expression in resistant Pseudomonas aeruginosa isolates in an Iranian referral hospital. Iran. J. Microbiol. 2016, 8, 249. [Google Scholar]
  71. Razali, N.M.; Wah, Y.B. Power comparisons of shapiro-wilk, kolmogorov-smirnov, lilliefors and anderson-darling tests. J. Stat. Model. Anal. 2011, 2, 21–33. [Google Scholar]
  72. SAS Institute. SAS/OR 9.3 User’s Guide: Mathematical Programming Examples; SAS Institute: Cary, NC, USA, 2012. [Google Scholar]
Figure 1. Comparison of checkerboard result vs. both of ciprofloxacin (A) and cinnamon oil (B), efflux pump activity vs. anti-Efflux pump activity for both of MC EtBr (C) and index (D). CIP, ciprofloxacin, MC EtBr, minimum EtBr concentration. * Statistically significant at p-value < 0.05, *** highly significant at p-value < 0.001.
Figure 1. Comparison of checkerboard result vs. both of ciprofloxacin (A) and cinnamon oil (B), efflux pump activity vs. anti-Efflux pump activity for both of MC EtBr (C) and index (D). CIP, ciprofloxacin, MC EtBr, minimum EtBr concentration. * Statistically significant at p-value < 0.05, *** highly significant at p-value < 0.001.
Antibiotics 12 01514 g001
Figure 2. Relative expression of the efflux pump genes post treatment with cinnamon essential oil in drug resistant P. aeruginosa isolates. As presented in Table 4, chicken cloacal swab code no.9, human burn code no. 11 and mastitis milk code no. 12.
Figure 2. Relative expression of the efflux pump genes post treatment with cinnamon essential oil in drug resistant P. aeruginosa isolates. As presented in Table 4, chicken cloacal swab code no.9, human burn code no. 11 and mastitis milk code no. 12.
Antibiotics 12 01514 g002
Table 1. Occurrence of P. aeruginosa in animal and human samples.
Table 1. Occurrence of P. aeruginosa in animal and human samples.
Sample (No.)No. of P. aeruginosa Isolates (%)p-Value
Poultry samples (110)80 (72.73)
Cloacal swabs (20)15 (75)
Lung and trachea (30)22 (73.33)
Cecal contents (23)15 (65.22)0.7531
Chicken heart (15)10 (66.67)
Chicken liver (22)18 (81.82)
Mastitis milk (24)18 (75)
Human samples (27)21 (77.78)0.4281
Burn swabs (16)13 (81.25)
Urine (11)8 (72.73)
Total (161)119 (73.91)0.8591
Table 2. Resistance frequency of P. aeruginosa recovered from different sources.
Table 2. Resistance frequency of P. aeruginosa recovered from different sources.
Antimicrobial ClassAntimicrobial AgentNo. of Resistant P. aeruginosa Isolated from Different Sources (%)No. (%)p-Value
Poultry (80)Human (21)Cattle (18)
AminoglycosidesGentamicin25 (31.25%)7 (33.33%)3 (16.67%)35 (29.41%)0.4281
Tobramycin25 (31.25%)7 (33.33%)3 (16.67%)35 (29.41%)0.4281
Amikacin25 (31.25%)7 (33.33%)3 (16.67%)35 (29.41%)0.4281
Netilmicin25 (31.25%)7 (33.33%)3 (16.67%)35 (29.41%)0.4281
CarbapenemsImipenem2 (2.5%)3 (14.28%)0 (0%)5 (4.2%)0.0356
Meropenem3 (3.75%)3 (14.29%)0 (0%)6 (5.04%)0.0428
Doripenem3 (3.75%)3 (14.29%)0 (0%)6 (5.04%)0.0428
CephalosporinCeftazidime27 (33.75%)12 (57.14%)7 (38.89%)46 (38.66%)0.1467
Cefepime27 (33.75%)12 (57.14%)7 (38.89%)46 (38.66%)0.1467
FluoroquinolonesCiprofloxacin16 (20%)2 (9.52%)1 (5.56%)19 (15.97%)0.2150
Levofloxacin16 (20%)2 (9.52%)1 (5.56%)19 (15.97%)0.2150
PenicillinTicarcillin-clavulanic acid6 (7.5%)1 (4.76%)1 (5.56%)8 (6.72%)0.8847
Piperacillin-tazobactam6 (7.5%)1 (4.76%)1 (5.56%)8 (6.72%)0.8847
MonobactamAztreonam23 (28.75%)15 (71.43%)2 (11.11%)40 (33.61%)0.0001
Phosphonic acidsFosfomycin80 (100%)21 (100%)18 (100%)119 (100%)1.00
PolypeptideColistin66 (82.5%)9 (42.86%)14 (77.78%)89 (74.79%)0.0018
Polymyxin B66 (82.5%)9 (42.86%)14 (77.78%)89 (74.79%)0.0018
MDR-38 (47.5%)12 (57.14%)8 (44.44%)58 (48.74%)0.6785
XDR-8 (10%)2 (9.52%)1 (5.56%)11 (9.24%)0.8401
PDR-1 (1.25%)0 (0%)0 (0%)1 (0.84%)0.7821
