Identification of Stem Rust Resistance Genes in Triticum Wheat Cultivars and Evaluation of Their Resistance to Puccinia graminis f. sp. tritici
by
Fu Gao
1,†,
Xianxin Wu
1,2,†,
Huiyan Sun
1,
Ziye Wang
1,
Si Chen
3,
Longmei Zou
1,
Jinjing Yang
1,
Yifan Wei
1,
Xinyu Ni
1,
Qian Sun
1 and
Tianya Li
1,* 1
College of Plant Protection, Shenyang Agricultural University, Shenyang 110866, China
2
Institute of Agricultural Quality Standards and Testing Technology, Liaoning Academy of Agricultural Sciences, Shenyang 110161, China
3
Institute of Industrial Crops, Heilongjiang Academy of Agricultural Sciences, Harbin 150086, China
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Agriculture 2024, 14(2), 198; https://doi.org/10.3390/agriculture14020198
Submission received: 2 January 2024
/
Revised: 24 January 2024
/
Accepted: 25 January 2024
/
Published: 26 January 2024
(This article belongs to the Section Genotype Evaluation and Breeding)
Abstract
:Wheat stem rust, caused by the fungus Puccinia graminis f. sp. tritici (Pgt), poses a substantial threat to global wheat production. Utilizing stem rust resistance (Sr) genes represents an economically viable, effective, and environmentally friendly approach to disease control. In this study, gene postulation, molecular testing, and pedigree analysis were used to identify the presence of Sr genes in 45 wheat cultivars. In addition, the resistance of these cultivars was evaluated against two predominant Pgt races, 34MRGQM and 21C3CTHTM, at the adult-plant stage during 2021–2022. The results identify seven Sr genes (Sr31, Sr38, Sr30, SrTmp, Sr22, Sr19, and Sr5) within 35 wheat cultivars. Among these, 23 cultivars contained Sr31, whereas Sr5 and SrTmp were present in four cultivars each. Han 5316, Shimai 15, Shiyou 20, and Kenong 1006 exhibited the presence of Sr19, Sr22, Sr30, and Sr38, respectively. Molecular studies confirmed the absence of Sr25 and Sr26 in any of the wheat cultivars. During field evaluation, 37 (82.2%) and 39 (86.7%) wheat cultivars demonstrated resistance to races 34MRGQM and 21C3CTHTM, respectively. Moreover, 33 wheat cultivars (73.3%) exhibited resistance to all the tested races. These study findings will significantly contribute to future research in wheat pre-breeding and abiotic stress tolerance.
1. Introduction
Wheat, as the third major staple crop, plays a crucial role in the global food supply and food security. However, its production is persistently affected by various biological and abiotic diseases [1,2]. Wheat stem rust, caused by Puccinia graminis f. sp. tritici (Pgt), has a severe impact on wheat production worldwide [3]. Since the 1970s, the use of wheat cultivars carrying Sr31 has effectively controlled the disease globally [4]. However, Pgt exhibits the ability to constantly change its virulence, overcome cultivar resistance, and lead to epidemics. For example, Ug99, a new race of Pgt overcoming Sr31 resistance, was first documented in Uganda in 1999. This race, named as TTKS according to the international nomenclature for Pgt, was later renamed as TTKSK due to the addition of a fifth differential set to the nomenclature [5,6]. TTKSK exhibits characteristics of rapid mutation and virulence. Currently, 15 mutated races belonging to the TTKSK lineage have been identified in 14 countries over the past two decades, successfully evading the resistance of globally utilized Sr genes (Sr31, Sr24, Sr36, Sr31 + Sr36 + Sr38, and Sr24 + Sr31 + Sr38) [7,8,9,10,11]. More seriously, this race and its derivative races have demonstrated highly pathogenic characteristics in the majority of wheat cultivars worldwide. Between 2005 and 2010, over 200,000 wheat cultivars, advanced breeding materials, and germplasm collections originating from 22 wheat-producing countries in Asia and Africa were evaluated for disease resistance in Kenya and Ethiopia. The results indicate that less than 10% of the materials exhibited a certain degree of resistance to Ug99 [12].
In 2013, the emergence of the new race TKTTF triggered an outbreak of wheat stem rust in Ethiopia, resulting in nearly 100% yield loss for the wheat cultivar “Digalu” [13]. Since the mid-20th century, wheat stem rust prevalence has become increasingly uncommon in Western Europe, resulting in the neglect of resistance breeding. Consequently, European wheat cultivars are vulnerable to wheat stem rust due to a lack of resistance. However, during the 21st century, a resurgence of wheat stem rust occurred in several European countries, where it had been absent for decades. In 2013 and 2014, TKTTF was detected in Germany [14], Denmark, and the United Kingdom in Europe [15], leading to severe losses in wheat yield. In 2016, the stem rust race TTTTF caused the breakdown of resistance in numerous durum and bread wheat varieties in Sicily, representing a significant threat that has been identified in other European countries [16]. In addition, an outbreak of wheat stem rust in Switzerland in 2017 resulted in a significant reduction in wheat productivity [14]. In 2020, an unprecedented occurrence of wheat stem rust was detected for the first time across multiple locations in Ireland. Transcriptome sequencing revealed that the isolates exhibited a remarkably close genetic relationship with race TKTTF [17].
Historically, the incidence of wheat stem rust in China has occurred mainly in the northeast region of Inner Mongolia, northwest spring wheat areas, and southern Yunnan [18]. Incomplete statistical records indicate that, from the 1920s to the 1970s, nine significant epidemics ravaged the wheat-planted regions of the northeast, resulting in staggering losses. For instance, in 1923 and 1948, losses amounted to 7.4 × 109 kg and 5.6 × 109 kg, respectively. Moreover, the devastating outbreaks of 1956 and 1958 in the Jianghuai wheat region led to wheat losses of up to 1 × 1010 kg [19]. However, since the 1970s, this disease has been effectively contained, primarily occurring sporadically in localized areas.
The Sr31 gene is present in approximately 60% of wheat cultivars in China, making the Ug99 race group a substantial threat to the safe production of wheat in China [20]. Hence, it is imperative to conduct analyses on wheat cultivars to assess their resistance to wheat stem rust and identify the specific resistance genes present, thereby aiding local wheat production risk assessment. To date, more than 70 Sr genes have been identified and named, originating from both cultivated wheat and its wild relatives [21]. Although most of these confer race-specific resistance, certain resistance genes, including Sr2, Sr55, Sr57, and Sr58, do not exhibit race specificity. In recent years, gene postulation and molecular marker technology, combined with cultivar pedigree analysis, have been extensively used to identify wheat stem rust resistance genes. For instance, Mourad et al. utilized gene-specific markers to analyze the presence of Sr genes in 330 genotypes from two nurseries in Nebraska [22]. The results indicate the existence of nine Sr genes (Sr24, Sr31, Sr38, Sr6, Sr7b, Sr9b, Sr36, Sr1RSamigo, and SrTmp) within these genotypes. Similarly, Haile et al. employed STS and SSR markers linked to major Sr genes to screen these genes in 58 tetraploid wheat materials in Ethiopia [23]. Li et al. conducted molecular marker assays to screen Yunnan wheat cultivars for resistance genes, revealing that 12 of the 119 wheat cultivars tested contained Sr28, 43 contained Sr31, 1 contained Sr32, and 10 contained Sr38 [24]. Moreover, Wu et al. applied molecular markers linked with Sr22, Sr25, Sr26, and Sr28 to detect the presence of these genes in 119 Yunnan wheat cultivars (lines) and 20 CIMMYT Ug99 resistance materials. Their analysis identified two CIMMYT materials containing Sr25, one containing Sr26, and one containing Sr28, while among the 119 wheat cultivars, only 12 were discovered to contain Sr28 [25].
The Shandong, Shanxi, Hebei, and Henan provinces are prominent wheat production areas in China. The latest statistical yearbook illustrates that the combined wheat cultivation area in these provinces amounts to 1.25 × 107 square hectares, accounting for 52.9% of the national cultivation area. The wheat yield in these regions reaches 8.15 × 104 million kg, accounting for 59.53% of the national wheat yield (http://www.stats.gov.cn/, accessed on 1 January 2024). Historically, these regions have been plagued by recurrent wheat stem rust outbreaks, which gravely affect local wheat production [26,27]. With the persistent emergence of Pgt on a global scale, it is of great significance to clarify the resistance of wheat cultivars to wheat stem rust and to identify the major resistance genes contained in wheat cultivars. Therefore, this study employed molecular testing, gene postulation, and lineage analysis to identify the presence of resistance genes in 45 prominent cultivars from Shandong, Shanxi, and Hebei provinces. In addition, we investigated their field responses to two predominant races (34MRGQM and 21C3CTHTM) in China.
2. Materials and Methods
2.1. Plant Materials and Pgt Races
Dr. Yan Hongfei from the Hebei Agricultural University of Hebei Province (latitude 38°82′ E, longitude 115°44′ N), China, contributed to the collection of 45 distinct wheat cultivars for this study (Supplemental Table S1). Forty-three monogenic lines used in this study were sourced from the Institute of Plant Immunity, Shenyang Agricultural University. These lines were instrumental in evaluating the virulence spectrum of Pgt and confirming the reliability of the molecular markers employed. The Little Club cultivar was used as a universally susceptible control. To assess the resistance capacity of the wheat cultivars to diverse races, 10 distinct races (34C3MKGSM, 34C6MTGSM, 34MRGQM, 21C3CTTTM, 21C3CTHTM, 34MKGQM, 34MTGSM, 21C3CTTSC, 34C3MTGQM, and MTSRR) of Pgt with different virulence spectra were identified by applying an international nomenclature for Pgt at the Institute of Plant Immunity, Shenyang Agricultural University [5,20].
2.2. Determination of Infection Types
The 10 Pgt races were propagated in a greenhouse and stored at 4 °C. In a controlled glass greenhouse environment, seeds of 45 wheat lines and 43 known Sr monogenic lines were individually planted in pots (10 cm in diameter and 12 cm in height) filled with a vermiculite and sand mixture (3:2, v/v), leveled to pH 7.2, with 10 seeds per pot for each line. The susceptible wheat cultivar LC, lacking any resistance genes to stem rust, was included as a control. Infection types (ITs) were performed at the one-leaf stage (approximately 8–10 d old) of the plants. The first leaves were sprayed with a 0.05% Tween 20 aqueous solution, followed by dust inoculation with a mixture of talcum and urediniospores (20:1, v/v) [3]. Subsequently, another round of spraying with a 0.05% Tween 20 aqueous solution was performed to create a moisturizing film. The inoculated wheat plants were then maintained at a temperature range from 18 °C to 20 °C for 16 h and cultivated in the greenhouse at a temperature of 20 °C ± 1 °C. Each isolate was subjected to three tests. When the wheat cultivar LC was fully sporulated, ITs were recorded approximately two weeks post-inoculation using a 0–4 scale. Low ITs of Pgt in wheat (0, 1−, 1, 1+, 2, and 2+) were classified as resistant, whereas high ITs (3−, 3, 3+, and 4) were categorized as susceptible [28]. According to the infection phenotype of the cultivar to be tested and the phenotype of the monogenic lines of the known Sr gene, the presence of the respective gene was deduced adhering to the method described by Dubin et al. [29].
2.3. Field Evaluation at the Adult-Plant Stage (APS)
In the third week of March, in both 2021 and 2022 (70–72 d after sowing), all wheat cultivars designated for testing purposes were meticulously planted within the experimental grounds of Shenyang Agricultural University (latitude 41°49′ N, longitude 123°33′ E, and altitude 67 m). The cultivation method involved planting a single row of each cultivar (1 m in length with a row spacing of 25 cm). In addition, for every 10 rows, a row of the susceptibility control cultivar LC was included. The field test utilized two prevalent races, 34MRGQM and 21C3CTHTM, which have dominated in China over the past three decades. An inoculation test was conducted at the jointing stage, with the soil maintained completely humid using water on the day of inoculation. Inoculation commenced at sunset, involving the application of a 20% Tween 20 solution to create a layer of dew on the leaves, followed by dust inoculation with a 1:30 volume ratio of urediniospores and talcum powder. The inoculated wheat plants were covered with plastic to maintain moisture for 14 h [30]. Maximum severity and infection response (IR) were assessed during the heading and flowering stages using a modified Cobb scale, as described by Roelfs et al. [31]. The climatic conditions are listed in Supplemental Table S2.
2.4. Molecular Markers for Stem Rust Resistance Gene
Genomic DNA was extracted from 45 wheat lines using CTAB [32]. All cultivars were detected using molecular markers that were closely linked to Sr24, Sr25, Sr26, Sr31, and Sr38. Polymerase chain reaction (PCR) systems were adjusted following the provided instructions. Table 1 outlines the PCR annealing temperature, array size, and primer sequences.
3. Results
3.1. Sr genes in the Wheat Cultivars Based on Gene Postulation and Molecular Marker Analysis
The seedling ITs of 43 monogenic lines containing known Sr genes and 45 wheat test lines when tested with 10 Chinese Pgt races are shown in Table 2 and Table 3, respectively. Nine lines with Sr31, Sr38, Sr44, Sr40, Sr33, Sr26, Sr21, SrTt3, and Sr9e genes were resistant to all races, exhibiting ITs ranging from 0 to 2. Conversely, 10 lines with Sr39, Sr16, Sr9g, Sr9f, Sr9d, Sr9b, Sr9a, Sr8a, Sr7b, and Sr6 were susceptible to all races, demonstrating ITs ranging from 3 to 4. These observations indicate that these 19 Sr genes could not be accurately identified by gene postulation. However, the remaining lines, containing Sr38, Sr37, Sr36, Sr35, Sr34, Sr32, Sr30, Sr28, Sr27, Sr25, Sr24, Sr23, Sr22, Sr19, Sr18, Sr17, Sr15, Sr13, Sr12, Sr11, Sr10, and Sr5, exhibited high and low ITs to the tested races. Therefore, these 22 genes could be identified through gene postulation. Through a combination of molecular detection and gene postulation methods, seven Sr genes (Sr31, Sr38, Sr5, Sr19, Sr22, Sr30, and SrTmp) were identified in the 36 wheat cultivars.
The results of the molecular markers confirmed the presence of Sr31 in the 23 wheat cultivars (Figure 1 and Table 3). All wheat cultivars containing Sr31 were further confirmed by gene postulation because these lines were also resistant to all tested races. Five cultivars (Heng 136, Henong 826, Shunmai 1718, Yunhan 618, and Jishi 02-1 strong gluten) demonstrated low ITs to three Sr5-avirulent races (21C3CTTTM, 21C3CTTSC, and 21C3CTHTM), and high ITs to all other races, suggesting the presence of Sr5. Han 5316 displayed high ITs for 34MTGSM and low ITs for all other races, which was consistent with the resistance spectrum of the monogenic line containing Sr19. Therefore, it was postulated that Han 5316 contains Sr19. The susceptibility of Shimai 15 to 34MRGQM, but resistance to other races, suggested the presence of Sr22. Based on the susceptibility of the Shiyou 20 cultivar to races MTSSR, 21C3CTTTM, and 21C3CTTSC, coupled with its resistance to all other races, it was likely that Shiyou 20 harbored the Sr30 resistance gene. Four wheat cultivars (Jimai 22, Jinan 17, Jimai 19, and Shannong 28) were resistant to seven SrTmp avirulent races (34C6MTGSM, 34C3MTGQM, 34C3MKGSM, 34MRGQM, 34MKGQM, 34MTGSM, and 21C3CTTSC), and susceptible to three SrTmp virulent races (MTSRR, 21C3CTTTM, and 21C3CTHTM), suggesting the potential presence of SrTmp. Furthermore, molecular marker analysis revealed that Kenong 1006 contained Sr38, whereas no wheat cultivars harbored the genes Sr25 and Sr26.
3.2. Field Evaluation
From 2021 to 2022, the IRs of 45 wheat cultivars were evaluated against two predominant races: 34MRGQM and 21C3CTHTM (Table 4). The IRs of all the wheat cultivars were divided into three categories: immunity, resistance to moderate resistance, and susceptibility to moderate susceptibility (Table 5). In field trials conducted in 2021 and 2022, 37 wheat cultivars (82.2%) and 39 wheat cultivars (86.7%) showed resistance to races 34MRGQM and 21C3CTHTM, respectively. Overall, 33 wheat cultivars (73.3%) were resistant to all tested races.
4. Discussion
Sr5 serves as the main gene for standard identification of Pgt in China. It can distinguish races of Pgt in almost all countries [30]. To date, based on the virulence of Pgt toward this gene, all wheat stem rust isolates in China can be classified into either 34 race groups (e.g., 34C0MKGSM and 34C0MRGQM) with virulence to Sr5 or 21 race groups (e.g., 21C3CTHTM and 21C3CKHQM) without virulence to Sr5 [33]. Although Sr5 exhibits susceptibility to Ug99, it has shown excellent resistance to the Chinese-dominated 21C3 race. In this study, five wheat cultivars were postulated to contain Sr5, accounting for 11.1% of the experimental materials. In the field experiment, wheat cultivars containing Sr5 showed high resistance to 21C3CTHTM, with disease severity levels below or equal to 30%. As an important resistance gene in wheat in China, Sr5 also plays a vital role in the accumulation of lignin and callose in wheat tissues following stem rust infection [34].
Sr19, originated from the 2B chromosome of Triticum aestivum L., is characterized by the absence of resistance to Ug99. In this study, among the 45 wheat cultivars examined, the presence of Sr19 was identified in a single cultivar (Han 5316). At the adult-plant stage, Han 5316 exhibited robust resistance (5-20R) to two dominant races in China, namely 34MRGQM and 21C3CTHTM. At the seedling stage, Han 5316 presented low ITs (0-2) to nine races in China, with only three ITs to 34MTGSM. The IT of the wheat cultivar Han 5316 containing Sr19 to the Chinese race 34C3MTGQM was determined to be one. This is contrary to the results reported in previous studies, suggesting that Han 5316 may possess an additional resistance gene conferring resistance to 34C3MTGQM.
Sr22 is derived from Triticum monococcum L., presenting excellent resistance to the new race Ug99 of Pgt, as well as the predominant race groups 21C3 and 34C2 in China. Located on the 7AL chromosome, Sr22 is a temperature-sensitive gene whose resistance level increases with decreasing temperature, which makes it difficult to identify the existence of this gene. In this study, only one of the 45 wheat cultivars was identified to possess Sr22 (Shimai 15). In the field experiment, Shimai 15 presented resistance to races 34MRGQM and 21C3CTHTM, with disease severity levels below or equal to 30%. In wheat cultivar identification within other regions, only four of the eighteen main cultivated materials in Heilongjiang Province were found to contain Sr22 [35]. Similarly, Li et al. employed Xcfa2019-specific primers to detect 283 wheat cultivars in China, including 20 cultivars resistant to Ug99 from CIMMYT [24]. Their investigation revealed that none of these cultivars contained the resistance gene Sr22. This suggests the absence of this gene in the Chinese wheat cultivars during the breeding process.
Sr30, derived from the long arm of the 5D chromosome of T. aestivum L. [36], exhibits discriminatory capabilities against specific races of Pgt (34C4 and 34C5) from other races in the 34-race group in China [20]. Specifically, Sr30 demonstrates susceptibility to races 34C4 and 34C5 while presenting resistance against races 34, 34C1, 34C2, and 34C3. Although Sr30 lacks resistance to Ug99, it serves as the main disease resistance gene in wheat cultivars (lines) in Yunnan Province, China, and presents robust resistance to other races in China [37]. In this study, only one of the 45 wheat cultivars tested (Shiyou 20 strong gluten) was identified to contain Sr30.
Sr31 currently stands as the most widely used resistance gene for stem rust. Since the 1960s, cultivars of the Soviet Union and Romania containing Sr31 have been introduced and extensively employed in wheat breeding programs across China. Although Sr31 is susceptible to Ug99, it still exhibits excellent resistance to all Pgt races in China. To mitigate the threat of Ug99 and its cultivars to wheat production, the identification of disease-resistant germplasms has become paramount [20]. Therefore, this study aimed to identify the Sr gene present in the main cultivars cultivated in Shandong, Hebei, and Shanxi provinces using molecular markers. The results indicate that 23 of the 45 wheat cultivars contained Sr31, which accounted for 41.8% of the experimental materials. The wheat cultivars containing Sr31 were resistant to 10 races in China at the seedling stage, while exhibiting MR or R responses to two dominant races in China (34MRGQM and 21C3CTHTM) at the adult-plant stage. Our results are consistent with those of numerous previous studies, suggesting that wheat cultivars in most areas of China may contain the Sr31 gene [24]. Further pedigree analysis confirmed that the presence of Sr31 in these cultivars could be derived from Avorara, Lovrin 10, Lovlin 13, and Lumai 14, carrying the linkage gene cluster Sr31-Yr9-Lr26-Pm8.
SrTmp is derived from Triumph, located on the 6DS chromosomes near SrCad and Sr42. This genetic positioning imparts resistance to Ug99. Unlike Sr42, SrTmp is resistant to races QCCJB, RKQSC, QTHJF, and TTKSK, whereas Sr42 is resistant only to races RKQSC and TTKSK [38]. The presence of this gene can be detected in diverse wheat cultivars in certain countries such as Europe, India, United States, Ethiopia, Pakistan [20]. The gene not only demonstrates robust resistance to Ug99 and several Ug99 variants but also indicates excellent resistance to numerous races of Pgt in China. In this study, four wheat cultivars (Jimai 22, Jinan 17, Jimai 19, and Shannong 28) contained SrTmp, accounting for 8.8% of the experimental materials. Pedigree tracing analysis revealed that the presence of SrTmp in these cultivars can originate from Youbaomai, which contained the dwarf resistance gene Rht2, the stem-rust resistance gene SrTmp, as well as leaf-rust resistance genes Lr1 and Lr35. In the field experiment, the lines containing SrTmp exhibited high resistance to the predominant race 34MRGQM in China, with disease severity levels below 30%.
The rust-resistant gene cluster Yr17-Lr37-Sr38, originating from Aegilops obliquus (T. ventricosum) and first transferred to the bread wheat cultivar “VPM1” [39], is located in the 2NS/2AS fragment. The gene cluster Sr38-Yr17-Lr37 has excellent resistance to wheat stem rust, stripe rust, and leaf rust. The restriction fragment length marker cMWG682 can be used to detect the presence of 2NS/2AS fragments in wheat [39]. In this study, Sr38 was detected in 1 of the 45 wheat samples. Although Sr38 has lost its resistance to Ug99, there have been no reports of Pgt races exhibiting virulence toward this gene in China. Consequently, Sr38 has demonstrated excellent resistance to most races in China. In this study, the wheat cultivar containing Sr38 showed low ITs (0–2) in response to the 10 tested races in China at the seedling stage. At the adult plant stage, the two predominant races in China (34MRGQM and 21C3CTHTM) presented resistance to diseases (R). Therefore, to enhance resistance against wheat stem rust in China, it is imperative to incorporate the Ug99-resistant gene into the breeding process.
In this study, Sr genes present in 45 wheat cultivars from Shandong, Shanxi, and Hebei provinces were identified using molecular markers and gene derivation techniques. As a result, seven Sr genes were detected, including Sr5, Sr19, Sr22, Sr30, Sr31, Sr38, and SrTmp, among which Sr5 and Sr31 emerged as the most prevalent genes applied in breeding programs. Although these genes lack resistance to Ug99, they exhibited excellent resistance to most Pgt races in China. Evaluation of the resistance of these cultivars (lines) to races 34MRGQM and 21C3CTHTM at both seedling and adult-plant stages demonstrated robust resistance. Except for Cangmai 119, all other resistant cultivars (lines) showed resistance to races 34MRGQM and 21C3CTHTM at the seedling stage (ITs: 0–2) and exhibited R to MR infection responses at the adult-plant stage, with relatively low severity. Conversely, cultivars showing susceptibility (ITs: 3–4) during the seedling stage also displayed MS to S infection responses during the adult-plant stage. Despite showing low ITs in races 34MRGQM and 21C3CTHTM at the seedling stage, Cangmai 119 exhibited S infection responses at the adult-plant stage. This suggests that Cangmai 119 may contain a temperature-sensitive gene that expresses resistance to low temperatures and is susceptible to high temperatures. In summary, wheat cultivars (lines) from the Henan, Hebei, Shandong, and Shanxi provinces exhibited substantial resistance to the tested races of Pgt. The findings of this study provide valuable resistance source materials and theoretical support for strategically organizing resistance genes regionally as well as for the selection and breeding of resistant cultivars in China.
Supplementary Materials
The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/agriculture14020198/s1, Table S1: Supplemental information on wheat cultivar; Table S2: Weather conditions in Shenyang from 30 May to 30 June 2021 and 2022.
Author Contributions
Performed the experiments, F.G., H.S. and X.N.; prepared figures and tables, Z.W. and S.C.; analyzed the data, F.G., X.W. and Y.W.; writing—review and editing, X.W., F.G., L.Z. and J.Y.; funding acquisition, Q.S.; funding acquisition, supervision, project administration, and approved the final draft, T.L. All authors have read and agreed to the published version of the manuscript.
Funding
This study was supported by the Natural Science Foundation of Education Department of Liaoning Province: LJKZ0641, and LJKZ0648.
Institutional Review Board Statement
Not applicable.
Data Availability Statement
Data are contained within the article.
Acknowledgments
We appreciate very much Hongfei Yan at the College of Plant Protection, Hebei Agricultural University, Technological Innovation Center for Biological Control of Crop Diseases, and Insect Pests of Hebei Province for providing the 45 wheat cultivars.
Conflicts of Interest
The authors declare no conflicts of interest.
References
- Ma, P.T.; Xu, H.X.; Luo, Q.L.; Qie, Y.M.; Zhou, Y.L.; Xu, Y.F.; Han, H.M.; Li, L.H.; An, D.G. Inheritance and genetic mapping of a gene for seedling resistance to powdery mildew in wheat line X39862. Euphytica 2014, 200, 149–157. [Google Scholar] [CrossRef]
- Zhang, Y.; Bai, Y.; Wu, G.; Zou, S.; Chen, Y.; Gao, C.; Tang, D. Simultaneous modification of three homoeologs of TaEDR1 by genome editing enhances powdery mildew resistance in wheat. Plant J. 2017, 91, 714–724. [Google Scholar] [CrossRef]
- Hatta, M.A.M.; Arora, S.; Ghosh, S.; Matny, O.; Smedley, M.A.; Yu, G.; Chakraborty, S.; Bhatt, D.; Xia, X.; Steuernagel, B.; et al. The wheat Sr22, Sr33, Sr35 and Sr45 genes confer resistance against stem rust in barley. Plant Biotechnol. J. 2021, 19, 273–284. [Google Scholar] [CrossRef] [PubMed]
- Cao, Y.Y.; Han, J.D.; Zhu, G.Q.; Zhang, L. Ug99, a new virulent race of Puccinia graminis f. sp. tritici, and its effect on China. Plant Prot. 2007, 33, 86–89. [Google Scholar]
- Jin, Y.; Pretorius, Z.A.; Singh, R.P.; Fetch, T., Jr. Detection of virulence to resistance gene Sr24 within race TTKS of Puccinia graminis f. sp. tritici. Plant Dis. 2008, 92, 923–926. [Google Scholar] [CrossRef] [PubMed]
- Pretorius, Z.A.; Singh, R.P.; Wagoire, W.W.; Payne, T.S. Detection of virulence to wheat stem rust resistance gene Sr31 in P. graminis f. sp. tritici in Uganda. Plant Dis. 2000, 84, 203. [Google Scholar] [PubMed]
- Food and Agricultural Organization of the United Nations (FAO). Spread of Damaging Wheat Rust Continues: New Races Found in Europe, Africa, Central Asia; FAO: Rome, Italy, 2017. [Google Scholar]
- Pretorius, Z.A.; Szabo, L.J.; Boshoff, W.H.P.; Herselman, L.; Visser, B. First report of a new TTKSF race of wheat stem rust (Puccinia graminis f. sp. tritici) in South Africa and Zimbabwe. Plant Dis. 2012, 96, 590. [Google Scholar]
- Rouse, M.N.; Nirmala, J.; Jin, Y.; Chao, S.; Fetch, T.G.J.; Pretorius, Z.A.; Hiebert, C.W. Characterization of Sr9h, a wheat stem rust resistance allele effective to Ug99. Theor. Appl. Genet. 2014, 127, 1681–1688. [Google Scholar] [CrossRef]
- Shamanin, V.P.; Pototskaya, I.V.; Shepelev, S.S.; Pozherukova, V.E.; Salina, E.A.; Skolotneva, E.S.; Hodson, D.; Hovmøller, M.; Patpour, M.; Morgounov, A.I. Stem rust in Western Siberia—Race composition and effective resistance genes. Vavilov J. Genet. Breed. 2020, 24, 131–138. [Google Scholar] [CrossRef]
- Sridhar, B.; David, P.H.; Julio, H.E.; Mandeep, S.R.; Ravi, P.S. Progress in breeding for resistance to Ug99 and other races of the stem rust fungus in CIMMYT wheat germplasm. Front. Agric. Sci. Eng. 2019, 6, 210–224. [Google Scholar]
- Singh, R.P.; Hodson, D.P.; Huerta-Espino, J.; Jin, Y.; Bhavani, S.; Njau, P.; Herrera-Foessel, S.; Singh, P.K.; Singh, S.; Govindan, V. The emergence of Ug99 races of the stem rust fungus is a threat to world wheat production. Annu. Rev. Phytopathol. 2011, 49, 465–481. [Google Scholar] [CrossRef] [PubMed]
- Olivera, P.; Newcomb, M.; Szabo, L.J.; Rouse, M.; Johnson, J.; Gale, S.; Luster, D.G.; Hodson, D.; Cox, J.A.; Burgin, L.; et al. Phenotypic and genotypic characterization of race TKTTF of Puccinia graminis f. sp. tritici that caused a wheat stem rust epidemic in southern Ethiopia in 2013-14. Phytopathology 2015, 105, 917–928. [Google Scholar]
- Firpo, P.D.O.; Newcomb, M.; Flath, K.; Sommerfeldt-Impe, N.; Szabo, L.J.; Carter, M.; Luster, D.G.; Jin, Y. Characterization of Puccinia graminis f. sp. tritici isolates derived from an unusual wheat stem rust outbreak in Germany in 2013. Plant Pathol. 2017, 66, 1258–1266. [Google Scholar]
- Lewis, C.M.; Persoons, A.; Bebber, D.P.; Kigathi, R.N.; Maintz, J.; Findlay, K.; Bueno-Sancho, V.; Corredor-Moreno, P.; Harrington, S.A.; Kangara, N.; et al. Potential for reemergence of wheat stem rust in the United Kingdom. Commun. Biol. 2017, 1, 13. [Google Scholar]
- Patpour, M.; Hovmøller, M.S.; Rodriguez-Algaba, J.; Randazzo, B.; Villegas, D.; Shamanin, V.P.; Berlin, A.; Flath, K.; Czembor, P.; Hanzalova, A.; et al. Wheat stem rust back in Europe: Diversity, prevalence and impact on host resistance. Front. Plant Sci. 2022, 13, 882440. [Google Scholar] [CrossRef] [PubMed]
- Tsushima, A.; Lewis, C.M.; Flath, K.; Kildea, S.; Saunders, D.G.O. Wheat stem rust recorded for the first time in decades in Ireland. Plant Pathol. 2022, 71, 890–900. [Google Scholar] [CrossRef] [PubMed]
- Cao, Y.Y. On Epiphytotic Pattern, Long Dispersion of Puccinia graminis f. sp. tritici and Its Gene Control through Systematic Engineering in China. Master’s Thesis, Shenyang Agricultural University, Shenyang, China, 1994. [Google Scholar]
- Sun, H.; Wang, Z.; Wang, R.; Chen, S.; Ni, X.; Gao, F.; Zhang, Y.; Xu, Y.; Wu, X.; Li, T. Identification of wheat stem rust resistance genes in wheat cultivars from Hebei province, China. Front. Plant Sci. 2023, 14, 1156936. [Google Scholar] [CrossRef] [PubMed]
- Jang, Y.Y.; Chen, W.Q.; Zhao, Z.H.; Zeng, J. Threat of new wheat stem rust race Ug99 to wheat production in China and counter measure. China Plant Prot. 2007, 27, 14–16. [Google Scholar]
- Chen, S.S.; Rouse, M.N.; Zhang, W.J.; Zhang, X.Q.; Guo, Y.; Briggs, J.; Dubcovsky, J. Wheat gene Sr60 encodes a protein with two putative kinase domains that confers resistance to stem rust. New Phytol. 2020, 225, 948–959. [Google Scholar] [CrossRef]
- Mourad, A.M.I.; Sallam, A.; Belamkar, V.; Wegulo, S.; Bai, G.; Mahdy, E.; Bakheit, B.; Abo, E.W.A.; Jin, Y.; Baenziger, P.S. Molecular marker dissection of stem rust resistance in Nebraska bread wheat germplasm. Sci. Rep. 2019, 9, 11694. [Google Scholar] [CrossRef]
- Haile, J.K.; Hammer, K.; Badebo, A.; Nachit, M.N.; Roder, M.S. Genetic diversity assessment of Ethiopian tetraploid wheat landraces and improved durum wheat cultivars using microsatellites and markers linked with stem rust resistance. Genet. Resour. Crop Evol. 2013, 60, 513–527. [Google Scholar] [CrossRef]
- Li, T.Y.; Cao, Y.Y.; Wu, X.X.; Xu, X.F.; Wang, W.L. Seedling resistance to stem rust and molecular marker analysis of resistance genes in wheat cultivars of Yunnan, China. PLoS ONE 2016, 11, e0165640. [Google Scholar] [CrossRef]
- Wu, X.X.; Li, T.Y.; Chen, S.; Wang, G.Q.; Cao, Y.Y.; Ma, S.L.; Li, M.J. Stem rust resistance evaluation and Ug99-resistance gene detection of 139 wheat cultivars. Sci. Agric. Sin. 2014, 47, 4618–4626. [Google Scholar]
- Wu, