Circadian-Mediated Regulation of Growth, Chloroplast Proteome, Targeted Metabolomics and Gene Regulatory Network in Spinacia oleracea Under Drought Stress
Abstract
:1. Introduction
2. Materials and Methods
2.1. Growth Environment and Collection of Plant Samples
2.2. Experimental Layout and Drought Stress Treatment
2.3. Morphological Observations and Growth Measurements
2.4. Plant Biomass and Leaf-Relative Water Content (L-RWC)
2.5. Estimation of Photosynthetic Variables and Chlorophyll Fluorescence
2.6. Estimation of Photosynthetic Pigment
2.7. MDA and Proline Content (Stress Markers)
2.8. Determination of Total Protein and Total Phenol Contents
2.9. In Situ Localization of H2O2 and O2−1
2.10. Estimation of Antioxidant Enzymatic Activities and Their Native PAGE Profiling
2.11. Stomatal Index and Stomatal Appearance
2.12. Thylakoidal Protein Analysis (BN-PAGE)
2.13. Isolation of RNA, cDNA Synthesis, and Analysis of RT-PCR
2.14. Targeted Metabolomics Analysis
2.15. Statistical Analysis
3. Results
3.1. Morphological Variations
3.1.1. Plant Physiology and Morphology
3.1.2. Leaf Morphology and Structural Traits
3.1.3. Root Physiology and Morphology
3.2. Plant Biomass and Leaf Relative Water Content (L-RWC)
3.3. Photosynthetic Measurements
3.4. Chlorophyll Molecules
3.5. Thylakoidal Protein Analysis (BN-PAGE)
3.6. Stomatal Index and Stomatal Appearance
3.7. Malonaldehyde (MDA) and Proline Content
3.8. H2O2 and O2− Localizations
3.9. Total Soluble Protein (TSP) and Total Phenolic Content (TPC)
3.10. Antioxidant Enzymatic Activities and Their Native PAGE Profiling
3.11. Quantitative RT-PCR Analysis
3.11.1. Expression of Core Genes of Circadian Clock
3.11.2. Expression of Pseudo-Response Regulators (PRRs)
3.11.3. Expression of Drought-Responsive Genes
3.12. Targeted Metabolomics Analysis
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Fahad, S.; Bajwa, A.A.; Nazir, U.; Anjum, S.A.; Farooq, A.; Zohaib, A.; Sadia, S.; Nasim, W.; Adkins, S.; Saud, S.; et al. Crop production under drought and heat stress: Plant responses and management options. Front. Plant Sci. 2017, 8, 1147. [Google Scholar] [CrossRef]
- Ozturk, M.; Turkyilmaz Unal, B.; García-Caparrós, P.; Khursheed, A.; Gul, A.; Hasanuzzaman, M. Osmoregulation and its actions during the drought stress in plants. Physiol. Plant. 2021, 172, 1321–1335. [Google Scholar] [CrossRef]
- Iqbal, M.S.; Singh, A.K.; Ansari, M.I. Effect of drought stress on crop production. In New Frontiers in Stress Management for Durable Agriculture; Springer: Berlin/Heidelberg, Germany, 2020; pp. 35–47. [Google Scholar]
- Yang, X.; Lu, M.; Wang, Y.; Wang, Y.; Liu, Z.; Chen, S. Response mechanism of plants to drought stress. Horticulturae 2021, 7, 50. [Google Scholar] [CrossRef]
- Pamungkas, S.S.; Farid, N. Drought stress: Responses and mechanism in plants. Rev. Agric. Sci. 2022, 10, 168–185. [Google Scholar] [CrossRef] [PubMed]
- Basu, S.; Ramegowda, V.; Kumar, A.; Pereira, A. Plant adaptation to drought stress. F1000Research 2016, 5, 1554. [Google Scholar] [CrossRef]
- Christmann, A.; Hoffmann, T.; Teplova, I.; Grill, E.; Muller, A. Generation of active pools of abscisic acid revealed by in vivo imaging of water-stressed Arabidopsis. Plant Physiol. 2005, 137, 209–219. [Google Scholar] [CrossRef] [PubMed]
- Danaeipour, Z.; Haddad, R. Influence of drought stress on photosynthetic characteristics and protective enzymes in plants. Iran. J. Genet. Plant Breed. 2020, 9, 114–129. [Google Scholar]
- Lawlor, D.W.; Tezara, W. Causes of decreased photosynthetic rate and metabolic capacity in water-deficient leaf cells: A critical evaluation of mechanisms and integration of processes. Ann. Bot. 2009, 103, 561–579. [Google Scholar] [CrossRef] [PubMed]
- Kar, R.K. Plant responses to water stress: Role of reactive oxygen species. Plant Signal. Behav. 2011, 6, 1741–1745. [Google Scholar] [CrossRef] [PubMed]
- Wahab, A.; Abdi, G.; Saleem, M.H.; Ali, B.; Ullah, S.; Shah, W.; Mumtaz, S.; Yasin, G.; Muresan, C.C.; Marc, R.A. Plants’ physio-biochemical and phyto-hormonal responses to alleviate the adverse effects of drought stress: A comprehensive review. Plants 2022, 11, 1620. [Google Scholar] [CrossRef] [PubMed]
- Muneer, S.; Kim, T.H.; Choi, B.C.; Lee, B.S.; Lee, J.H. Effect of CO, NOx and SO2 on ROS production, photosynthesis and ascorbate–glutathione pathway to induce Fragaria × annasa as a hyperaccumulator. Redox Biol. 2014, 2, 91–98. [Google Scholar] [CrossRef] [PubMed]
- Qi, J.; Song, C.P.; Wang, B.; Zhou, J.; Kangasjärvi, J.; Zhu, J.K.; Gong, Z. Reactive oxygen species signaling and stomatal movement in plant responses to drought stress and pathogen attack. J. Integr. Plant Biol. 2018, 60, 805–826. [Google Scholar] [CrossRef]
- Kaur, G.; Asthir, B. Molecular responses to drought stress in plants. Biol. Plant. 2017, 61, 201–209. [Google Scholar] [CrossRef]
- Farooq, M.; Hussain, M.; Wahid, A.; Siddique, K.H. Drought stress in plants: An overview. In Plant Responses to Drought Stress: From Morphological to Molecular Features; Springer: Berlin/Heidelberg, Germany, 2012; pp. 1–33. [Google Scholar]
- Foyer, C.H.; Kunert, K. The ascorbate–glutathione cycle coming of age. J. Exp. Bot. 2024, 75, 2682–2699. [Google Scholar] [CrossRef] [PubMed]
- Miller, G.A.; Suzuki, N.; Ciftci-Yilmaz, S.U.; Mittler, R.O. Reactive oxygen species homeostasis and signalling during drought and salinity stresses. Plant Cell Environ. 2010, 33, 453–467. [Google Scholar] [CrossRef]
- Singh, R.; Singh, S.; Parihar, P.; Mishra, R.K.; Tripathi, D.K.; Singh, V.P.; Chauhan, D.K.; Prasad, S.M. Reactive oxygen species (ROS): Beneficial companions of plants’ developmental processes. Front. Plant Sci. 2016, 7, 1299. [Google Scholar] [CrossRef]
- Wang, Y.; Mostafa, S.; Zeng, W.; Jin, B. Function and mechanism of jasmonic acid in plant responses to abiotic and biotic stresses. Int. J. Mol. Sci. 2021, 22, 8568. [Google Scholar] [CrossRef]
- Song, W.; Shao, H.; Zheng, A.; Zhao, L.; Xu, Y. Advances in roles of salicylic acid in plant tolerance responses to biotic and abiotic stresses. Plants 2023, 12, 3475. [Google Scholar] [CrossRef]
- Tuteja, N. Abscisic acid and abiotic stress signaling. Plant Signal. Behav. 2007, 2, 135–138. [Google Scholar] [CrossRef]
- Pérez-Llorca, M.; Pollmann, S.; Müller, M. Ethylene and jasmonates signaling network mediating secondary metabolites under abiotic stress. Int. J. Mol. Sci. 2023, 24, 5990. [Google Scholar] [CrossRef] [PubMed]
- Xu, H.; Zuo, Y.; Wei, J.; Wang, L. The Circadian Clock Coordinates the Tradeoff between Adaptation to Abiotic Stresses and Yield in Crops. Biology 2023, 12, 1364. [Google Scholar] [CrossRef] [PubMed]
- Creux, N.; Harmer, S. Circadian rhythms in plants. Cold Spring Harb. Perspect. Biol. 2019, 11, a034611. [Google Scholar] [CrossRef]
- Xu, X.; Yuan, L.; Xie, Q. The circadian clock ticks in plant stress responses. Stress Biol. 2022, 2, 15. [Google Scholar] [CrossRef] [PubMed]
- Davis, W.; Endo, M.; Locke, J.C. Spatially specific mechanisms and functions of the plant circadian clock. Plant Physiol. 2022, 190, 938–951. [Google Scholar] [CrossRef]
- Srivastava, D.; Shamim, M.; Kumar, M.; Mishra, A.; Maurya, R.; Sharma, D.; Pandey, P.; Singh, K.N. Role of circadian rhythm in plant system: An update from development to stress response. Environ. Exp. Bot. 2019, 162, 256–271. [Google Scholar] [CrossRef]
- Xu, H.; Wang, X.; Wei, J.; Zuo, Y.; Wang, L. The regulatory networks of the circadian clock involved in plant adaptation and crop yield. Plants 2023, 12, 1897. [Google Scholar] [CrossRef]
- Webb, A.A. The physiology of circadian rhythms in plants. New Phytol. 2003, 160, 281–303. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.A.; Kim, H.S.; Choi, S.H.; Jang, J.Y.; Jeong, M.J.; Lee, S.I. The importance of the circadian clock in regulating plant metabolism. Int. J. Mol. Sci. 2017, 18, 2680. [Google Scholar] [CrossRef] [PubMed]
- Oakenfull, R.J.; Davis, S.J. Shining a light on the Arabidopsis circadian clock. Plant Cell Environ. 2017, 40, 2571–2585. [Google Scholar] [CrossRef]
- Franklin, K.A.; Whitelam, G.C. Light signals, phytochromes and cross-talk with other environmental cues. J. Exp. Bot. 2004, 55, 271–276. [Google Scholar] [CrossRef]
- Paik, I.; Huq, E. Plant photoreceptors: Multi-functional sensory proteins and their signaling networks. Semin. Cell Dev. Biol. 2019, 92, 114–121. [Google Scholar] [CrossRef] [PubMed]
- Su, J.; Liu, B.; Liao, J.; Yang, Z.; Lin, C.; Oka, Y. Coordination of cryptochrome and phytochrome signals in the regulation of plant light responses. Agronomy 2017, 7, 25. [Google Scholar] [CrossRef]
- Lopez, L.; Fasano, C.; Perrella, G.; Facella, P. Cryptochromes and the circadian clock: The story of a very complex relationship in a spinning world. Genes 2021, 12, 672. [Google Scholar] [CrossRef] [PubMed]
- Pandey, S.C.; Kalloo, G. Spinach: Spinacia oleracea L. In Genetic Improvement of Vegetable Crops; Elsevier Science: Pergamon, Türkiye, 1993; pp. 325–336. [Google Scholar]
- Jakhro, M.I.; Shah, S.I.; Amanullah, Z.M.; Rahujo, Z.A.; Ahmed, S.; Jakhro, M.A. Growth and yield of spinach (Spinacia oleracea) under fluctuating levels of organic and inorganic fertilizers. Int. J. Dev. Res. 2017, 7, 11454–11460. [Google Scholar]
- Bhattarai, G.; Shi, A. Research advances and prospects of spinach breeding, genetics, and genomics. Veg. Res. 2021, 1, 9. [Google Scholar] [CrossRef]
- Chitwood, J. Spinach (Spinacia oleracea L.) Seed Germination and Whole Plant Growth Response to Heat Stress and Association Mapping of Bolting, Tallness and Erectness for Use in Spinach Breeding. Master’s Thesis, University of Arkansas, Fayetteville, AR, USA, 2016. [Google Scholar]
- Nešković, M.; Ćulafić, L. Spinach (Spinacia oleracea L.). In Crops II; Springer: Berlin/Heidelberg, Germany, 1988; pp. 370–385. [Google Scholar]
- Ramaiyan, B.; Kour, J.; Nayik, G.A.; Anand, N.; Alam, M.S. Spinach (Spinacia oleracea L.). In Antioxidants in Vegetables and Nuts-Properties and Health Benefits; Springer: Singapore, 2020; pp. 159–173. [Google Scholar]
- Bokov, D.O.; Yu, S.S.; Mazo, V.K.; Bessonov, V.V. Prospects for the use of spinach (Spinacia oleracea L.) containing phytoecdysteroids and polyphenols. Pharmacogn. J. 2020, 12, 246–250. [Google Scholar]
- Bukhari, S.A.; Lalarukh, I.; Amjad, S.F.; Mansoora, N.; Naz, M.; Naeem, M.; Bukhari, S.A.; Shahbaz, M.; Ali, S.A.; Marfo, T.D.; et al. Drought stress alleviation by potassium-nitrate-containing chitosan/montmorillonite microparticles confers changes in Spinacia oleracea L. Sustainability 2021, 13, 9903. [Google Scholar] [CrossRef]
- Deveci, H. Estimation of the Impact of Climate Change on Spinach Cultivation Areas in Türkiye. Sustainability 2023, 15, 15395. [Google Scholar] [CrossRef]
- Nasarullah, N.N.; Ahmed, W.N.; Othman, H. Determining Water Stress and Varying Irrigation Regimes on Spinach (Spinacia oleracea L.) Growth Performance. In IOP Conference Series: Earth and Environmental Science; IOP Publishing: London, UK, 2022; Volume 1059, p. 012073. [Google Scholar]
- Al Murad, M.; Muneer, S. Silicon supplementation modulates physiochemical characteristics to balance and ameliorate salinity stress in mung bean. Front. Plant Sci. 2022, 13, 810991. [Google Scholar] [CrossRef]
- Barrs, H.D.; Weatherley, P.E. A re-examination of the relative turgidity technique for estimating water deficits in leaves. Aust. J. Biol. Sci. 1962, 15, 413–428. [Google Scholar] [CrossRef]
- Razi, K.; Bae, D.W.; Muneer, S. Target-based physiological modulations and chloroplast proteome reveals a drought resilient rootstock in okra (Abelmoschus esculentus) genotypes. Int. J. Mol. Sci. 2021, 22, 12996. [Google Scholar] [CrossRef]
- Hiscox, J.D.; Israelstam, G.F. A method for the extraction of chlorophyll from leaf tissue without maceration. Can. J. Bot. 1979, 57, 1332–1334. [Google Scholar] [CrossRef]
- Arnon, D.I. Copper enzymes in isolated chloroplasts. Polyphenoloxidase Beta vulgaris. Plant Physiol. 1949, 24, 1–15. [Google Scholar] [CrossRef] [PubMed]
- Venkat, A.; Bae, D.W.; Muneer, S. Circadian Clock Contributes to Modulate Salinity Stress-Responsive Antioxidative Mechanisms and Chloroplast Proteome in Spinacia oleracea. Agriculture 2023, 13, 429. [Google Scholar] [CrossRef]
- Vajjiravel, P.; Nagarajan, D.; Pugazhenthi, V.; Suresh, A.; Sivalingam, M.K.; Venkat, A.; Mahapatra, P.P.; Razi, K.; Al Murad, M.; Bae, D.W.; et al. Circadian-based approach for improving physiological, phytochemical and chloroplast proteome in Spinacia oleracea under salinity stress and light emitting diodes. Plant Physiol. Biochem. 2024, 207, 108350. [Google Scholar] [CrossRef] [PubMed]
- Bates, L.S.; Waldren, R.P.; Teare, I.D. Rapid determination of free proline for water-stress studies. Plant Soil 1973, 39, 205–207. [Google Scholar] [CrossRef]
- Bradford, M.M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef] [PubMed]
- Muneer, S.; Lee, B.R.; Bae, D.W.; Kim, T.H. Changes in expression of proteins involved in alleviation of Fe-deficiency by sulfur nutrition in Brassica napus L. Acta Physiol. Plant. 2013, 35, 3037–3045. [Google Scholar] [CrossRef]
- Muneer, S.; Lee, J.H. Hazardous gases (CO, NOx, CH4 and C3H8) released from CO2 fertilizer unit lead to oxidative damage and degrades photosynthesis in strawberry plants. Sci. Rep. 2018, 8, 12291. [Google Scholar] [CrossRef]
- Nakano, Y.; Asada, K. Hydrogen peroxide is scavenged by ascorbate-specific peroxidase in spinach chloroplasts. Plant Cell Physiol. 1981, 22, 867–880. [Google Scholar]
- Dhindsa, R.S.; Matowe, W. Drought tolerance in two mosses: Correlated with enzymatic defence against lipid peroxidation. J. Exp. Bot. 1981, 32, 79–91. [Google Scholar] [CrossRef]
- Cakmak, I.; Marschner, H. Magnesium deficiency and high light intensity enhance activities of superoxide dismutase, ascorbate peroxidase, and glutathione reductase in bean leaves. Plant Physiol. 1992, 98, 1222–1227. [Google Scholar] [CrossRef]
- Shah, K.; Nahakpam, S. Heat exposure alters the expression of SOD, POD, APX and CAT isozymes and mitigates low cadmium toxicity in seedlings of sensitive and tolerant rice cultivars. Plant Physiol. Biochem. 2012, 57, 106–113. [Google Scholar] [CrossRef] [PubMed]
- Gomes-Junior, R.A.; Moldes, C.A.; Delite, F.S.; Gratão, P.L.; Mazzafera, P.; Lea, P.J.; Azevedo, R.A. Nickel elicits a fast antioxidant response in Coffea arabica cells. Plant Physiol. Biochem. 2006, 44, 420–429. [Google Scholar] [CrossRef] [PubMed]
- Beauchamp, C.; Fridovich, I. Superoxide dismutase: Improved assays and an assay applicable to acrylamide gels. Anal. Biochem. 1971, 44, 276–287. [Google Scholar] [CrossRef] [PubMed]
- Woodbury, W.; Spencer, A.K.; Stahmann, M.A. An improved procedure using ferricyanide for detecting catalase isozymes. Anal. Biochem. 1971, 44, 301–305. [Google Scholar] [CrossRef]
- Clare, D.A.; Duong, M.N.; Darr, D.; Archibald, F.; Fridovich, I. Effects of molecular oxygen on detection of superoxide radical with nitroblue tetrazolium and on activity stains for catalase. Anal. Biochem. 1984, 140, 532–537. [Google Scholar] [CrossRef] [PubMed]
- Anderson, M.D.; Prasad, T.K.; Stewart, C.R. Changes in isozyme profiles of catalase, peroxidase, and glutathione reductase during acclimation to chilling in mesocotyls of maize seedlings. Plant Physiol. 1995, 109, 1247–1257. [Google Scholar] [CrossRef] [PubMed]
- Mittler, R.; Zilinskas, B.A. Detection of ascorbate peroxidase activity in native gels by inhibition of the ascorbate-dependent reduction of nitroblue tetrazolium. Anal. Biochem. 1993, 212, 540–546. [Google Scholar] [CrossRef] [PubMed]
- Muneer, S.; Park, Y.G.; Manivannan, A.; Soundararajan, P.; Jeong, B.R. Physiological and proteomic analysis in chloroplasts of Solanum lycopersicum L. under silicon efficiency and salinity stress. Int. J. Mol. Sci. 2014, 15, 21803–21824. [Google Scholar] [CrossRef]
- Al Murad, M.; Muneer, S. Physiological and molecular analysis revealed the role of silicon in modulating salinity stress in mung bean. Agriculture 2023, 13, 1493. [Google Scholar] [CrossRef]
- Razi, K.; Muneer, S. Grafting enhances drought tolerance by regulating and mobilizing proteome, transcriptome and molecular physiology in okra genotypes. Front. Plant Sci. 2023, 14, 1178935. [Google Scholar] [CrossRef] [PubMed]
- Sun, Y.; Wang, J.; Wang, Q.; Wang, C. Responses of the growth characteristics of spinach to different moisture contents in soil under irrigation with magnetoelectric water. Agronomy 2023, 13, 657. [Google Scholar] [CrossRef]
- Sharma, M.; Irfan, M.; Kumar, A.; Kumar, P.; Datta, A. Recent insights into plant circadian clock response against abiotic stress. J. Plant Growth Regul. 2022, 41, 3530–3543. [Google Scholar] [CrossRef]
- Mwimba, M.; Karapetyan, S.; Liu, L.; Marqués, J.; McGinnis, E.M.; Buchler, N.E.; Dong, X. Daily humidity oscillation regulates the circadian clock to influence plant physiology. Nat. Commun. 2018, 9, 4290. [Google Scholar] [CrossRef]
- Inoue, K.; Araki, T.; Endo, M. Circadian clock during plant development. J. Plant Res. 2018, 131, 59–66. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Du, Z.; Huo, X.; Zhou, J.; Chen, Y.; Zhang, J.; Pan, A.; Wang, X.; Wang, F.; Zhang, J. Genome-wide analysis of PRR gene family uncovers their roles in circadian rhythmic changes and response to drought stress in Gossypium hirsutum L. PeerJ 2020, 8, e9936. [Google Scholar] [CrossRef]
- Werner, C.; Correia, O.; Beyschlag, W. Two different strategies of Mediterranean macchia plants to avoid photoinhibitory damage by excessive radiation levels during summer drought. Acta Oecologica 1999, 20, 15–23. [Google Scholar] [CrossRef]
- Lobet, G.; Draye, X. Novel scanning procedure enabling the vectorization of entire rhizotron-grown root systems. Plant Methods 2013, 9, 1. [Google Scholar] [CrossRef]
- Gowda, V.R.; Henry, A.; Yamauchi, A.; Shashidhar, H.E.; Serraj, R. Root biology and genetic improvement for drought avoidance in rice. Field Crops Res. 2011, 122, 1–13. [Google Scholar] [CrossRef]
- Anjum, S.A.; Ashraf, U.; Tanveer, M.; Khan, I.; Hussain, S.; Shahzad, B.; Zohaib, A.; Abbas, F.; Saleem, M.F.; Ali, I.; et al. Drought induced changes in growth, osmolyte accumulation and antioxidant metabolism of three maize hybrids. Front. Plant Sci. 2017, 8, 69. [Google Scholar] [CrossRef] [PubMed]
- Li, W.; Wang, Y.; Zhang, Y.; Wang, R.; Guo, Z.; Xie, Z. Impacts of drought stress on the morphology, physiology, and sugar content of Lanzhou lily (Lilium davidii var. unicolor). Acta Physiol. Plant. 2020, 42, 127. [Google Scholar] [CrossRef]
- Patmi, Y.S.; Pitoyo, A. Effect of drought stress on morphological, anatomical, and physiological characteristics of Cempo Ireng cultivar mutant rice (Oryza sativa L.) strain 51 irradiated by gamma-ray. J. Phys. Conf. Ser. 2020, 1436, 012015. [Google Scholar] [CrossRef]
- Misra, V.; Solomon, S.; Mall, A.K.; Prajapati, C.P.; Hashem, A.; Abd_Allah, E.F.; Ansari, M.I. Morphological assessment of water stressed sugarcane: A comparison of waterlogged and drought affected crop. Saudi J. Biol. Sci. 2020, 27, 1228–1236. [Google Scholar] [CrossRef]
- Pour-Aboughadareh, A.; Mohammadi, R.; Etminan, A.; Shooshtari, L.; Maleki-Tabrizi, N.; Poczai, P. Effects of drought stress on some agronomic and morpho-physiological traits in durum wheat genotypes. Sustainability 2020, 12, 5610. [Google Scholar] [CrossRef]
- Keyvan, S. The effects of drought stress on yield, relative water content, proline, soluble carbohydrates and chlorophyll of bread wheat cultivars. J. Anim. Plant Sci 2010, 8, 1051–1060. [Google Scholar]
- Zokaee-Khosroshahi, M.; Esna-Ashari, M.; Ershadi, A.; Imani, A. Morphological changes in response to drought stress in cultivated and wild almond species. Int. J. Hortic. Sci. Technol. 2014, 1, 79–92. [Google Scholar]
- Khodabin, G.; Tahmasebi-Sarvestani, Z.; Rad, A.H.; Modarres-Sanavy, S.A. Effect of drought stress on certain morphological and physiological characteristics of a resistant and a sensitive canola cultivar. Chem. Biodivers. 2020, 17, e1900399. [Google Scholar] [CrossRef]
- Flexas, J.; Bota, J.; Loreto, F.; Cornic, G.; Sharkey, T.D. Diffusive and metabolic limitations to photosynthesis under drought and salinity in C3 plants. Plant Biol. 2004, 6, 269–279. [Google Scholar] [CrossRef]
- Farooq, M.; Wahid, A.; Kobayashi, N.S.; Fujita, D.B.; Basra, S.M. Plant drought stress: Effects, mechanisms and management. In Sustainable Agriculture; Springer: Dordrecht, The Netherlands, 2009; pp. 153–188. [Google Scholar]
- Wu, M.; Zhang, W.H.; Ma, C.; Zhou, J.Y. Changes in morphological, physiological, and biochemical responses to different levels of drought stress in Chinese cork oak (Quercus variabilis Bl.) seedlings. Russ. J. Plant Physiol. 2013, 60, 681–692. [Google Scholar] [CrossRef]
- Dastborhan, S.; Ghassemi-Golezani, K. Influence of seed priming and water stress on selected physiological traits of borage. Folia Hortic. 2015, 27, 151–159. [Google Scholar] [CrossRef]
- Zhi, Q.Q.; Chen, Y.; Hu, H.; Huang, W.Q.; Bao, G.G.; Wan, X.R. Physiological and transcriptome analyses reveal tissue-specific responses of Leucaena plants to drought stress. Plant Physiol. Biochem. 2024, 214, 108926. [Google Scholar] [CrossRef] [PubMed]
- Ilyas, M.; Nisar, M.; Khan, N.; Hazrat, A.; Khan, A.H.; Hayat, K.; Fahad, S.; Khan, A.; Ullah, A. Drought tolerance strategies in plants: A mechanistic approach. J. Plant Growth Regul. 2021, 40, 926–944. [Google Scholar] [CrossRef]
- Ghosh, U.K.; Islam, M.N.; Siddiqui, M.N.; Khan, M.A. Understanding the roles of osmolytes for acclimatizing plants to changing environment: A review of potential mechanism. Plant Signal. Behav. 2021, 16, 1913306. [Google Scholar] [CrossRef] [PubMed]
- Ashraf, M.F.; Foolad, M.R. Roles of glycine betaine and proline in improving plant abiotic stress resistance. Environ. Exp. Bot. 2007, 59, 206–216. [Google Scholar] [CrossRef]
- Szabados, L.; Savouré, A. Proline: A multifunctional amino acid. Trends Plant Sci. 2010, 15, 89–97. [Google Scholar] [CrossRef] [PubMed]
- AlKahtani, M.D.; Hafez, Y.M.; Attia, K.; Rashwan, E.; Husnain, L.A.; AlGwaiz, H.I.; Abdelaal, K.A. Evaluation of silicon and proline application on the oxidative machinery in drought-stressed sugar beet. Antioxidants 2021, 10, 398. [Google Scholar] [CrossRef]
- Mittler, R. Oxidative stress, antioxidants and stress tolerance. Trends Plant Sci. 2002, 7, 405–410. [Google Scholar] [CrossRef]
- Dietz, K.J. Thiol-based peroxidases and ascorbate peroxidases: Why plants rely on multiple peroxidase systems in the photosynthesizing chloroplast? Mol. Cells 2016, 39, 20–25. [Google Scholar] [CrossRef]
- Choudhury, F.K.; Rivero, R.M.; Blumwald, E.; Mittler, R. Reactive oxygen species, abiotic stress and stress combination. Plant J. 2017, 90, 856–867. [Google Scholar] [CrossRef] [PubMed]
- Mittler, R.; Vanderauwera, S.; Gollery, M.; Van Breusegem, F. Reactive oxygen gene network of plants. Trends Plant Sci. 2004, 9, 490–498. [Google Scholar] [CrossRef] [PubMed]
- Farooq, A.; Bukhari, S.A.; Akram, N.A.; Ashraf, M.; Wijaya, L.; Alyemeni, M.N.; Ahmad, P. Exogenously applied ascorbic acid-mediated changes in osmoprotection and oxidative defense system enhanced water stress tolerance in different cultivars of safflower (Carthamus tinctorious L.). Plants 2020, 9, 104. [Google Scholar] [CrossRef]
- Xu, X.; Yuan, L.; Yang, X.; Zhang, X.; Wang, L.; Xie, Q. Circadian clock in plants: Linking timing to fitness. J. Integr. Plant Biol. 2022, 64, 792–811. [Google Scholar] [CrossRef]
- Hughes, C.L.; Harmer, S.L. Myb-like transcription factors have epistatic effects on circadian clock function but additive effects on plant growth. Plant Direct 2023, 7, e533. [Google Scholar] [CrossRef] [PubMed]
- Hu, Z.; Zhang, N.; Qin, Z.; Li, J.; Yang, N.; Chen, Y.; Kong, J.; Luo, W.; Xiong, A.; Zhuang, J. Differential response of MYB transcription factor gene transcripts to circadian rhythm in tea plants (Camellia sinensis). Int. J. Mol. Sci. 2024, 25, 657. [Google Scholar] [CrossRef] [PubMed]
- Yi, F.; Huo, M.; Li, J.; Yu, J. Time-series transcriptomics reveals a drought-responsive temporal network and crosstalk between drought stress and the circadian clock in foxtail millet. Plant J. 2022, 110, 1213–1228. [Google Scholar] [CrossRef]
- Niwa, Y.; Ito, S.; Nakamichi, N.; Mizoguchi, T.; Niinuma, K.; Yamashino, T.; Mizuno, T. Genetic linkages of the circadian clock-associated genes, TOC1, CCA1 and LHY, in the photoperiodic control of flowering time in Arabidopsis thaliana. Plant Cell Physiol. 2007, 48, 925–937. [Google Scholar] [CrossRef] [PubMed]
- Kawamura, M.; Ito, S.; Nakamichi, N.; Yamashino, T.; Mizuno, T. The function of the clock-associated transcriptional regulator CCA1 (CIRCADIAN CLOCK-ASSOCIATED 1) in Arabidopsis thaliana. Biosci. Biotechnol. Biochem. 2008, 72, 1307–1316. [Google Scholar] [CrossRef] [PubMed]
- Huang, H.; Alvarez, S.; Bindbeutel, R.; Shen, Z.; Naldrett, M.J.; Evans, B.S.; Briggs, S.P.; Hicks, L.M.; Kay, S.A.; Nusinow, D.A. Identification of evening complex associated proteins in Arabidopsis by affinity purification and mass spectrometry. Mol. Cell. Proteom. 2016, 15, 201–217. [Google Scholar]
- Nagel, D.H.; Doherty, C.J.; Pruneda-Paz, J.L.; Schmitz, R.J.; Ecker, J.R.; Kay, S.A. Genome-wide identification of CCA1 targets uncovers an expanded clock network in Arabidopsis. Proc. Natl. Acad. Sci. USA 2015, 112, E4802–E4810. [Google Scholar]
- Rawat, R.; Takahashi, N.; Hsu, P.Y.; Jones, M.A.; Schwartz, J.; Salemi, M.R.; Phinney, B.S.; Harmer, S.L. REVEILLE8 and PSEUDO-REPONSE REGULATOR5 form a negative feedback loop within the Arabidopsis circadian clock. PLoS Genet. 2011, 7, e1001350. [Google Scholar] [CrossRef] [PubMed]
- Gray, J.A.; Shalit-Kaneh, A.; Chu, D.N.; Hsu, P.Y.; Harmer, S.L. The REVEILLE clock genes inhibit growth of juvenile and adult plants by control of cell size. Plant Physiol. 2017, 173, 2308–2322. [Google Scholar] [CrossRef] [PubMed]
- Bendix, C.; Marshall, C.M.; Harmon, F.G. Circadian clock genes universally control key agricultural traits. Mol. Plant 2015, 8, 1135–1152. [Google Scholar] [CrossRef]
- Hotta, C.T. The evolution and function of the PSEUDO RESPONSE REGULATOR gene family in the plant circadian clock. Genet. Mol. Biol. 2022, 45 (Suppl. 1), e20220137. [Google Scholar] [CrossRef]
- Nakamichi, N. The transcriptional network in the Arabidopsis circadian clock system. Genes 2020, 11, 1284. [Google Scholar] [CrossRef] [PubMed]
- Nakamichi, N.; Kiba, T.; Henriques, R.; Mizuno, T.; Chua, N.H.; Sakakibara, H. PSEUDO-RESPONSE REGULATORS 9, 7, and 5 are transcriptional repressors in the Arabidopsis circadian clock. Plant Cell 2010, 22, 594–605. [Google Scholar] [CrossRef] [PubMed]
- Yuan, L.; Yu, Y.; Liu, M.; Song, Y.; Li, H.; Sun, J.; Wang, Q.; Xie, Q.; Wang, L.; Xu, X. BBX19 fine-tunes the circadian rhythm by interacting with PSEUDO-RESPONSE REGULATOR proteins to facilitate their repressive effect on morning-phased clock genes. Plant Cell 2021, 33, 2602–2617. [Google Scholar] [CrossRef]
- Hotta, C.T.; Gardner, M.J.; Hubbard, K.E.; Baek, S.J.; Dalchau, N.; Suhita, D.; Dodd, A.N.; Webb, A.A. Modulation of environmental responses of plants by circadian clocks. Plant Cell Environ. 2007, 30, 333–349. [Google Scholar] [CrossRef] [PubMed]
- Para, A.; Farre, E.M.; Imaizumi, T.; Pruneda-Paz, J.L.; Harmon, F.G.; Kay, S.A. PRR3 is a vascular regulator of TOC1 stability in the Arabidopsis circadian clock. Plant Cell 2007, 19, 3462–3473. [Google Scholar] [CrossRef] [PubMed]
- Nakamichi, N.; Kiba, T.; Kamioka, M.; Suzuki, T.; Yamashino, T.; Higashiyama, T.; Sakakibara, H.; Mizuno, T. Transcriptional repressor PRR5 directly regulates clock-output pathways. Proc. Natl. Acad. Sci. USA 2012, 109, 17123–17128. [Google Scholar] [CrossRef] [PubMed]
- Kamioka, M.; Takao, S.; Suzuki, T.; Taki, K.; Higashiyama, T.; Kinoshita, T.; Nakamichi, N. Direct repression of evening genes by CIRCADIAN CLOCK-ASSOCIATED1 in the Arabidopsis circadian clock. Plant Cell 2016, 28, 696–711. [Google Scholar] [CrossRef]
- Nakamichi, N.; Kita, M.; Ito, S.; Yamashino, T.; Mizuno, T. PSEUDO-RESPONSE REGULATORS, PRR9, PRR7 and PRR5, together play essential roles close to the circadian clock of Arabidopsis thaliana. Plant Cell Physiol. 2005, 46, 686–698. [Google Scholar] [CrossRef] [PubMed]
- Farré, E.M.; Kay, S.A. PRR7 protein levels are regulated by light and the circadian clock in Arabidopsis. Plant J. 2007, 52, 548–560. [Google Scholar] [CrossRef] [PubMed]
- Zandkarimi, H.; Ebadi, A.; Salami, S.A.; Alizade, H.; Baisakh, N. Analyzing the expression profile of AREB/ABF and DREB/CBF genes under drought and salinity stresses in grape (Vitis vinifera L.). PLoS ONE 2015, 10, e0134288. [Google Scholar] [CrossRef] [PubMed]
- Eftekhari, A.; Baghizadeh, A.; Yaghoobi, M.M.; Abdolshahi, R. Differences in the drought stress response of DREB2 and CAT1 genes and evaluation of related physiological parameters in some bread wheat cultivars. Biotechnol. Biotechnol. Equip. 2017, 31, 709–716. [Google Scholar]
- Lata, C.; Prasad, M. Role of DREBs in regulation of abiotic stress responses in plants. J. Exp. Bot. 2011, 62, 4731–4748. [Google Scholar] [CrossRef] [PubMed]
- Akbudak, M.A.; Filiz, E.; Kontbay, K. DREB2 (dehydration-responsive element-binding protein 2) type transcription factor in sorghum (Sorghum bicolor): Genome-wide identification, characterization and expression profiles under cadmium and salt stresses. 3 Biotech 2018, 8, 426. [Google Scholar] [CrossRef] [PubMed]
- Zhou, Y.; Chen, M.; Guo, J.; Wang, Y.; Min, D.; Jiang, Q.; Ji, H.; Huang, C.; Wei, W.; Xu, H.; et al. Overexpression of soybean DREB1 enhances drought stress tolerance of transgenic wheat in the field. J. Exp. Bot. 2020, 71, 1842–1857. [Google Scholar] [CrossRef] [PubMed]
- Shivaraj, S.M.; Sharma, Y.; Chaudhary, J.; Rajora, N.; Sharma, S.; Thakral, V.; Ram, H.; Sonah, H.; Singla-Pareek, S.L.; Sharma, T.R.; et al. Dynamic role of aquaporin transport system under drought stress in plants. Environ. Exp. Bot. 2021, 184, 104367. [Google Scholar] [CrossRef]
- Alexandersson, E.; Danielson, J.Å.; Råde, J.; Moparthi, V.K.; Fontes, M.; Kjellbom, P.; Johanson, U. Transcriptional regulation of aquaporins in accessions of Arabidopsis in response to drought stress. Plant J. 2010, 61, 650–660. [Google Scholar] [CrossRef]
- Aroca, R.; Ferrante, A.; Vernieri, P.; Chrispeels, M.J. Drought, abscisic acid and transpiration rate effects on the regulation of PIP aquaporin gene expression and abundance in Phaseolus vulgaris plants. Ann. Bot. 2006, 98, 1301–1310. [Google Scholar] [CrossRef] [PubMed]
- Yadav, B.; Jogawat, A.; Gnanasekaran, P.; Kumari, P.; Lakra, N.; Lal, S.K.; Pawar, J.; Narayan, O.P. An overview of recent advancement in phytohormones-mediated stress management and drought tolerance in crop plants. Plant Gene 2021, 25, 100264. [Google Scholar]
- Lim, C.W.; Baek, W.; Jung, J.; Kim, J.H.; Lee, S.C. Function of ABA in stomatal defense against biotic and drought stresses. Int. J. Mol. Sci. 2015, 16, 15251–15270. [Google Scholar] [CrossRef] [PubMed]
- Ilyas, N.; Gull, R.; Mazhar, R.; Saeed, M.; Kanwal, S.; Shabir, S.; Bibi, F. Influence of salicylic acid and jasmonic acid on wheat under drought stress. Commun. Soil Sci. Plant Anal. 2017, 48, 2715–2723. [Google Scholar] [CrossRef]
- Saleem, M.; Fariduddin, Q.; Castroverde, C.D. Salicylic acid: A key regulator of redox signalling and plant immunity. Plant Physiol. Biochem. 2021, 168, 381–397. [Google Scholar] [CrossRef] [PubMed]
- Balcke, G.U.; Handrick, V.; Bergau, N.; Fichtner, M.; Henning, A.; Stellmach, H.; Tissier, A.; Hause, B.; Frolov, A. An UPLC-MS/MS method for highly sensitive high-throughput analysis of phytohormones in plant tissues. Plant Methods 2012, 8, 47. [Google Scholar] [CrossRef] [PubMed]
- Almeida Trapp, M.; De Souza, G.D.; Rodrigues-Filho, E.; Boland, W.; Mithöfer, A. Validated method for phytohormone quantification in plants. Front. Plant Sci. 2014, 5, 417. [Google Scholar] [CrossRef]
Gene Name | Forward Sequence (5′---------3′) | Reverse Sequence (5′---------3′) | Amplicon Size (bp) |
---|---|---|---|
Actin-1 | CGTTTGGATATTTTGCCTGCC | GTAGTCTGTCAGGTCACGCC | 200 |
CCA1 | TTCAGCCACTAGTATGTTGA | GATAGAGAACTTGTTATTGA | 800 |
LHY | GCAATCCTCGGAACCAACCA | GACTGTTTCACGGTGGACTT | 920 |
RVE8 | ACATCCCAACTTCTTCCCCG | CTTGAGCTTCCCATGCCAGA | 958 |
PRR5 | ATGACTAGTAGCGAGGAAGT | TGTTACGTCGTCCAGTTCTT | 400 |
PRR7 | TGGCCCGAGACAAATCTTTC | AAGATCCTGACTATTATTAT | 800 |
DREB1 | ATGACCTCATTTTCTACCTT | TTAATAACTCCAAAGGGACA | 645 |
DREB2 | GGAAGAAGTTTCGGGAGACG | CCAACAAGGTCGGCATCCCG | 429 |
PIP1 | ATGGAAGGGAAAGATGAAGA | TTACGACTTGGACTTGAATG | 861 |
Gene Name | Forward Sequence (5′---------3′) | Reverse Sequence (5′---------3′) | Amplicon Size |
---|---|---|---|
Actin-2 | ATCCTCCGTCTTGACCTTG | TGTCCGTCAGGCAACTCAT | 200 |
TOC1 | AACAAAGTCTTCTTCTTTCT | ACACTCATCTCGACTCTTGT | 600 |
PRR3 | ACCACCTCCCAAAAAATCC | TGGATAAACAAAAATTTAAT | 700 |
PRR9 | AACAAAGTCTTCTTCTTTCT | ACACTCATCTCGACTCTTGT | 500 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Venkat, A.; Muneer, S. Circadian-Mediated Regulation of Growth, Chloroplast Proteome, Targeted Metabolomics and Gene Regulatory Network in Spinacia oleracea Under Drought Stress. Agriculture 2025, 15, 522. https://doi.org/10.3390/agriculture15050522
Venkat A, Muneer S. Circadian-Mediated Regulation of Growth, Chloroplast Proteome, Targeted Metabolomics and Gene Regulatory Network in Spinacia oleracea Under Drought Stress. Agriculture. 2025; 15(5):522. https://doi.org/10.3390/agriculture15050522
Chicago/Turabian StyleVenkat, Ajila, and Sowbiya Muneer. 2025. "Circadian-Mediated Regulation of Growth, Chloroplast Proteome, Targeted Metabolomics and Gene Regulatory Network in Spinacia oleracea Under Drought Stress" Agriculture 15, no. 5: 522. https://doi.org/10.3390/agriculture15050522
APA StyleVenkat, A., & Muneer, S. (2025). Circadian-Mediated Regulation of Growth, Chloroplast Proteome, Targeted Metabolomics and Gene Regulatory Network in Spinacia oleracea Under Drought Stress. Agriculture, 15(5), 522. https://doi.org/10.3390/agriculture15050522