Next Article in Journal
A Comparative Study on the Hydrodynamic-Energy Loss Characteristics between a Ducted Turbine and a Shaftless Ducted Turbine
Next Article in Special Issue
The Isolation of Vibrio crassostreae and V. cyclitrophicus in Lesser-Spotted Dogfish (Scyliorhinus canicula) Juveniles Reared in a Public Aquarium
Previous Article in Journal
Numerical Simulation of the Ice Breaking Process for Hovercraft
Previous Article in Special Issue
Detection of Infectious Hypodermal and Hematopoietic Necrosis Virus (IHHNV, Decapod Penstylhamaparvovirus 1) in Commodity Red Claw Crayfish (Cherax quadricarinatus) Imported into South Korea
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
JMSE
Volume 9
Issue 9
10.3390/jmse9090929
jmse-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Bonamia exitiosa in European Flat Oyster (Ostrea edulis) on the Croatian Adriatic Coast from 2016 to 2020

by
Dražen Oraić
1,*,
Relja Beck
1,
Željko Pavlinec
1,
Ivana Giovanna Zupičić
1,
Ljupka Maltar
2,
Tihana Miškić
2,
Žaklin Acinger-Rogić
2 and
Snježana Zrnčić
1
1
Croatian Veterinary Institute, 10000 Zagreb, Croatia
2
Croatian Ministry of Agriculture-Veterinary and Food Safety Directorate General, 10000 Zagreb, Croatia
*
Author to whom correspondence should be addressed.
J. Mar. Sci. Eng. 2021, 9(9), 929; https://doi.org/10.3390/jmse9090929
Submission received: 23 June 2021 / Revised: 17 August 2021 / Accepted: 21 August 2021 / Published: 27 August 2021
(This article belongs to the Special Issue Microbial Diseases of Marine Organisms)
Browse Figures
Versions Notes

Abstract

:
The annual production of European flat oysters (Ostrea edulis) in Croatia is about 50 to 65 tons, and it has a long tradition. All Croatian oyster farms are subjected to the national surveillance program aiming to detect the presence of Bonamia ostreae and Marteilia refringens according to the Council Directive 2006/88/EC. Within the surveillance program, the first findings of the parasite Bonamia spp. occurred in 2016 in two production areas in the north and south of the Eastern Adriatic coast. The repeated findings of the parasite were noted up to 2020 but also on two additional sites in the north. The parasite was detected by cytological analysis of stained heart smears, histological examination, and PCR. PCR positive samples were sequenced for SSU rDNA gene, and BLAST analysis confirmed infection with Bonamia exitiosa. Attempts to prove the Pacific oyster as a putative vector of the parasite failed. The infection prevalence from 2016 until 2020 ranged from 3.3 to 20% in different sites. No mortalities were reported from the infected sites, and it seemed that infection of flat oysters with B. exitiosa did not affect their health. The study has not shown the source and way of infection spread, which imposes the need for more comprehensive molecular and epidemiological studies.

1. Introduction

The production of European flat oyster (Ostrea edulis) has a long tradition and economic significance in many countries of the Mediterranean basin and the East Atlantic coast. Along the Croatian coast, flat oysters have been cultivated for centuries, and in recent decades, the annual production has ranged from 50 to 65 t [1]. Production of O. edulis has stagnated since the 70s of the last century as a result of the introduction of pathogens into the susceptible population. Therefore, diseases have caused large losses and dramatically affected production [2,3,4]. One of these pathogens is the protozoan parasite Bonamia ostreae, belonging to the clade “microcell” within Haplosporidia [5]. Various methods have been developed to identify and confirm the presence of parasites of the genus Bonamia, but each of them has certain limitations. Microscopy of gill and heart-stained tissue impressions and histological slides are methods to identify and confirm Bonamia species. Identifying parasite species due to morphological similarity is time-consuming and requires experience and expertise. However, both these methods have low sensitivity and specificity [6,7,8,9], similar to TEM, which seems to be insufficient in the identification of species [10]. Diagnostic sensitivity has significantly improved with the implementation of molecular methods, such as PCR [11,12] or in situ hybridization.
Based on molecular studies of small ribosomal subunit rRNA genes, the genera Bonamia is phylogenetically positioned into a clade microcell within the genus Haplosporidia, and within it, includes four species: B. ostreae, B. exitiosa, B. roughleyi, and B. perspora [13,14,15,16]. All species of Bonamia cause infection of flat oyster hemocytes, leading to death [12]. In some cases, parasites are present in low prevalence and with little impact on the flat oyster population [17]. It has been reported that flat oysters exposed to parasites over a long period develop a certain degree of resistance [18]. Bonamia exitiosa was for the first time reported as the cause of the Chilean oyster’s (Ostrea chilensis) high mortality in New Zealand when only 9% of affected flat oysters survived [19]. Catastrophic and rapid mortality was caused by the same parasite on triploids of the Suminoe oyster (Crassostrea ariakensis), introduced for experimental cultivation in 2003 in Bogue Sound, North Carolina [20], in an area where the crested oyster (Ostreola equestris) was an indigenous species [15].
This paper presents the findings, distribution, and prevalence of the Bonamia exitiosa in the samples of flat oyster analyzed within the national surveillance program for the infection with Bonamia parasites.

2. Materials and Methods

2.1. Sampling

The sampling points within production areas were determined through an intensive monitoring program in the period from 1998 to 2000. Each year, according to the national surveillance program, authorized veterinarians sampled 30 adult flat oysters on each of nine sampling points along the Croatian Adriatic coast (Figure 1, Table 1). The samples were packed in a transport refrigerator and delivered to the laboratory within 24–36 h.
All samples submitted within the surveillance program in the period 2016 to 2020, from the B. exitiosa positive sites are listed in Table 2 and sites are shown in Figure 1. Namely, from the site of the Medulin Bay during the mentioned period (2016–2020), 180 flat oysters were submitted; from the Mali Ston Bay with five sampling sites, there were 900 individuals, while 180 individuals were submitted from the sites from Lim Bay, Savudrija Bay, and Marina Bay, respectively.
After the first finding of B. exitiosa positive flat oysters in the northern part of the Eastern Adriatic coast, epidemiological surveillance was carried out. It was found that there were some populations of Pacific oyster (Magallana = Crassostrea gigas) present in the Medulin Bay production area, and during 2017, a sample of 18 animals was collected to examine them as a possible source of infection. In 2018, after the detection of B. exitiosa in Lim Bay, another batch of 30 Pacific oyster was tested for the presence of this parasite.

2.2. Tissue Processing, Cytological and Histological Examination

After dissection of each oyster submitted for diagnostics, including Pacific oysters, tissues were collected for cytology, histology, and molecular analysis.
For cytological diagnosis of Bonamia spp., a piece of the heart of each oyster was taken and briefly dried on absorbent paper. A series of heart imprints were made in two rows on a glass slide. Imprints of five specimens were made on one slide and stained with Hemacolor® staining kit according to manufacturer instructions (Merck, Darmstadt, Germany).
For histological examination, transversal sections of soft tissue, including gills and the digestive gland of each oyster, were placed in histo-cassettes and immersed in Davidson’s formalin, alcohol, acetic acid (AFA) fixative. Davidson-fixed tissues were dehydrated through a graded series of ethanols, succeeded by xylene, and embedded in paraffin, sectioned at 3 μm, and mounted on Microme EC 350-2 slides (Thermo Scientific, Waltham, MA, USA). Mounted slides were heated to 60 °C, deparaffinized, and rehydrated in xylene, a graded series of alcohol, and finally, water, followed by staining with hematoxylin and eosin (H&E).
For detection of Bonamia spp. by PCR, gill samples were taken and preserved in ethanol 96% until DNA extraction.
Stained tissue impressions and histological sections were examined on a Zeiss Axiskop-2 binocular microscope (Carl Zeiss, Jena, Germany) at 400× and 1000× magnifications with immersion oil.

2.3. Molecular Detection and Characterization

2.3.1. DNA Extraction

DNA used in all molecular analyses was extracted from gill tissues from each animal. From the samples collected from 2016–2019, DNA was extracted using MagMAX CORE Nucleic Acid Purification Kit (Thermo Fisher Scientific, USA) on KingFisher Flex System (Thermo Fisher Scientific, Waltham, MA, USA). From the samples collected in 2020, DNA was extracted using innuPREP AniPath DNA/RNA Kit—IPC16 (Analytik Jena, Germany) on InnuPure C16 touch (Analytik Jena, Jena, Germany). Both methods of extraction were done according to the manufacturer’s instructions.

2.3.2. PCR and Sequencing

In the period from 2016 to 2018, a modified method developed by Cochennec et al. [11] for the detection of Bonamia sp was used. The reaction mix contained 10 μL of GoTaq G2 Hot Start Master Mix (Promega, Madison, WI, USA), 60 ng of DNA as measured on a DS-11 Series Spectrophotometer (DeNovix, Wilmington, NC, USA), 0.5 μM of each primer (BO 5′ 3′, BOAS 5′ 3′), and nuclease-free water to the final volume of 20 μL. The amplification was performed using ProFlex PCR System (Applied Biosystems, Waltham, MA, USA) with an initial denaturation at 95 °C for 2 min, followed by 35 cycles of denaturation at 94 °C for 1 min, primer annealing at 55 °C for 1 min, elongation at 72 °C for 1 min, and ending with the final elongation step at 72 °C for 7 min. The presence of PCR products was examined by electrophoresis on a QIAxcel system (Qiagen, Hilden, Germany) using the QIAxcel DNA Screening Kit. For species identification, direct Sanger sequencing of the PCR products was performed by Macrogen Europe. Sequence identity was confirmed by BLAST [21].

2.3.3. Real-Time PCR

For the samples from 2019 and 2020, for the simultaneous detection of B. ostreae and B. exitiosa DNA, a probe-based real-time qPCR assay developed by the European Union Reference Laboratory (EURL) for Mollusc Diseases (Ifremer, La Tremblade, France) was performed [22]. The reaction mix contained 10 µL of GoTaq® Probe qPCR Master Mix, 2X (Promega, Madison, WI, USA), 0.3 µM of each primer (BO2_F 5′ AAATGGCCTCTTCCCAATCT 3′, BO2_R 5′ CCGATCAAACTAGGCTGGAA 3′, BEa_F 5′ GACTTTGACCATCGGAAACG 3′, BEa_R 5′ ATCGAGTCGTACGCGAGTCT 3′), 0.2 µM of each double-labelled probe (BO2_probe 5′ HEX—TGACGATCGGGAATGAACGC—BHQ-1 3′, BEa_probe 5′ FAM—GGCAGCGAATCGATGGGAAT—BHQ-1 3′), 25 ng of template DNA as measured on a DS-11 Series Spectrophotometer (DeNovix, Wilmington, USA), and nuclease-free water to the final volume of 20 μL. The amplification was performed on qTower3 thermal cycler (Analytik Jena, Jena, Germany) with the following program: 95 °C for 2 min for polymerase activation, followed by 40 cycles of denaturation at 95 °C for 15 s and annealing at 60 °C for 30 s. The fluorescence was recorded at the end of each cycle with HEX and FAM filters. To detect possible differences, all positive samples were amplified and sequenced using the same method described above.

2.3.4. Sequencing and Phylogeny

Obtained sequences were analyzed using Geneious Prime 2020.0.1 software. For the phylogenetic analysis of the obtained sequences, similar sequences available in GenBank [23] were used and identified using BLAST [21]. Sequences were aligned with MAFFT v7.388 [24] using default parameters. Phylogenetic analysis was performed in MEGA 10.0.5 [25]. The best model was selected based on the lowest BIC score. The maximum likelihood tree was calculated with the following settings: K2+G substitution model, five discrete gamma categories, used all sites, and SPR level 5 heuristic method with very strong branch swap filter. Phylogeny was tested by the bootstrap method with 1000 replications. The obtained tree was visualized in iTOL [26]. Four sequences belonging to Minchinia spp. were used as an outgroup.

3. Results

Until 2016, the results of cytological examination of heart imprints, histological slides of oysters’ organs, and PCR tested negative for the presence of parasite Bonamia spp. There were no reported mortalities, and there were no symptoms of the disease on the oysters from the production areas included in the surveillance program. In the May of 2016, for the first time, there were positive findings of the parasite Bonamia exitiosa from two production areas (Figure 1, Table 2).
The first one was in the north of the Eastern Adriatic Coast in Medulin Bay where 3 out of 30 animals tested positive for Bonamia sp. using conventional PCR and heart imprints, and the second one was in the south of the Croatian Adriatic Sea in the Mali Ston Bay. In all five sampling points, there were Bonamia sp. positive samples; (in Mali Ston and Brijesta, 3 out of 30, respectively, by heart imprints and five and six using conventional PCR; in Bistrina and Bjejevica, 2 out of 30, respectively, in imprints and two and three by PCR; and Sutvid, 1 out of 30 by each technique. Following the first finding in Medulin Bay in May, 1 out of 30 animals sampled in November of the same year tested positive. In 2017, positive samples were detected again in Medulin Bay in May and November and also in October of 2020. In 2019, a conventional PCR was replaced with a new molecular method, real-time PCR developed by EURL for mollusc diseases, and validated through interlaboratory proficiency testing as a screening method in the surveillance program. All samples analyzed in 2019 and 2020 were tested using real-time PCR. Therefore, samples collected in Medulin Bay in October 2020 were screened using real-time PCR, and positive samples were tested using conventional PCR and submitted for sequencing. In Mali Ston Bay, there have been no positive findings since 2016. In June 2018, there were positive findings of B. exitiosa in 2 out of 30 flat oysters sampled in the Lim Bay detected by imprints and three by PCR and in the same number by each method (two by imprints and three by PCR out of 30 flat oysters) sampled in the Savudrija Bay, two sampling points in the Northeastern Adriatic coast. In Savudrija Bay, in 2020, 4 out of 30 flat oysters were found positive by real-time PCR, confirmed by conventional PCR and sequencing. However, all samples from Marina Bay tested negative for the presence of Bonamia sp. during the whole studied period using heart imprints, conventional and real-time PCR.
All pacific oysters collected in the Medulin Bay (n = 18) and from the Limski Bay (n = 30) tested negative for the presence of Bonamia sp by both used techniques.
Microscopic examination of heart imprints revealed mononuclear cells (Figure 2a) and, in fewer numbers, binuclear cells of light blue-stained cytoplasm and red-stained nuclei that were located centrally or near the center in mononuclear stages (Figure 2b).
Microscopic examination of histological slides showed weak to moderate infiltration of hemocytes in the connective tissue of gills, digestive glands, and gonads. Weak to medium necrosis with low to medium presence of Bonamia-like parasites (Mean size: 1.95 µm) were found in the same tissues. In a small number of infected animals, the connective tissue of the gonads had marked necrotic changes and Bonamia-like cells were found (Figure 3a,b).
All PCR positive products (304 bp) were successfully sequenced, and since obtained sequences have not differed, only one haplotype was deposited in Gene Bank (Accession Number MZ026851).
The alignment of the sequences with the SSU rDNA genes of Bonamia exitiosa showed 100% homology in samples with Bonamia sp. from New Zealand (AF337563.1) and Chile (AY860060), both found in Ostrea chilensis (Figure 4). They also showed 99.34% pairwise identity with sequences of Bonamia sp. found in O. edulis in Spain (EU016528.1) and O. stentina in Tunisia (GQ385242).