MDR, multidrug-resistance; XDR, extensive drug-resistance; PDR, pan drug-resistance. Bold values indicate significant differences at p < 0.05.
Table 3. Chemical constituents of cinnamon essential oil.
Table 3. Chemical constituents of cinnamon essential oil.
CompoundRetention Time (min)Area under Peak%
Benzyl alcohol8.90434162727.8116.67
Linalyl iso-valerate14.9915320755.752.6
Cinnamaldehyde15.557160046038.478.1
Eugenol17.7813073334.821.5
β-Caryophyllene19.4212312309.181.13
Table 4. Phenotypic characterization of XDR Pseudomonas isolates.
Table 4. Phenotypic characterization of XDR Pseudomonas isolates.
Isolate No.SourceAntimicrobial Resistant PatternMAR IndexMIC (µg/mL)Checkerboard Result MIC (µg/mL)Efflux Pump
Activity
Anti-Efflux Pump
Activity
CIPCinnamon OilMC EtBr (µg/mL)Index MC EtBr (µg/mL)Index
1Chicken cloacal swabGEN, AK, NET, TOB, CAZ, FEP, PTZ, TIC, ATM, FF, PB, CT0.7020.250.5/0.031241527
2Chicken heartGEN, AK, NET, TOB, CAZ, FEP, CIP, PTZ, TIC, ATM, FF, PB, CT0.7640.254/0.252713
3Chicken heartGEN, AK, NET, TOB, CAZ, FEP, CIP, PTZ, TIC, ATM, FF, PB, CT0.7640.1254/0.12541527
4Chicken cecal contentGEN, AK, NET, TOB, CAZ, FEP, CIP, PTZ, TIC, ATM, FF, PB, CT0.76160.1258/0.01562713
5Chicken cloacal swabGEN, AK, NET, TOB, CAZ, FEP, CIP, LEV, ATM, FF, PB, CT0.701280.1252/0.007841527
6Chicken liverGEN, AK, NET, TOB, CAZ, FEP, CIP, LEV, ATM, FF, PB, CT0.701280.254/0.03124152.59
7Chicken liverGEN, AK, NET, TOB, CAZ, FEP, CIP, LEV, ATM, FF, PB, CT0.702560.258/0.031241527
8Chicken cecal contentGEN, AK, NET, TOB, CAZ, FEP, CIP, IPM, MRP, DOR, PTZ, TIC, ATM, FF, PB, CT0.94640.2564/0.01562.591.55
9Chicken cloacal swabGEN, AK, NET, TOB, IPM, MRP, DOR, CAZ, FEP, CIP, LEV, PTZ, TIC, ATM, FF, PB, CT1320.12532/0.01564152.59
10Human burn CAZ, FEP, CIP, LEV, PTZ, TIC, ATM, FF, PB, CT0.58320.1251/0.00781.5513
11Human burn GEN, AK, NET, TOB, IPM, MRP, DOR, CAZ, FEP, CIP, LEV, ATM, FF, PB, CT0.881280.2564/0.03124152.59
12Mastitis milkGEN, AK, NET, TOB, CAZ, FEP, PTZ, TIC, ATM, FF, PB, CT0.7020.1251/0.01562713
Mean ± SE 66.333 ± 22.751 *0.187 ± 0.018 Π16.041 ± 6.914/
0.048 ± 0.020
3.166 ± 0.303 11.667 ±1.214 1.75 ± 0.1796.00 ± 0.717
MIC, minimum inhibitory concentration; GEN, gentamicin; AK, amikacin; NET, netilmicin; TOB, tobramycin; IPM, imipenem; MRP, meropenem; DOR, doripenem CAZ, ceftazidime; FEP, cefepime CIP, ciprofloxacin LEV, levofloxacin; PTZ, ticarcillin-clavulanic acid; TIC, piperacillin-tazobactam; ATM, aztreonam FF, fosfomycin; PB, polymyxin B; CT, colistin; MAR, multiple antibiotic resistance; MIC, minimum inhibitory concentration; MC EtBr, minimum EtBr concentration; SE, standard error *, Π, , differ significantly with checkerboard, MC EtBr, and Index, respectively. All isolates were XDR except the isolate No. 9 was PDR.
Table 5. Oligonucleotide primers used in the study.
Table 5. Oligonucleotide primers used in the study.
Target GenePrimers Sequences 5 → 3′SpecificityAnnealing
Temperature (° C)
Product Size (bp)References
16S rRNAF: GACGGGTGAGTAATGCCTA
R: CACTGGTGTTCCTTCCTATA
Pseudomonas species54618[54]
oprLF: ATGGAAATGCTGAAATTCGGC
R: CTTCTTCAGCTCGACGCGACG
P. aeruginosa and an internal control57504[68,69]
mexAF:ACCTACGAGGCCGACTACCAGA
R: GTTGGTCACCAGGGCGCCTTC
Efflux pump gene61179[70]
mexBF: GTGTTCGGCTCGCAGTACTC
R: AACCGTCGGGATTGACCTTG
Efflux pump gene244
F, forward; R, reverse; bp, base pair.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Abdelatti, M.A.I.; Abd El-Aziz, N.K.; El-Naenaeey, E.-s.Y.M.; Ammar, A.M.; Alharbi, N.K.; Alharthi, A.; Zakai, S.A.; Abdelkhalek, A. Antibacterial and Anti-Efflux Activities of Cinnamon Essential Oil against Pan and Extensive Drug-Resistant Pseudomonas aeruginosa Isolated from Human and Animal Sources. Antibiotics 2023, 12, 1514. https://doi.org/10.3390/antibiotics12101514

AMA Style

Abdelatti MAI, Abd El-Aziz NK, El-Naenaeey E-sYM, Ammar AM, Alharbi NK, Alharthi A, Zakai SA, Abdelkhalek A. Antibacterial and Anti-Efflux Activities of Cinnamon Essential Oil against Pan and Extensive Drug-Resistant Pseudomonas aeruginosa Isolated from Human and Animal Sources. Antibiotics. 2023; 12(10):1514. https://doi.org/10.3390/antibiotics12101514

Chicago/Turabian Style

Abdelatti, Mohamed A. I., Norhan K. Abd El-Aziz, El-sayed Y. M. El-Naenaeey, Ahmed M. Ammar, Nada K. Alharbi, Afaf Alharthi, Shadi A. Zakai, and Adel Abdelkhalek. 2023. "Antibacterial and Anti-Efflux Activities of Cinnamon Essential Oil against Pan and Extensive Drug-Resistant Pseudomonas aeruginosa Isolated from Human and Animal Sources" Antibiotics 12, no. 10: 1514. https://doi.org/10.3390/antibiotics12101514

APA Style

Abdelatti, M. A. I., Abd El-Aziz, N. K., El-Naenaeey, E.-s. Y. M., Ammar, A. M., Alharbi, N. K., Alharthi, A., Zakai, S. A., & Abdelkhalek, A. (2023). Antibacterial and Anti-Efflux Activities of Cinnamon Essential Oil against Pan and Extensive Drug-Resistant Pseudomonas aeruginosa Isolated from Human and Animal Sources. Antibiotics, 12(10), 1514. https://doi.org/10.3390/antibiotics12101514

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop