Gene Mining and Genetic Effect Analysis Reveal Novel Loci, TaZn-2DS Associated with Zinc Content in Wheat Grain
Abstract
1. Introduction
2. Materials and Methods
2.1. Plant Materials
2.2. Field Experimental Design
2.3. Phenotypic Evaluation
- (1)
- When the wheat matured, we harvested and threshed manually. Approximately 2 g of normal grains were randomly chosen, placed in a paper bag, sealed, and dried at 80 °C until a constant weight was attained.
- (2)
- After drying, the samples were ground using a tungsten carbide ball mill instrument (Retsch MM400, Haan, Germany). The grinding instrument was set at 20 times per second and operated for 30 s to obtain whole wheat flour.
- (3)
- A total of 0.2 g dried whole wheat flour was weighed and placed in a digestion tube (HVE56). A total of 5 mL of HNO3 (analytical grade) solution was added. The digestion tube was placed in a microwave digestion instrument (Anton-Paar, Multiwave 4000, Graz, Austria) for digestion until it became completely transparent. After cooling, the volume was adjusted to 25 mL.
- (4)
- GZnC was determined using an inductively coupled plasma optical emission spectrometer (Agilent 5110 ICP-OES, Santa Clara, CA, USA). The detection wavelength was set at 213.857 nm.
- (5)
- The calculation formula for GZnC is as follows:
2.4. Statistical Analysis
2.5. Genome-Wide Association Study (GWAS)
2.6. Construction of Genetic Linkage Map
2.7. Development of KASP Markers
2.8. Identification of Candidate Genes
3. Results
3.1. Phenotypic Variation of GZnC in AH Population and CH Population
3.2. Linkage Analysis and QTL Genetic Effect Analysis of GZnC in AH Population
3.3. GWAS of QGZn.haust-AH-2D in CH Population
3.4. Co-Localization Analysis of QGZn.haust-AH-2D and QGZn.haust-CH-2D
3.5. Development and Validation of KASP Markers
3.6. Fine Mapping and Genetic Effect Analysis of TaZn-2DS
4. Discussion
4.1. Comparative Analysis of Significant Loci in GZnC
4.2. Candidate Gene Analysis of TaZn-2DS
4.3. KASP Markers for Molecular Marker-Assisted Breeding
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Fan, J.; Jin, Y.; Liu, J.; Fei, X. Studies on the Degradation Pattern of Wheat Malt Endo-1,4-β-Xylanase on Wheat-Derived Arabinoxylans. J. Sci. Food Agric. 2024, 104, 4278–4285. [Google Scholar] [CrossRef] [PubMed]
- Sun, M.; Luo, Q.; Zheng, Q.; Tong, J.; Wang, Y.; Song, J.; Zhang, Y.; Pu, Z.; Zheng, J.; Liu, L.; et al. Molecular Characterization of Stable QTL and Putative Candidate Genes for Grain Zinc and Iron Concentrations in Two Related Wheat Populations. Theor. Appl. Genet. 2023, 136, 217. [Google Scholar] [CrossRef]
- Kandwal, P.; Fujiwara, T.; Kamiya, T. OsVIT2 Mutation Increases Fe and Zn of Grain without Compromising the Growth in Paddy Field. Front. Plant Sci. 2022, 13, 868661. [Google Scholar] [CrossRef] [PubMed]
- Kumar, S.; Hash, C.; Nepolean, T.; Mahendrakar, M.; Satyavathi, C.; Singh, G.; Rathore, A.; Yadav, R.; Gupta, R.; Srivastava, R. Mapping Grain Iron and Zinc Content Quantitative Trait Loci in an Iniadi-Derived Immortal Population of Pearl Millet. Genes 2018, 9, 248. [Google Scholar] [CrossRef]
- Semba, R.D.; Askari, S.; Gibson, S.; Bloem, M.W.; Kraemer, K. The Potential Impact of Climate Change on the Micronutrient-Rich Food Supply. Adv. Nutr. 2021, 13, 80–100. [Google Scholar] [CrossRef]
- Yasuda, H.; Tsutsui, T. Infants and Elderlies Are Susceptible to Zinc Deficiency. Sci. Rep. 2016, 6, 21850. [Google Scholar] [CrossRef]
- Li, X.; Wang, F.; Feng, X.; Xiao, Q.; Zheng, Q.; Xu, J.; Ma, J.; Ji, J.; Lu, S. A Nationwide Investigation of Trace Elements in Rice and Wheat Flour in China: Levels, Spatial Distributions and Implications for Human Exposure. Environ. Sci. Pollut. Res. 2023, 30, 75235–75246. [Google Scholar] [CrossRef]
- Andersson, M. Progress Update: Crop Development of Biofortified Staple Food Crops under HarvestPlus. Afr. J. Food Agric. Nutr. Dev. 2017, 17, 11905–11935. [Google Scholar] [CrossRef]
- Ma, J.; Qi, S.; Yuan, M.; Zhao, D.; Zhang, D.; Feng, J.; Wang, J.; Li, W.; Song, C.; Wang, T.; et al. A Genome-Wide Association Study Revealed the Genetic Variation and Candidate Genes for Grain Copper Content in Bread Wheat (Triticum aestivum L.). Food Funct. 2022, 13, 5177–5188. [Google Scholar] [CrossRef]
- Govindan, V.; Singh, R.P.; Juliana, P.; Mondal, S.; Bentley, A.R. Mainstreaming Grain Zinc and Iron Concentrations in CIMMYT Wheat Germplasm. J. Cereal Sci. 2022, 105, 103473. [Google Scholar] [CrossRef]
- Gupta, P.K.; Balyan, H.S.; Sharma, S.; Kumar, R. Biofortification and Bioavailability of Zn, Fe and Se in Wheat: Present Status and Future Prospects. Theor. Appl. Genet. 2020, 134, 1–35. [Google Scholar] [CrossRef] [PubMed]
- Kaur, H.; Sharma, P.; Kumar, J.; Singh, V.K.; Vasistha, N.K.; Gahlaut, V.; Tyagi, V.; Verma, S.K.; Singh, S.; Dhaliwal, H.S.; et al. Genetic Analysis of Iron, Zinc and Grain Yield in Wheat-Aegilops Derivatives Using Multi-Locus GWAS. Mol. Biol. Rep. 2023, 50, 9191–9202. [Google Scholar] [CrossRef]
- Zhou, Z.; Shi, X.; Zhao, G.; Qin, M.; Ibba, M.I.; Wang, Y.; Li, W.; Yang, P.; Wu, Z.; Lei, Z.; et al. Identification of Novel Genomic Regions and Superior Alleles Associated with Zn Accumulation in Wheat Using a Genome-Wide Association Analysis Method. Int. J. Mol. Sci. 2020, 21, 1928. [Google Scholar] [CrossRef]
- Ren, P.; Zhao, D.; Zeng, Z.; Yan, X.; Zhao, Y.; Lan, C.; Wang, C. Pleiotropic Effect Analysis and Marker Development for Grain Zinc and Iron Concentrations in Spring Wheat. Mol. Breed. 2022, 42, 49. [Google Scholar] [CrossRef] [PubMed]
- Sun, M.; Tong, J.; Dong, Y.; Pu, Z.; Zheng, J.; Zhang, Y.; Zhang, X.; Hao, C.; Xu, X.; Cao, Q.; et al. Molecular Characterization of QTL for Grain Zinc and Iron Concentrations in Wheat Landrace Chinese Spring. Theor. Appl. Genet. 2024, 137, 148. [Google Scholar] [CrossRef]
- Bi, J.; Zeng, Z.; Li, Q.; Hong, Z.; Yan, Q.; Zhao, Y.; Wang, C. QTL Mapping and KASP Marker Development of Grain Quality-Relating Traits in Two Wheat RIL Populations. Acta Agron. Sin. 2024, 50, 669–1683. [Google Scholar] [CrossRef]
- Li, Q.; Zeng, Z.; Zhao, Y.; Li, J.; Chen, F.; Wang, C. Genome-Wide Association Study and Linkage Mapping Reveal TaqW-6B Associated with Water-Extractable Arabinoxylan Content in Wheat Grain. Theor. Appl. Genet. 2024, 137, 166. [Google Scholar] [CrossRef]
- Jia, Y.; Xu, N.; Zhang, J.; Ren, K.; Wu, J.; Wang, C.; Huang, M.; Li, Y. Combined Genome-Wide Association Studies (GWAS) and Linkage Mapping Identifies Genomic Regions Associated with Seedling Root System Architecture (RSA) under Different Nitrogen Conditions in Wheat (Triticum aestivum L.). Agriculture 2024, 14, 1652. [Google Scholar] [CrossRef]
- Meng, L.; Li, H.; Zhang, L.; Wang, J. QTL IciMapping: Integrated software for genetic linkage map construction and quantitative trait locus mapping in biparental populations. Crop J. 2015, 3, 269–283. [Google Scholar] [CrossRef]
- Ma, J.; Cao, Y.; Li, H. Genome-wide association study of ear cob diameter in maize. Acta Agron. Sin. 2021, 47, 1228–1238. [Google Scholar] [CrossRef]
- Yang, X.; Pan, Y.; Singh, P.K.; He, X.; Ren, Y.; Zhao, L.; Zhang, N.; Cheng, S.; Chen, F. Investigation and Genome-Wide Association Study for Fusarium Crown Rot Resistance in Chinese Common Wheat. BMC Plant Biol. 2019, 19, 153. [Google Scholar] [CrossRef]
- Lv, G.; Dong, Z.; Wang, Y.; Geng, J.; Li, J.; Lv, X.; Sun, C.; Ren, Y.; Zhang, J.; Chen, F. Identification of Genetic Loci of Black Point in Chinese Common Wheat by Genome-Wide Association Study and Linkage Mapping. Plant Dis. 2020, 104, 2005–2013. [Google Scholar] [CrossRef]
- Liu, X.; Huang, M.; Fan, B.; Buckler, E.S.; Zhang, Z. Iterative Usage of Fixed and Random Effect Models for Powerful and Efficient Genome-Wide Association Studies. PLoS Genet. 2016, 12, e1005767. [Google Scholar] [CrossRef] [PubMed]
- Huang, M.; Liu, X.; Zhou, Y.; Summers, R.M.; Zhang, Z. BLINK: A Package for the next Level of Genome-Wide Association Studies with Both Individuals and Markers in the Millions. Gigascience 2019, 8, giy154. [Google Scholar] [CrossRef] [PubMed]
- Wang, Q.; Tian, F.; Pan, Y.; Buckler, E.S.; Zhang, Z. A SUPER Powerful Method for Genome Wide Association Study. PLoS ONE 2014, 9, e107684. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Zeng, Z.; Li, J.; Zhao, D.; Zhao, Y.; Peng, C.; Lan, C.; Wang, C. Identification and Validation of New Quantitative Trait Loci for Spike-Related Traits in Two RIL Populations. Mol. Breed. 2023, 43, 64. [Google Scholar] [CrossRef]
- Mccouch, S.; Cho, Y.; Yano, M.; Paul, E.; Blinstrub, M.; Morishima, H. Report on qtl nomenclature. Rice Genet. Newsl. 1997, 14, 11–13. [Google Scholar]
- Ma, S.; Wang, M.; Wu, J.; Guo, W.; Chen, Y.; Li, G.; Wang, Y.; Shi, W.; Xia, G.; Fu, D.; et al. WheatOmics: A Platform Combining Multiple Omics Data to Accelerate Functional Genomics Studies in Wheat. Mol. Plant 2021, 14, 1965–1968. [Google Scholar] [CrossRef]
- Welch, R.M.; Graham, R.D. Breeding for Micronutrients in Staple Food Crops from a Human Nutrition Perspective. J. Exp. Bot. 2004, 55, 353–364. [Google Scholar] [CrossRef]
- Cakmak, I.; Torun, A.; Millet, E.; Feldman, M.; Fahima, T.; Korol, A.; Nevo, E.; Braun, H.J.; Özkan, H. Triticum dicoccoides: An Important Genetic Resource for Increasing Zinc and Iron Concentration in Modern Cultivated Wheat. Soil Sci. Plant Nutr. 2004, 50, 1047–1054. [Google Scholar] [CrossRef]
- Manjunath, K.K.; Krishna, H.; Devate, N.B.; Sunilkumar, V.P.; Chauhan, D.; Singh, S.; Mishra, C.N.; Singh, J.B.; Sinha, N.; Jain, N.; et al. Mapping of the QTLs Governing Grain Micronutrients and Thousand Kernel Weight in Wheat (Triticum aestivum L.) Using High Density SNP Markers. Front. Nutr. 2023, 10, 1105207. [Google Scholar] [CrossRef]
- Soriano, J.M.; Colasuonno, P.; Marcotuli, I.; Gadaleta, A. Meta-QTL Analysis and Identification of Candidate Genes for Quality, Abiotic and Biotic Stress in Durum Wheat. Sci. Rep. 2021, 11, 11877. [Google Scholar] [CrossRef] [PubMed]
- Krishnappa, G.; Khan, H.; Krishna, H.; Kumar, S.; Mishra, C.N.; Parkash, O.; Devate, N.B.; Nepolean, T.; Rathan, N.D.; Mamrutha, H.M.; et al. Genetic Dissection of Grain Iron and Zinc, and Thousand Kernel Weight in Wheat (Triticum aestivum L.) Using Genome-Wide Association Study. Sci. Rep. 2022, 12, 12444. [Google Scholar] [CrossRef] [PubMed]
- He, J.; Liu, F.; Wang, W.; Xing, G.; Guan, R.; Gai, J. Restricted two-stage multi-locus genome-wide association analysis and its applications to genetic and breeding studies. Sci. Agric. Sin. 2020, 53, 1704–1716. [Google Scholar] [CrossRef]
- Xu, J.; Ni, Z.; Chen, F.; Fu, X.; Yu, F. Integrated Linkage Mapping and Genome-Wide Association Study to Dissect the Genetic Basis of Zinc Deficiency Tolerance in Maize at Seedling Stage. Crop J. 2022, 10, 1807–1818. [Google Scholar] [CrossRef]
- Brachi, B.; Morris, G.P.; Borevitz, J.O. Genome-Wide Association Studies in Plants: The Missing Heritability Is in the Field. Genome Biol. 2011, 12, 232. [Google Scholar] [CrossRef]
- Krishnappa, G.; Rathan, N.D.; Sehgal, D.; Ahlawat, A.K.; Singh, S.K.; Singh, S.K.; Shukla, R.B.; Jaiswal, J.P.; Solanki, I.S.; Singh, G.P.; et al. Identification of Novel Genomic Regions for Biofortification Traits Using an SNP Marker-Enriched Linkage Map in Wheat (Triticum aestivum L.). Front. Nutr. 2021, 8, 669444. [Google Scholar] [CrossRef]
- Shi, R.; Li, H.; Tong, Y.; Jing, R.; Zhang, F.; Zou, C. Identification of Quantitative Trait Locus of Zinc and Phosphorus Density in Wheat (Triticum aestivum L.) Grain. Plant Soil 2008, 306, 95–104. [Google Scholar] [CrossRef]
- Deng, M.; Wang, F.; Mao, C. Plant phosphate transporters and its molecular regulation mechanism. Plant Physiol. J. 2017, 53, 377–387. [Google Scholar] [CrossRef]
- Liu, Y.; Zhao, F. Structure and mechanism of ABC transporter. Chin. Bull. Life Sci. 2017, 29, 223–229. [Google Scholar] [CrossRef]
- Winter, D.; Vinegar, B.; Nahal, H.; Ammar, R.; Wilson, G.V.; Provart, N.J. An “Electronic Fluorescent Pictograph” Browser for Exploring and Analyzing Large-Scale Biological Data Sets. PLoS ONE 2007, 2, e718. [Google Scholar] [CrossRef] [PubMed]
Population | Environment | Avocet (mg/kg) | Huites (mg/kg) | Range (mg/kg) | CV (%) a | Kurtosis | Skewness | H2 b | F-Value | |||
---|---|---|---|---|---|---|---|---|---|---|---|---|
G c | E d | G × E | ||||||||||
AH population | E1 | 24.74 ** | 29.42 | 25.39 ± 0.28 | 18.35–32.87 | 11.84 | 0.13 | −0.04 | 0.68 | 61.75 ** | 4868.54 ** | 28.28 ** |
E2 | 25.33 ** | 29.35 | 32.76 ± 0.49 | 23.93–42.08 | 14.93 | 0.52 | −0.00 | |||||
E3 | 30.82 ** | 32.92 | 32.01 ± 0.30 | 23.79–42.38 | 8.26 | 0.54 | −0.01 | |||||
E4 | 26.67 ** | 30.83 | 30.34 ± 0.27 | 22.35–43.78 | 8.56 | 0.66 | 0.83 | |||||
CH population | E5 | - | - | 34.74 ± 0.33 | 23.58–47.88 | 14.70 | 0.38 | −0.06 | 0.48 | 5.09 ** | 3032.11 ** | 4.34 ** |
E6 | - | - | 23.84 ± 0.24 | 16.31–37.75 | 14.60 | 0.50 | 0.75 | |||||
E7 | - | - | 26.77 ± 0.20 | 17.72–38.05 | 11.70 | 0.62 | 1.04 |
QTL | Environment | Physical Position (Mb) | Marker | LOD a | PVE (%) b | Add c |
---|---|---|---|---|---|---|
QGZn.haust-AH-2D | E1 | 13.62–17.82 | 1111273-SNP4993218 | 3.39 | 11.27 | −1.01 |
E2 | 13.62–17.82 | 1111273-SNP4993218 | 4.08 | 5.61 | −1.73 | |
QGZn.haust-AH-3B | E3 | 755.25–808.81 | 1039769-4009392 | 4.11 | 15.00 | −1.52 |
QGZn.haust-AH-4A | E3 | 626.31–626.75 | 3026163-1102703 | 3.18 | 10.67 | −1.26 |
QGZn.haust-AH-4D | E2 | 136.63–181.33 | 3950702-3956991 | 3.30 | 4.31 | −1.43 |
QGZn.haust-AH-5A | E1 | 7.50–74.86 | 977662-2298898 | 3.10 | 10.24 | 0.93 |
QGZn.haust-AH-5B | E1 | 498.71–570.85 | 3947969-4004204 | 2.76 | 8.89 | −0.86 |
QGZn.haust-AH-6A | E2 | 484.85–601.40 | 100462039-100592272 | 9.46 | 14.20 | 2.80 |
E4 | 484.85–601.40 | 100462039-100592272 | 6.15 | 17.36 | 1.70 | |
QGZn.haust-AH-7A | E2 | 652.92–653.58 | SNP1012201-SNP1045045 | 3.50 | 4.62 | −1.48 |
QGZn.haust-AH-7D | E2 | 99.96–100.66 | SNP1082802-3954697 | 3.87 | 5.14 | −1.58 |
QTL | Chr. a | Physical Position (Mb) | No. of SNPs b | Location | Peak SNP c | Position (bp) | p-Value * | R2 (%) d | Models |
---|---|---|---|---|---|---|---|---|---|
QGZn.haust-CH-2B | 2B | 16.99–26.67 | 36 | E6 | AX-95652890 | 26,234,604 | 4.80 × 10−6 | 8.68 | GLM, MLM, FarmCPU, BLINK, SUPER |
E5 | AX-95226752 | 26,670,700 | 5.69 × 10−6 | 9.69 | |||||
QGZn.haust-CH-2D | 2D | 13.61–15.12 | 20 | E6 | AX-94681457 | 13,607,335 | 2.16 × 10−5 | 8.99 | GLM, MLM, FarmCPU, BLINK, SUPER |
E5 | AX-95152978 | 14,802,416 | 6.08 × 10−8 | 11.58 | |||||
QGZn.haust-CH-3B.1 | 3B | 554.56–554.60 | 4 | E6 | AX-109274631 | 554,564,071 | 7.17 × 10−5 | 8.06 | GLM, FarmCPU, BLINK, SUPER |
E7 | AX-110541001 | 554,604,758 | 7.18 × 10−5 | 5.85 | |||||
QGZn.haust-CH-3B.2 | 3B | 591.19–604.61 | 33 | E6 | AX-86178818 | 604,132,925 | 8.80 × 10−6 | 9.83 | GLM, FarmCPU, BLINK, SUPER |
E7 | AX-110940497 | 603,248,051 | 1.41 × 10−5 | 4.42 | |||||
QGZn.haust-CH-5A | 5A | 564.54–567.08 | 6 | E6 | AX-111617968 | 567,083,856 | 8.54 × 10−5 | 7.86 | GLM, SUPER |
E5 | AX-109979093 | 566,958,487 | 3.30 × 10−5 | 6.94 | |||||
QGZn.haust-CH-5B | 5B | 706.31–711.118 | 4 | E6 | AX-110432411 | 708,384,678 | 4.91 × 10−6 | 8.88 | GLM, SUPER |
E5 | AX-109385228 | 711,181,732 | 5.48 × 10−5 | 7.88 | |||||
QGZn.haust-CH-7B | 7B | 706.61–716.21 | 12 | E6 | AX-110923652 | 716,214,977 | 7.98 × 10−5 | 7.85 | GLM, FarmCPU, BLINK |
E5 | AX-110923652 | 714,334,703 | 1.71 × 10−5 | 7.58 |
KASP Marker | Physical Position (bp) | SNP Marker | Primer | Alleles | Sequence (5′-3′) |
---|---|---|---|---|---|
KAZn-2D-1 | 13,607,335 | AX-94681457 | KAZn-2D-1A | T/C | GAAGGTGACCAAGTTCATGCTTGGACTCTAGGTATAAAGACGGT |
KAZn-2D-1B | GAAGGTCGGAGTCAACGGATTTGGACTCTAGGTATAAAGACGGC | ||||
KAZn-2D-1C | GTGTGTTTTCCAGCAAATATCAATC | ||||
KAZn-2D-2 | 14,944,840 | AX-95257896 | KAZn-2D-2A | T/C | GAAGGTGACCAAGTTCATGCTCTCCGGTGAGCTGGTTAGAT |
KAZn-2D-2B | GAAGGTCGGAGTCAACGGATTCTCCGGTGAGCTGGTTAGAC | ||||
KAZn-2D-2C | TCCTAATAGTGCTACTTTGCTTGT | ||||
KAZn-2D-3 | 15,115,176 | AX-94647307 | KAZn-2D-3A | T/C | GAAGGTGACCAAGTTCATGCTCGATGGATCGCTGAAGGT |
KAZn-2D-3B | GAAGGTCGGAGTCAACGGATTCGATGGATCGCTGAAGGC | ||||
KAZn-2D-3C | ATGTCTCCGCAACATCCTCC |
Varieties | Zn Content (mg/kg) | Varieties | Zn Content (mg/kg) | |
---|---|---|---|---|
NA population | PEWTER | 42.79 | CAILLOUX | 46.37 |
MARFED | 43.19 | YAQUI 50 | 48.82 | |
PROVENCE | 43.56 | CHEYENNE | 48.91 | |
Quality | 43.59 | AC KARMA | 53.46 | |
Youzi Wheat | 45.09 | RED FIFE | 54.96 | |
CH population | Luo 1807 | 46.92 | Jingyu Mai 1 | 42.92 |
Qunxi Mai 11 | 40.10 | Xinmai 12 | 40.68 | |
Heyu 1 | 45.53 | Yumai 117 | 46.89 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hong, Z.; Zeng, Z.; Li, J.; Yan, X.; Song, J.; Yan, Q.; Li, Q.; Zhao, Y.; Liu, C.; Jing, X.; et al. Gene Mining and Genetic Effect Analysis Reveal Novel Loci, TaZn-2DS Associated with Zinc Content in Wheat Grain. Agriculture 2025, 15, 124. https://doi.org/10.3390/agriculture15020124
Hong Z, Zeng Z, Li J, Yan X, Song J, Yan Q, Li Q, Zhao Y, Liu C, Jing X, et al. Gene Mining and Genetic Effect Analysis Reveal Novel Loci, TaZn-2DS Associated with Zinc Content in Wheat Grain. Agriculture. 2025; 15(2):124. https://doi.org/10.3390/agriculture15020124
Chicago/Turabian StyleHong, Zhuangzhuang, Zhankui Zeng, Jiaojiao Li, Xuefang Yan, Junqiao Song, Qunxiang Yan, Qiong Li, Yue Zhao, Chang Liu, Xueyan Jing, and et al. 2025. "Gene Mining and Genetic Effect Analysis Reveal Novel Loci, TaZn-2DS Associated with Zinc Content in Wheat Grain" Agriculture 15, no. 2: 124. https://doi.org/10.3390/agriculture15020124
APA StyleHong, Z., Zeng, Z., Li, J., Yan, X., Song, J., Yan, Q., Li, Q., Zhao, Y., Liu, C., Jing, X., & Wang, C. (2025). Gene Mining and Genetic Effect Analysis Reveal Novel Loci, TaZn-2DS Associated with Zinc Content in Wheat Grain. Agriculture, 15(2), 124. https://doi.org/10.3390/agriculture15020124