4. Discussion

Until 2010, the diagnostic procedure for detection of Bonamia spp. was based on the results of heart imprints and histopathological evaluation of each oyster. Subsequently, since 2010, examinations of stained imprints and PCR screening methods for the same sample have been combined according to a dual detection strategy described by Carnegie and EU legislative [27,28]. In the period from 2010 to the first finding of Bonamia spp. positive oysters, 1870 individuals were tested in total.
In the spring of 2016, Bonamia parasite was detected for the first time by conventional PCR in the samples collected from the production area in the northern part of the Eastern Adriatic Sea, sampling point 7 (Figure 1). The sample consisted of 30 adult individuals (more than 2-y old), which were reported to be more susceptible to infection with Bonamia spp. compared to younger ages [29,30]. The microcellular finding was confirmed in stained heart imprints. The suspicion for the presence of Bonamia ostreae was set up, but sequencing revealed the presence of Bonamia exitiosa. Shortly following, the samples collected from the production area in the southern part of the Croatian Adriatic coast, the Mali Ston Bay, were submitted for diagnostics. In each of five samples (n = 150) from different sampling points, the same diagnostic procedure revealed that 17 flat oysters were PCR positive for Bonamia spp. Again, an affiliation of B. exitiosa was determined by sequencing of the PCR positive product. It was found that the prevalence of B. exitiosa in the different sampling points within Mali Ston Bay notably varied from 3.3% to 20.0% per sampling point (Table 2) when tested by PCR compared to prevalence of 3.3% to 13.3% after evaluation of stained heart imprints. In stained heart imprints, single cells with a central nucleus were observed by microscopic examination. However, outside hemocytes, there was a lower abundance of cells with two nuclei. This corresponds to the previously described imprints findings of Bonamia exitiosa in flat oysters [31,32,33,34]. Histopathological examination of positive PCR samples of B. exitiosa confirmed Bonamia-like cells in one-third of samples. In this study, the histological examination was proven as a less sensitive method in line with the finding of Lynch et al., who previously related the low prevalence of parasite to the low sensitivity [35]. It can also mean that environmental conditions were not favorable for the spread and development of infection or that our PCR positive findings were related to the detection of non-infective parasite stages [36].
Interestingly, B. exitiosa was detected in all five sampling points in the Mali Ston Bay only in spring of 2016 and never again until 2020, although surveillance was carried out regularly each year, and in total, 750 oysters were examined during this period and tested negative for the presence of B. exitiosa. At the same time, in the north of the Adriatic coast, B. exitiosa was confirmed for the first time by sequencing and heart imprints in spring 2016, and in following years, it was detected in another two production areas. In Medulin Bay, the findings of B. exitiosa continuously occurred from the spring of 2016 to autumn of 2020, except in 2019. During the seasons with positive findings of the parasite, the prevalence of the PCR positive samples varied from 3.3% to 16.7%. Unexpectedly, in 2019, there were no B. exitiosa positive/infected oysters, which could be explained with a low number of analyzed samples. There were only 90 individuals submitted for diagnostics of Bonamia spp.
It has been experimentally proven that B. ostreae favors lower sea temperature for survival [37] and higher prevalence of bonamiosis in oysters, and increased mortality in the colder period with lower sea temperatures has been described. On the contrary, in the case of Bonamia spp. in C. ariakensis, it has already been observed that the disease occurred in the warmer period when temperatures exceeded 20 °C [38]. Epidemiological circumstances of our B. exitiosa positive cases are unlike each of the reported cases, as no increase in mortalities or disease prevalence has been observed over the last five years.
For the reason mentioned above, the real impact of the infection is hard to evaluate. The prevalence of the B. exitiosa along the Croatian Adriatic Coast varied from 3.35% to a relatively high prevalence of 20% in the sampling point Brijesta in the Mali Ston Bay, and the recent recorded prevalence was 16.7% in the Medulin Bay, the site of the first finding (Table 2). These results show a higher prevalence of B. exitiosa compared to the findings in the study from the Manfredonia Bay in the southern part of the Italian Adriatic coast [32] in 2007, in which only two oysters out of a total of 750 were positive for B. exitiosa. There were no constancy in the prevalence on the sampling site over the studied period. It was shown that sequences of B. exitiosa detected in O. edulis from the Mediterranean area, including the one from Manfredonia Bay, Spain and also O. stentina in Tunisia [31,32,39], are 99.3% similar to those in Croatia, which supports the fact that the same strain is circulating throughout the Mediterranean basin.
Another concern is the answer to the question of how the flat oysters on Croatian production sites became infected with B. exitiosa It is reported that Pacific oysters are a vector or reservoirs of Bonamia spp. [40,41]. Although there is no farming of this species in the Croatian part of the Adriatic Sea, it has been present in the Lim Bay since 1963 [42]. This invasive species was also confirmed in the central Adriatic, but it was not found in the locality of Mali Ston, a southern production area with positive findings of B. exitiosa in the spring of 2016 [43]. The first positive finding of B. exitiosa in the Medulin Bay followed by a positive finding in Limski Bay in 2018 aroused suspicion of Pacific oysters as a source of infection for flat oysters. Unfortunately, the suspicion had to be discarded as both samples, one consisting of 18 Pacific oysters from the Medulin Bay in 2017 and another consisting of 30 Pacific oysters from the Lim Bay, tested negative for the presence of Bonamia spp. Furthermore, until now, there have been no records of mortality or introductions of new batches of either Pacific or flat oysters or any other mollusc species into the infected production areas. The possibility of some vector that might transfer the parasite across the Adriatic Sea should not be fully discarded, but it is hard to prove it.
Since the source of infection with B. exitiosa in flat oysters in all recorded production areas in Croatia remains unknown, another susceptible species may be considered a source of infection for the flat oyster. It is known that another oyster species, dwarf oysters (O. stentina), also exist in the Adriatic Sea [44,45], and phylogeographic research has confirmed that B. exitiosa has always been found in O. stentina [39]. The hypothesis could be made that O. stentina, an inhabitant in the Adriatic Sea, could be a source of B. exitiosa, as O. stentina in Tunisia were found to be positive for this parasite [39,46].
Moreover, it was not possible to get any additional information on the source of B. exitiosa’s origin from phylogenetic analysis. As it is visible from the phylogenetic tree, the similarity of the Croatian isolate of B. exitiosa to different previously sequenced isolates from Chile or Australia was 100%. The similarity of different B. exitiosa isolates found in different oyster species around the world emphasize the fact that the SSU rDNA gene is highly conserved. Therefore, the sequencing of additional genes or the whole genome should be carried out to provide us with more details on the phylogeny of the Croatian isolates.
More comprehensive molecular studies of the B. exitiosa, together with investigation of the natural population of O. stentina from production areas and natural beds along the Eastern Adriatic coast to confirm the natural-historical origin of the parasite B. exitiosa, will enable a better understanding of the pathogen’s presence in the Croatian flat oyster production area.

Author Contributions

Conceptualization, D.O. and S.Z.; formal analysis, R.B., I.G.Z. and Ž.P.; investigation, R.B., Ž.P., I.G.Z., D.O. and S.Z.; resources, S.Z. and D.O.; data curation, L.M., T.M. and Ž.A.-R.; writing—original draft preparation, D.O.; writing—review and editing, S.Z., Ž.P. and R.B.; visualization, I.G.Z. and D.O.; supervision, S.Z. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Croatian Ministry of Agriculture—Veterinary and Food Safety Directorate General.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are available upon a reasonable request from corresponding author.

Acknowledgments

We would like to thank Isabelle Arzul and Bruno Chollet from EURL for Molluscs Diseases for confirming the results of our findings.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. MP-Uprava Ribarstva. 2019. Available online: https://ribarstvo.mps.hr/default.aspx?id=14 (accessed on 17 August 2021).
  2. Grizel, H.; Mialhe, E.; Chagot, D.; Boulo, V.; Bachère, E. Bonamiosis: A model study of diseases in marine molluscs. Am. Fish. Soc. Spec. Publ. 1988, 18, 1–4. [Google Scholar]
  3. Robert, R.; Borel, M.; Pichot, Y.; Gilles, T. Growth and mortality of the European oyster Ostrea edulis in the Bay of Arcachón (France). Aquat. Living Resour. 1991, 4, 265–274. [Google Scholar] [CrossRef]
  4. Hudson, E.B.; Hill, B.J. Impact and spread of bonamiosis in the UK. Aquaculture 1991, 93, 279–285. [Google Scholar] [CrossRef]
  5. Carnegie, R.B.; Cochennec-Laureau, N. Microcell parasites of oysters: Recent insights and future trends. Aquat. Living Resour. 2004, 17, 519–528. [Google Scholar] [CrossRef]
  6. O’Neill, G.; Culloty, S.C.; Mulcahy, M.F. The effectiveness of two routine diagnostic techniques for the detection of the protozoan parasite Bonamia ostreae. Bull. Eur. Ass. Fish. Pathol. 1998, 18, 117–120. [Google Scholar]
  7. Culloty, S.; Cronin, M.; Mulcahy, M. Possible limitations of diagnostic methods recommended for the detection of the protistan, Bonamia ostreae in the European flat oyster, Ostrea edulis. Bull. Eur. Assoc. Fish. Pathol. 2003, 199, 67–71. [Google Scholar]
  8. Da Silva, P.M.; Villalba, A. Comparison of light microscopic techniques for the diagnosis of the infection of the European flat oyster Ostrea edulis by the protozoan Bonamia ostreae. J. Invertebr. Pathol. 2004, 85, 97–104. [Google Scholar] [CrossRef]
  9. Marty, G.D.; Bower, S.M.; Clarke, K.R.; Meyer, G.; Lowe, G.; Osborn, A.L.; Chow, E.P.; Hannah, H.; Byrne, S.; Sojonky, K.; et al. Histopathology and a real-time PCR assay for detection of Bonamia ostreae in Ostrea edulis cultured in western Canada. Aquaculture 2006, 261, 33–42. [Google Scholar] [CrossRef]
  10. Engelsma, M.Y.; Culloty, S.C.; Lynch, S.A.; Arzul, I.; Carnegie, R.B. Bonamia parasites: A rapidly changing perspective on a genus of important mollusc pathogens. Dis. Aquat. Org. 2014, 110, 5–23. [Google Scholar] [CrossRef] [Green Version]
  11. Cochennec, N.; LeRoux, F.; Berthe, F.; Gerard, A. Detection of Bonamia ostreae based on small subunit ribosomal probe. J. Invert. Pathol. 2000, 76, 26–32. [Google Scholar] [CrossRef]
  12. Cochennec-Laureau, N.; Reece, K.S.; Berthe, F.C.J.; Hine, P.M. Mykrocytos roughleyi taxonomic affiliation leads to the genus Bonamia (Haplosporidia). Dis. Aquat. Org. 2003, 54, 209–217. [Google Scholar] [CrossRef] [Green Version]
  13. Arzul, I. Chapter 2.4.3. Infection with Bonamia ostreae. In Manual of Diagnostic Tests for Aquatic Animals; World Organisation for Animal Health (OIE): Paris, France, 2012. [Google Scholar]
  14. Grizel, H.; Comps, M.; Raguenes, D.; Leborgne, Y.; Tigè, G.; Martin, A.G. Bilan des essais d’acclimatation d’Ostrea chilensis sur les côtes de Bretagne. Rev. Trav. Inst. Pêches Marit. 1983, 46, 209–225. [Google Scholar]
  15. Carnegie, R.B.; Burreson, E.M.; Hine, P.M.; Stokes, N.A.; Audemard, C.; Bishop, M.J.; Peterson, C.H. Bonamia perspora n. sp. (Haplosporidia), a parasite of the oyster Ostreola equestris, is the first Bonamia species known to produce spores. J. Eukaryot. Microbiol. 2006, 53, 232–245. [Google Scholar] [CrossRef] [PubMed]
  16. Carnegie, R.B.; Hill, K.M.; Stokes, N.A.; Burreson, E.M. The haplosporidian Bonamia exitiosa is present in Australia, but the identity of the parasite described as Bonamia (formerly Mikrocytos) roughleyi is uncertain. J. Invertebr. Pathol. 2014, 115, 33–40. [Google Scholar] [CrossRef]
  17. Culloty, S.C.; Mulcahy, M.F. Bonamia ostreae in the Native Oyster Ostrea edulis: A review; Marine Environment and Health Series No. 29; Marine Institute: Rinville, Ireland, 2007; 40p. [Google Scholar]
  18. Culloty, S.C.; Cronin, M.A.; Mulcahy, M.F. Potential resistance of a number of populations of the oyster Ostrea edulis to the parasite Bonamia ostreae. Aquaculture 2004, 237, 41–58. [Google Scholar] [CrossRef]
  19. Hine, P.M.; Cochennec-Laureau, N.; Berthe, F.C.J. Bonamia exitiosus n. sp. (Haplosporidia) infecting flat oysters Ostrea chilensis in New Zealand. Dis. Aquat. Org. 2001, 47, 63–72. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  20. Burreson, E.M.; Stokes, N.A.; Carnegie, R.B.; Bishop, M.J. Bonamia sp. (Haplosporidia) found in non-native oysters Crassostrea ariakensis in Bogue Sound, North Carolina. J. Aquat Anim. Health 2004, 16, 1–9. [Google Scholar] [CrossRef]
  21. Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W.; Lipman, D.J. Basic Local Alignment Search Tool. J. Mol. Biol. 1990, 215, 403–410. [Google Scholar] [CrossRef]
  22. Ifremer, EURL-Mollusc, Edition n° 1, Bonamia ostrae and Bonamia exitiosa detection by Taqman® Real-Time Polymerase Chain Reaction. Available online: https://www.eurl-mollusc.eu/content/download/137231/file/B.ostreae%26B.exitiosa%20_TaqmanRealTimePCR_editionN%C2%B01.pdf (accessed on 17 August 2021).
  23. Benson, D.A.; Cavanaugh, M.; Clark, K.; Karsch-Mizrachi, I.; Lipman, D.J.; Ostell, J.; Sayers, E.W. GenBank. Nucleic Acids Res. 2013, 41, D36–D42. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  24. Katoh, K.; Standley, D.M. MAFFT Multiple Sequence Alignment Software Version 7: Improvements in Performance and Usability. Mol. Biol. Evol. 2013, 30, 772–780. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  25. Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef]
  26. Letunic, I.; Bork, P. Interactive Tree of Life (ITOL) v4: Recent Updates and New Developments. Nucleic Acids Res. 2019, 47, W256–W259. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  27. Carnegie, R.B. Bonamiosis of Oysters Caused by Bonamia exitiosa; Feist, S., Ed.; ICES Identification Leaflets for Diseases and Parasites of Fish and Shellfish; International Council for the Exploration of Sea: Copenhagen, Denmark, 2017; Volume 66, p. 6. [Google Scholar] [CrossRef]
  28. Commission Implementing Decision (EU) 2015/1554 of 11 September 2015 Laying down Rules for the Application of Directive 2006/88/EC as Regards Requirements for Surveillance and Diagnostic Methods. Available online: https://eur-lex.europa.eu/legal-content/EN/TXT/PDF/?uri=CELEX:32015D1554&rid=1 (accessed on 17 August 2021).
  29. Dinamani, P.; Hine, P.M.; Jones, J.B. Occurrence and characteristics of the haemocyte parasite Bonamia sp. in the New Zealand dredge oyster Tiostrea lutaria. Dis. aquat. Org. 1987, 3, 37–44. [Google Scholar] [CrossRef]
  30. Engelsma, M.Y.; Kerkhoff, S.; Roozenburg, I.; Haenen, O.L.M.; Van Gool, A.; Sistermans, W.; Wijnhoven, S.; Hummel, H. Epidemiology of Bonamia ostreae infecting European flat oyster Ostrea edulis from Lake Grevelingen, The Netherlands. Mar. Ecol. Prog. Ser. 2010, 409, 131–142. [Google Scholar] [CrossRef] [Green Version]
  31. Abollo, E.; Ramilo, A.; Casas, M.S.; Comesaña, P.; Cao, A.; Carballal, M.J.; Villalba, A. First detection of the protozoan parasite Bonamia exitiosa (Haplosporidia) infecting flat oyter Ostrea edulis grown in European waters. Aquaculture 2008, 274, 201–207. [Google Scholar] [CrossRef]
  32. Narcisi, V.; Arzul, I.; Cargini, D.; Mosca, F.; Calzetta, A.; Traversa, D.; Robert, M.; Joly, J.P.; Chollet, B.; Renault., T.; et al. Detection of Bonamia ostreae and B. exitiosa (Haplosporidia) in Ostrea edulis from the Adriatic Sea (Italy). Dis. Aquat. Org. 2010, 89, 79–85. [Google Scholar] [CrossRef]
  33. Carrasco, N.; Villalba, A.; Andree, K.B.; Engelsma, M.Y.; Lacuesta, B.; Ramilo, A.; Gairín, I. Bonamia exitiosa (Haplosporidia) observed infecting the European flat oyster Ostrea edulis cultured on the Spanish Mediterranean coast. J. Invertebr. Pathol. 2012, 110, 307–313. [Google Scholar] [CrossRef] [PubMed]
  34. Buss, J.J.; Harris, J.O.; Tanner, J.E.; Wiltshire, K.H.; Deveney, M.R. Rapid transmission of Bonamia exitiosa by cohabitation causes mortality in Ostrea angasi. J. Fish. Dis. 2020, 43, 227–237. [Google Scholar] [CrossRef]
  35. Lynch, S.A.; Mulcahy, M.F.; Culloty, S.C. Efficiency of diagnostic techniques for the parasite, Bonamia ostreae, in the flat oyster, Ostrea edulis. Aquaculture 2008, 281, 17–21. [Google Scholar] [CrossRef]
  36. Ford, S.E.; Allam, B.; Xu, Z. Using bivalves as particle collectors with PCR detection to investigate the environmental distribution of Haplosporidium nelsoni. Dis. Aquat. Org. 2009, 83, 159–168. [Google Scholar] [CrossRef]
  37. Arzul, I.; Gagnaire, B.; Bond, C.; Chollet, B.; Morga, B.; Ferrnad, S.; Robert, M.; Renault, T. Effects of temperature and salinity on the survival of Bonamia ostreae a parasite infecting flat oysters O. edulis. Dis. Aquat. Org. 2009, 85, 67–75. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  38. Audemard, C.; Carnegie, R.B.; Stokes, N.A.; Bishop, M.J.; Peterson, C.H.; Burreson, E.M. Effects of salinity on Bonamia sp. survival in Asian oyster Crassostrea ariakensis. J. Shell. Res. 2008, 27, 535–540. [Google Scholar] [CrossRef]
  39. Hill, K.M.; Carnegie, R.B.; Aloui-Bejaoui, N.; El Gharsalli, R.; White, D.M.; Stokes, N.A.; Burreson, E.M. Observation of a Bonamia sp. infecting the oyster Ostrea stentina in Tunisia, and a consideration of its phylogenetic affinities. J. Invert. Pathol. 2010, 103, 179–185. [Google Scholar] [CrossRef] [PubMed]
  40. Lynch, S.A.; Armitage, D.V.; Mulcahy, M.F.; Culloty, S.C. Investigating the possible role of benthic macroinvertebrates and zooplankton in the life cycle of the haplosporidian Bonamia ostreae. Exp. Parasitol. 2007, 115, 359–368. [Google Scholar] [CrossRef]
  41. Lynch, S.A.; Abolle, E.; Ramilo, A.; Cao, A.; Culloty, S.C.; Villalba, A. Observations raise the question if the Pacific Oyster, Crassostrea gigas, can act as either a carrier or reservoir for Bonamia ostreae or Bonamia exitiosa. Parasitology 2010, 137, 1515–1526. [Google Scholar] [CrossRef]
  42. Hrs-Brenko, M. Ostrea edulis (Linnaeus) and Crassostrea gigas (Thunberg) larvae in the plankton of Limski kanal in the northern Adriatic Sea. Acta Adriat. 1982, 23, 399–407. [Google Scholar]
  43. Šegvić-Bubić, T.; Grubišić, L.; Zrnčić, S.; Jozić, S.; Žužul, I.; Talijančić, I.; Oraić, D.; Relić, M.; Katavić, I. Range expansion of the non-native oyster. Acta Adriat. 2016, 57, 321–330. [Google Scholar]
  44. Hrs-Brenko, M.; Legac, M. Inter-and intra-species relationships of sessile bivalves on the eastern coast of the Adriatic Sea. Nat. Croat. 2006, 15, 203–230. [Google Scholar]
  45. Vondrak, T. Upotreba Molekularnih Biljega u Identifikaciji Različitih vrsta Kamenica u Jadranu, Diplomski rad, Sveučilište u Zagrebu, Prirodoslovno-Matematički fakultet, Biološki Odsjek. 2017. Available online: https://repozitorij.pmf.unizg.hr/islandora/object/pmf%3A4522/datastream/PDF/view (accessed on 17 August 2021).
  46. Hill-Spanik, K.M.; McDowell, J.R.; Stokes, N.A.; Reece, K.S.; Burreson, E.M.; Carnegie, R.B. Phylogeographic perspective on the distribution and dispersal of a marine pathogen, the oyster parasite Bonamia exitiosa. Mar. Ecol. Prog. Ser. 2015, 536, 65–76. [Google Scholar] [CrossRef]
Jmse 09 00929 g001 550
Figure 1. Map showing European flat oyster (O. edulis) production areas with sampling points included in the national surveillance plan. A production area in the south with five sampling points and three production areas in the north Croatian Adriatic Sea tested positive (red numbers) for B. exitiosa in 2016–2020. The numbers refer to production areas/sampling sites listed in Table 2.
Figure 1. Map showing European flat oyster (O. edulis) production areas with sampling points included in the national surveillance plan. A production area in the south with five sampling points and three production areas in the north Croatian Adriatic Sea tested positive (red numbers) for B. exitiosa in 2016–2020. The numbers refer to production areas/sampling sites listed in Table 2.
Jmse 09 00929 g001
Jmse 09 00929 g002 550
Figure 2. (a) Heart imprints of Ostrea edulis infected by cells identified as Bonamia exitiosa within hemocyte; (b) Heart imprints of Ostrea edulis infected by mononuclear and binucleated cells identified as Bonamia exitiosa. Hemacolor staining, 1000× magnification.
Figure 2. (a) Heart imprints of Ostrea edulis infected by cells identified as Bonamia exitiosa within hemocyte; (b) Heart imprints of Ostrea edulis infected by mononuclear and binucleated cells identified as Bonamia exitiosa. Hemacolor staining, 1000× magnification.
Jmse 09 00929 g002
Jmse 09 00929 g003 550
Figure 3. (a) Histological section of Ostrea edulis; Bonamia-like parasite in necrotic tissue of digestive gland (b) Gonadal connective tissue cells infected with Bonamia-like parasite. H&E staining, 1000× magnification.
Figure 3. (a) Histological section of Ostrea edulis; Bonamia-like parasite in necrotic tissue of digestive gland (b) Gonadal connective tissue cells infected with Bonamia-like parasite. H&E staining, 1000× magnification.
Jmse 09 00929 g003
Jmse 09 00929 g004 550
Figure 4. Bonamia spp. maximum likelihood phylogenetic tree. Bootstrap values higher than 75 are displayed.
Figure 4. Bonamia spp. maximum likelihood phylogenetic tree. Bootstrap values higher than 75 are displayed.
Jmse 09 00929 g004
Table
Table 1. Total number of oysters analyzed for the presence of Bonamia spp. in the period 2016–2020.
Table 1. Total number of oysters analyzed for the presence of Bonamia spp. in the period 2016–2020.
SpeciesFlat Oyster (Ostrea edulis)Pacific Oyster (Magallana gigas)
Production AreaMali Ston BayMedulin BayLim BaySavudrija BayMarina BayMedulin BayLim Bay
Date and number of sample animalsDate
M/Y		NoDate
M/Y		NoDate
M/Y		NoDate
M/Y		NoDate
M/Y		NoDate
M/Y		NoDate
M/Y		No
05/2016150 *05/201630 *05/20163005/20163011/201630
11/201615011/201630 *09/20163010/20163006/201730
05/201715007/201730 *05/20173005/20173005/20183007/201718
11/201715011/201730 *06/201830 *06/201830 *09/201830
11/201815010/20183009/20193010/20193008/201930 09/201830
10/202015010/202030 *09/20203009/202030 *08/202030
Totally 900 180 180 180 180 18 30
* Samples with positive finding of B. exitiosa.
Table
Table 2. Positive findings of Bonamia exitiosa within sampling area showing sampling dates, sampling points, and prevalence using different diagnostic techniques in Croatia during the period 2016–2020.
Table 2. Positive findings of Bonamia exitiosa within sampling area showing sampling dates, sampling points, and prevalence using different diagnostic techniques in Croatia during the period 2016–2020.
Date of Sampling
(M/Y)		Production Area/Name of Sampling SiteNumber of Sampled AnimalsSampled SpeciesResults of Laboratory Analysis
Heart ImprintsPCR Real Time PCR
MALOSTONSKI BAY AREA+-ve%+-ve%+-ve%
05/20166 * Mali Ston30 Ostrea edulis 310516.7n/d-
05/20162 * Brijesta30 Ostrea edulis 31062.,0n/d-
05/20165 * Bistrina30 Ostrea edulis 26.726.7n/d-
05/20163 * Bjejevica30 Ostrea edulis 26.7310.0n/d-
05/20164 * Sutvid30 Ostrea edulis 13.313.3n/d-
MEDULINSKI BAY
05/20167 * Medulinski Bay30 Ostrea edulis 26.736.7n/d-
11/20167 * Medulinski Bay30 Ostrea edulis 13.313.3n/d-
07/20177 * Medulinski Bay30 Ostrea edulis 26.7310.0n/d-
11/20177 * Medulinski Bay30 Ostrea edulis 13.313.3n/d-
11/20177 * Medulinski Bay18 Magallana gigas 0000n/d-
10/20207 * Medulinski Bay30 Ostrea edulis 413.3516.7516.7
LIM BAY
07/20181 * Lim Bay30 Ostrea edulis 13.326.7n/d-
20181 * Lim Bay30 Magallana gigas 0000n/d-
SAVUDRIJA BAY
06/201812 * Savudrija Bay30 Ostrea edulis 26.7310.0n/d-
09/202012 * Savudrija Bay30 Ostrea edulis 16.7413.3413.3
* labels the number of the sampling site corresponding to the map of sampling sites.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Oraić, D.; Beck, R.; Pavlinec, Ž.; Zupičić, I.G.; Maltar, L.; Miškić, T.; Acinger-Rogić, Ž.; Zrnčić, S. Bonamia exitiosa in European Flat Oyster (Ostrea edulis) on the Croatian Adriatic Coast from 2016 to 2020. J. Mar. Sci. Eng. 2021, 9, 929. https://doi.org/10.3390/jmse9090929

AMA Style

Oraić D, Beck R, Pavlinec Ž, Zupičić IG, Maltar L, Miškić T, Acinger-Rogić Ž, Zrnčić S. Bonamia exitiosa in European Flat Oyster (Ostrea edulis) on the Croatian Adriatic Coast from 2016 to 2020. Journal of Marine Science and Engineering. 2021; 9(9):929. https://doi.org/10.3390/jmse9090929

Chicago/Turabian Style

Oraić, Dražen, Relja Beck, Željko Pavlinec, Ivana Giovanna Zupičić, Ljupka Maltar, Tihana Miškić, Žaklin Acinger-Rogić, and Snježana Zrnčić. 2021. "Bonamia exitiosa in European Flat Oyster (Ostrea edulis) on the Croatian Adriatic Coast from 2016 to 2020" Journal of Marine Science and Engineering 9, no. 9: 929. https://doi.org/10.3390/jmse9090929

APA Style

Oraić, D., Beck, R., Pavlinec, Ž., Zupičić, I. G., Maltar, L., Miškić, T., Acinger-Rogić, Ž., & Zrnčić, S. (2021). Bonamia exitiosa in European Flat Oyster (Ostrea edulis) on the Croatian Adriatic Coast from 2016 to 2020. Journal of Marine Science and Engineering, 9(9), 929. https://doi.org/10.3390/jmse9090929

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop