Characterization of Mutations Associated with Streptomycin Resistance in Multidrug-Resistant Mycobacterium tuberculosis in Zambia
Abstract
:1. Introduction
2. Results
2.1. Correlation between Genotypes and STR Resistance
2.2. Mutations in rpsL
2.3. Mutations in rrs
2.4. Mutations in gidB
2.5. Association of Genotype and Mutations in rpsL, rrs and gidB
2.6. Molecular Determination of STR Resistance
3. Discussion
4. Materials and Methods
4.1. Samples and DST
4.2. DNA Extraction, PCR Amplification and Sequencing of rpsL, rrs, and gidB Genes
4.3. Spoligotyping
4.4. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- World Health Organisation Global Tuberculosis Report 2020; World Health Organisation: Geneva, Switzeland, 2020; ISBN 9789240013131.
- World Health Organization Tuberculosis Country Profile: Zambia. Available online: https://worldhealthorg.shinyapps.io/tb_profiles/?_inputs_&entity_type=%22country%22&lan=%22EN%22&iso2=%22ZM%22 (accessed on 13 August 2021).
- Kapata, N.; Chanda-Kapata, P.; Bates, M.; Mwaba, P.; Cobelens, F.; Grobusch, M.P.; Zumla, A. Multidrug-resistant TB in Zambia: Review of national data from 2000 to 2011. Trop. Med. Int. Health 2013, 18, 1386–1391. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Solo, E.S.; Nakajima, C.; Kaile, T.; Bwalya, P.; Mbulo, G.; Fukushima, Y.; Chila, S.; Kapata, N.; Shah, Y.; Suzuki, Y. Mutations of rpoB, katG and inhA genes in multidrug-resistant Mycobacterium tuberculosis isolates from Zambia. J. Glob. Antimicrob. Resist. 2020, 13, 98–99. [Google Scholar] [CrossRef] [PubMed]
- Solo, E.S.; Suzuki, Y.; Kaile, T.; Bwalya, P.; Lungu, P.; Chizimu, J.Y.; Shah, Y.; Nakajima, C. Characterization of Mycobacterium tuberculosis genotypes and their correlation to multidrug resistance in Lusaka, Zambia. Int. J. Infect. Dis. 2021, 102, 489–496. [Google Scholar] [CrossRef]
- World Health Organization. Global Tuberculosis Report 2019; WHO: Geneva, Switzeland, 2019; ISBN 964-7445-88-1. [Google Scholar]
- World Health Organization. WHO Consolidated Guidelines on Tuberculosis. Module 4: Treatment Drug-Resistant Tuberculosis Treatment; World Health organisation: Geneva, Switzeland, 2020; ISBN 9789240007048. [Google Scholar]
- Carter, A.P.; Clemons, W.M.; Brodersen, D.E.; Morgan-Warren, R.J.; Wimberly, B.T.; Ramakrishnan, V. Functional insights from the structure of the 30S ribosomal subunit and its interactions with antibiotics. Nature 2000, 407, 340–348. [Google Scholar] [CrossRef] [PubMed]
- Tudó, G.; Rey, E.; Borrell, S.; Alcaide, F.; Codina, G.; Coll, P.; Martín-Casabona, N.; Montemayor, M.; Moure, R.; Orcau, À.; et al. Characterization of mutations in streptomycin-resistant Mycobacterium tuberculosis clinical isolates in the area of Barcelona. J. Antimicrob. Chemother. 2010, 65, 2341–2346. [Google Scholar] [CrossRef] [Green Version]
- Okamoto, S.; Tamaru, A.; Nakajima, C.; Nishimura, K.; Tanaka, Y.; Tokuyama, S.; Suzuki, Y.; Ochi, K. Loss of a conserved 7-methylguanosine modification in 16S rRNA confers low-level streptomycin resistance in bacteria. Mol. Microbiol. 2007, 63, 1096–1106. [Google Scholar] [CrossRef]
- Wong, S.Y.; Javid, B.; Addepalli, B.; Piszczek, G.; Strader, M.B.; Limbach, P.A.; Barry, C.E. Functional role of methylation of G518 of the 16S rRNA 530 loop by GidB in Mycobacterium tuberculosis. Antimicrob. Agents Chemother. 2013, 57, 6311–6318. [Google Scholar] [CrossRef] [Green Version]
- Cohen, K.A.; Stott, K.E.; Munsamy, V.; Manson, A.L.; Earl, A.M.; Pym, A.S. Evidence for Expanding the Role of Streptomycin in the Management of Drug-Resistant Mycobacterium tuberculosis. Antimicrob. Agents Chemother. 2020, 64, e00860-20. [Google Scholar] [CrossRef]
- Elliott, A.M.; Halwiindi, B.; Hayes, R.J.; Luo, N.; Mwinga, A.G.; Tembo, G.; Machiels, L.; Steenbergen, G.; Pobee, J.O.M.; Nunn, P.; et al. The impact of human immunodeficiency virus on mortality of patients treated for tuberculosis in a cohort study in Zambia. Trans. R. Soc. Trop. Med. Hyg. 1995, 89, 78–82. [Google Scholar] [CrossRef]
- Hosp, M.; Elliott, A.M.; Raynes, J.G.; Mwinga, A.G.; Luo, N.; Zangerle, R.; Pobee, J.O.M.; Wachter, H.; Dierich, M.P.; McAdam, K.P.W.J.; et al. Neopterin, β2-Microglobulin, and Acute Phase Proteins in HIV-1-Seropositive and -Seronegative Zambian Patients with Tuberculosis. Lung 1997, 175, 265–275. [Google Scholar] [CrossRef]
- Ministry of Health, Government of the Republic of Zambia. The National Tuberculosis and Leprosy Programme: TB Manual; Ministry of Health, Government of the Republic of Zambia: Lusaka, Zambia, 2008; pp. 32–33. [CrossRef] [Green Version]
- Lukoye, D.; Adatu, F.; Musisi, K.; Kasule, G.W.; Were, W.; Odeke, R.; Kalamya, J.N.; Awor, A.; Date, A.; Joloba, M.L. Anti-Tuberculosis Drug Resistance among New and Previously Treated Sputum Smear-Positive Tuberculosis Patients in Uganda: Results of the First National Survey. PLoS ONE 2013, 8. [Google Scholar] [CrossRef]
- World Health Organization WHO Global Lists of High Burden Countries for Tuberculosis ( TB ), TB/HIV and TB ( MDR/RR-TB ), 2021–2025; World Health Organisation: Geneva, Switzeland, 2021; ISBN 9789240029439.
- Chihota, V.; Apers, L.; Mungofa, S.; Kasongo, W.; Nyoni, I.M.; Tembwe, R.; Mbulo, G.; Tembo, M.; Streicher, E.M.; Van Der Spuy, G.D.; et al. Predominance of a single genotype of Mycobacterium tuberculosis in regions of Southern Africa. Int. J. Tuberc. Lung Dis. 2007, 11, 311–318. [Google Scholar] [PubMed]
- Mulenga, C.; Shamputa, I.C.; Mwakazanga, D.; Kapata, N.; Portaels, F.; Rigouts, L. Diversity of Mycobacterium tuberculosis genotypes circulating in Ndola, Zambia. BMC Infect. Dis. 2010, 10, 177. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Thida Oo, N.A.; San, L.L.; Thapa, J.; Aye, K.S.; Aung, W.W.; Nakajima, C.; Suzuki, Y. Characterization of mutations conferring streptomycin resistance to multidrug-resistant Mycobacterium tuberculosis isolates from Myanmar. Tuberculosis 2018, 111, 8–13. [Google Scholar] [CrossRef] [PubMed]
- Zhao, L.; Liu, H.; Sun, Q.; Xiao, T.; Zhao, X.; Li, G.; Zeng, C.; Wan, K. Identification of mutations conferring streptomycin resistance in multidrug-resistant tuberculosis of China. Diagn. Microbiol. Infect. Dis. 2015, 83, 150–153. [Google Scholar] [CrossRef]
- Phelan, J.E.; O’Sullivan, D.M.; Machado, D.; Ramos, J.; Oppong, Y.E.A.; Campino, S.; O’Grady, J.; McNerney, R.; Hibberd, M.L.; Viveiros, M.; et al. Integrating informatics tools and portable sequencing technology for rapid detection of resistance to anti-tuberculous drugs. Genome Med. 2019, 11, 1–7. [Google Scholar] [CrossRef] [Green Version]
- Sander, P.; Springer, B.; Prammananan, T.; Sturmfels, A.; Kappler, M.; Pletschette, M.; Böttger, E.C. Fitness cost of chromosomal drug resistance-conferring mutations. Antimicrob. Agents Chemother. 2002, 46, 1204–1211. [Google Scholar] [CrossRef] [Green Version]
- Sun, H.; Zhang, C.; Xiang, L.; Pi, R.; Guo, Z.; Zheng, C.; Li, S.; Zhao, Y.; Tang, K.; Luo, M.; et al. Characterization of mutations in streptomycin-resistant Mycobacterium tuberculosis isolates in Sichuan, China and the association between Beijing-lineage and dual-mutation in gidB. Tuberculosis 2016, 96, 102–106. [Google Scholar] [CrossRef]
- Verma, J.S.; Gupta, Y.; Nair, D.; Manzoor, N.; Rautela, R.S.; Rai, A.; Katoch, V.M. Evaluation of gidB alterations responsible for streptomycin resistance in Mycobacterium tuberculosis. J. Antimicrob. Chemother. 2014, 69, 2935–2941. [Google Scholar] [CrossRef] [Green Version]
- Bauskenieks, M.; Pole, I.; Skenders, G.; Jansone, I.; Broka, L.; Nodieva, A.; Ozere, I.; Kalvisa, A.; Ranka, R.; Baumanis, V. Genotypic and phenotypic characteristics of aminoglycoside-resistant Mycobacterium tuberculosis isolates in Latvia. Diagn. Microbiol. Infect. Dis. 2015, 81, 177–182. [Google Scholar] [CrossRef]
- Lanzas, F.; Karakousis, P.C.; Sacchettini, J.C.; Ioerger, T.R. Multidrug-Resistant Tuberculosis in Panama Is Driven by Clonal Expansion of a Multidrug-Resistant Mycobacterium tuberculosis Strain Related to the KZN Extensively Drug-Resistant M. tuberculosis Strain from South Africa. J. Clin. Microbiol. 2013, 51, 3277–3285. [Google Scholar] [CrossRef] [Green Version]
- Casali, N.; Nikolayevskyy, V.; Balabanova, Y.; Harris, S.R.; Ignatyeva, O.; Kontsevaya, I. Evolution and transmission of drug-resistant tuberculosis in a Russian population. Nat. Genet. 2014, 46, 279–286. [Google Scholar] [CrossRef] [Green Version]
- Wong, S.Y.; Lee, J.S.; Kwak, H.K.; Via, L.E.; Boshoff, H.I.M.; Barry, C.E. Mutations in gidB confer low-level streptomycin resistance in Mycobacterium tuberculosis. Antimicrob. Agents Chemother. 2011, 55, 2515–2522. [Google Scholar] [CrossRef] [Green Version]
- Coll, F.; McNerney, R.; Guerra-Assunção, J.A.; Glynn, J.R.; Perdigão, J.; Viveiros, M.; Portugal, I.; Pain, A.; Martin, N.; Clark, T.G. A robust SNP barcode for typing Mycobacterium tuberculosis complex strains. Nat. Commun. 2014, 5, 4812. [Google Scholar] [CrossRef] [Green Version]
- Feuerriegel, S.; Köser, C.U.; Niemann, S. Phylogenetic polymorphisms in antibiotic resistance genes of the mycobacterium tuberculosis complex. J. Antimicrob. Chemother. 2014, 69, 1205–1210. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chihota, V.N.; Niehaus, A.; Streicher, E.M.; Wang, X.; Sampson, S.L.; Mason, P.; Källenius, G.; Mfinanga, S.G.; Pillay, M.; Klopper, M.; et al. Geospatial distribution of Mycobacterium tuberculosis genotypes in Africa. PLoS ONE 2018, 13, 1–18. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mbugi, E.V.; Katale, B.Z.; Streicher, E.M.; Keyyu, J.D.; Kendall, S.L.; Dockrell, H.M.; Michel, A.L.; Rweyemamu, M.M.; Warren, R.M.; Matee, M.I.; et al. Mapping of Mycobacterium tuberculosis Complex Genetic Diversity Profiles in Tanzania and Other African Countries. PLoS ONE 2016, 11, eo154571. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Katale, B.Z.; Mbelele, P.M.; Lema, N.A.; Campino, S.; Mshana, S.E.; Rweyemamu, M.M.; Phelan, J.E.; Keyyu, J.D.; Majigo, M.; Mbugi, E. V.; et al. Whole genome sequencing of Mycobacterium tuberculosis isolates and clinical outcomes of patients treated for multidrug-resistant tuberculosis in Tanzania. BMC Genomics 2020, 21, 1–15. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Coll, F.; Phelan, J.; Hill-Cawthorne, G.A.; Nair, M.B.; Mallard, K.; Ali, S. Genome-wide analysis of multi- and extensively drug-resistant Mycobacterium tuberculosis. Nat. Genet. 2018, 50, 307–316. [Google Scholar] [CrossRef] [Green Version]
- Miotto, P.; Tessema, B.; Tagliani, E.; Chindelevitch, L.; Starks, A.M.; Emerson, C.; Hanna, D.; Kim, P.S.; Liwski, R.; Zignol, M.; et al. A standardised method for interpreting the association between mutations and phenotypic drug resistance in Mycobacterium tuberculosis. Eur. Respir. J. 2017, 50, 1701354. [Google Scholar] [CrossRef] [Green Version]
- Perdigão, J.; Clemente, S.; Ramos, J.; Masakidi, P.; Machado, D.; Silva, C.; Couto, I.; Viveiros, M.; Taveira, N.; Portugal, I. Genetic diversity, transmission dynamics and drug resistance of Mycobacterium tuberculosis in Angola OPEN. Nat. Publ. Gr. 2017, 7, 42814. [Google Scholar] [CrossRef] [Green Version]
- Rando-Segura, A.; Aznar, M.L.; Moreno, M.M.; Espasa, M.; Sulleiro, E.; Bocanegra, C.; Gil, E.; Eugénio, A.N.E.; Escartin, C.; Zacarias, A.; et al. Drug Resistance of Mycobacterium tuberculosis Complex in a Rural Setting, Angola. Emerg. Infect. Dis. 2018, 24, 569–572. [Google Scholar] [CrossRef]
- Eldholm, V.; Monteserin, J.; Rieux, A.; Lopez, B.; Sobkowiak, B.; Ritacco, V. Four decades of transmission of a multidrug-resistant Mycobacterium tuberculosis outbreak strain. Nat. Commun. 2015, 6, 7119. [Google Scholar] [CrossRef] [Green Version]
- Oppong, Y.E.A.; Phelan, J.; Perdigão, J.; Machado, D.; Miranda, A.; Portugal, I.; Viveiros, M.; Clark, T.G.; Hibberd, M.L. Genome-wide analysis of Mycobacterium tuberculosis polymorphisms reveals lineage-specific associations with drug resistance. BMC Genomics 2019, 20, 252. [Google Scholar] [CrossRef]
- Borrell, S.; Gagneux, S. Strain diversity, epistasis and the evolution of drug resistance in Mycobacterium tuberculosis. Clin. Microbiol. Infect. 2011, 17, 815–820. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hall, T.A. BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 1999, 41, 95–98. [Google Scholar]
- Kamerbeek, J.; Schouls, L.; Kolk, A.; Van Agterveld, M.; van Soolingen, D.; Kuijper, S.; Bunschoten, A.; Molhuizen, H.; Shaw, R.; Goyal, M.; et al. Simultaneous detection and strain differentiation of Mycobacterium tuberculosis for diagnosis and epidemiology. JCM 1997, 35, 907–914. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Brudey, K.; Driscoll, J.R.; Rigouts, L.; Prodinger, W.M.; Gori, A.; Al-Hajoj, S.A.; Allix, C.; Aristimuño, L.; Arora, J.; Baumanis, V.; et al. Mycobacterium tuberculosis complex genetic diversity: Mining the fourth international spoligotyping database (SpolDB4) for classification, population genetics and epidemiology. BMC Microbiol. 2006, 6, 1–17. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Spoligotype | Streptomycin Resistant | Streptomycin Susceptible | Significance | ||||
---|---|---|---|---|---|---|---|
SIT | Clade | n = 91 | Proportion (%) | n = 47 | Proportion (%) | Odds Ratio (95%CI) | p Value |
21 | CAS1_Kili | 29 | 31.9 | 5 | 10.6 | 3.9 (1.4 to 11.0) | 0.009 |
59 | LAM11_ZWE | 21 | 23.1 | 8 | 17.0 | 1.5 (0.6–3.6) | 0.4096 |
20 | LAM1 | 4 | 4.4 | 13 | 27.7 | 0.1 (0.04–0.39) | 0.0005 |
815 | LAM11_ZWE | 10 | 11.0 | 3 | 6.4 | 1.8 (0.5–6.9) | 0.39 |
53 | T1 | 8 | 8.8 | 4 | 8.5 | 1.0 (0.3–3.6) | 0.96 |
Orphan | LAM11_ZWE | 4 | 4.4 | 1 | 2.1 | ||
137 | X2 | 3 | 3.3 | 4 | 8.5 | ||
52 | T2 | 3 | 3.3 | 2 | 4.3 | ||
Orphan | H1 | 2 | 2.2 | 2 | 4.3 | ||
42 | LAM9 | 1 | 1.1 | 2 | 4.3 | ||
4 | H3/T1 | 0 | 0.0 | 1 | 2.1 | ||
Orphan | EAI | 2 | 2.2 | 0 | 0.0 | ||
34 | S | 1 | 1.1 | 0 | 0.0 | ||
50 | H3 | 1 | 1.1 | 0 | 0.0 | ||
73 | T | 0 | 0.0 | 1 | 2.1 | ||
317 | T2 | 1 | 1.1 | 0 | 0.0 | ||
811 | LAM11_ZWE | 1 | 1.1 | 0 | 0.0 | ||
2173 | LAM11_ZWE | 0 | 0.0 | 1 | 2.1 |
rpsL (DNA) | RpsL (Protein) | rrs | gidB (DNA) | GidB (Protein) | STR Resistant | STR Susceptible |
---|---|---|---|---|---|---|
A128G | K43R | 21 | 0 | |||
A263G | K88R | 8 | 0 | |||
A262C | K88Q | 1 | 0 | |||
A514C | 3 | 0 | ||||
C517T | 2 | 0 | ||||
C517T | C548T | A183V | 1 | 0 | ||
A906G | G211C | G71R | 2 | 0 | ||
A907C | 3 | 0 | ||||
25_88del | 9fs | 1 | 0 | |||
T64C | Y22H | 3 | 2 | |||
98delG | 34fs | 3 | 1 | |||
G109A | G37R | 3 | 1 | |||
112delC | 39fs | 4 | 1 | |||
C223T | P75S | 1 | 0 | |||
G227A | G76D | 1 | 0 | |||
T242C | I81T | 1 | 0 | |||
T298C | F100L | 1 | 1 | |||
347delG | 117fs | 5 | 2 | |||
T371G | V124G | 5 | 1 | |||
C401A | A134E | 1 | 0 | |||
G412C | A138P | 3 | 1 | |||
C447G | S149R | 0 | 1 | |||
T455C | L152S | 2 | 0 | |||
G469C | G157R | 2 | 0 | |||
575_576delGC | 193fs | 2 | 0 | |||
T611A, C612A | 204 Stop | 4 | 1 | |||
No mutations | 8 | 35 |
rpsL (DNA) | RpsL (Protein) | rrs | gidB (DNA) | GidB (Protein) | CAS | LAM | H | T | S | X | EAI |
---|---|---|---|---|---|---|---|---|---|---|---|
A128G | K43R | 16 | 2 | 1 | 1 | 1 | |||||
A263G | K88R | 4 | 1 | 3 | |||||||
A262C | K88Q | 1 | |||||||||
A514C | 3 | ||||||||||
C517T | 2 | ||||||||||
C517T | C548T | A183V | 1 | ||||||||
A906G | G330T | G71R | 2 | ||||||||
A907C | 3 | ||||||||||
25_88del | 9fs | 1 | |||||||||
T64C | Y22H | 5 | |||||||||
98delG | 34fs | 4 | |||||||||
G109A | G37R | 4 | |||||||||
112delC | 39fs | 5 | |||||||||
C223T | P75S | 1 | |||||||||
G227A | G76D | 1 | |||||||||
T242C | I81T | 1 | |||||||||
T298C | F100L | 2 | |||||||||
347delG | 117fs | 3 | 4 | ||||||||
T371G | V124G | 6 | |||||||||
C401A | A134E | 1 | |||||||||
G412C | A138P | 4 | |||||||||
C447G | S149R | 1 | |||||||||
T455C | L152S | 2 | |||||||||
G469C | G157R | 2 | |||||||||
575_576delGC | 193fs | 2 | |||||||||
T611A, C612A | 204 Stop | 5 | |||||||||
No mutations | 3 | 27 | 3 | 8 | 2 | ||||||
Total | 34 | 69 | 6 | 19 | 1 | 7 | 2 |
Correlation of Drug Resistance Genotype and Phenotype | ||||||||
---|---|---|---|---|---|---|---|---|
Susceptible | Resistant | Sensitivity (%) | Specificity (%) | PPV (%) | NPV (%) | |||
Mutation | No Mutation | Mutation | No Mutation | |||||
rpsL | 0 | 47 | 30 | 61 | 33.0 | 100 | 100 | 43.5 |
rrs | 0 | 47 | 11 | 80 | 12.1 | 100 | 100 | 37.0 |
gidB | 12 | 35 | 45 | 46 | 49.5 | 74.5 | 78.9 | 43.2 |
rrs or rpsL | 0 | 47 | 41 | 50 | 45.1 | 100 | 100 | 48.5 |
rpsL or rrs or gidB | 12 | 35 | 83 | 8 | 91.2 | 74.5 | 87.4 | 81.4 |
Gene | Primer Set | |
---|---|---|
rrs | Foward | GATGACGGCCTTCGGGTTGT |
Reverse | AGGCCACAAGGGAACGCCTA | |
rpsL | Foward | GGCCGACAAACAGAACGT |
Reverse | GTTCACCAACTGGGTGAC | |
gidB | Foward | CGCCGAGTCGTTGTGCT |
Reverse | AGCCTGGCCCGACCTTA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Bwalya, P.; Yamaguchi, T.; Solo, E.S.; Chizimu, J.Y.; Mbulo, G.; Nakajima, C.; Suzuki, Y. Characterization of Mutations Associated with Streptomycin Resistance in Multidrug-Resistant Mycobacterium tuberculosis in Zambia. Antibiotics 2021, 10, 1169. https://doi.org/10.3390/antibiotics10101169
Bwalya P, Yamaguchi T, Solo ES, Chizimu JY, Mbulo G, Nakajima C, Suzuki Y. Characterization of Mutations Associated with Streptomycin Resistance in Multidrug-Resistant Mycobacterium tuberculosis in Zambia. Antibiotics. 2021; 10(10):1169. https://doi.org/10.3390/antibiotics10101169
Chicago/Turabian StyleBwalya, Precious, Tomoyuki Yamaguchi, Eddie Samuneti Solo, Joseph Yamweka Chizimu, Grace Mbulo, Chie Nakajima, and Yasuhiko Suzuki. 2021. "Characterization of Mutations Associated with Streptomycin Resistance in Multidrug-Resistant Mycobacterium tuberculosis in Zambia" Antibiotics 10, no. 10: 1169. https://doi.org/10.3390/antibiotics10101169
APA StyleBwalya, P., Yamaguchi, T., Solo, E. S., Chizimu, J. Y., Mbulo, G., Nakajima, C., & Suzuki, Y. (2021). Characterization of Mutations Associated with Streptomycin Resistance in Multidrug-Resistant Mycobacterium tuberculosis in Zambia. Antibiotics, 10(10), 1169. https://doi.org/10.3390/antibiotics10101169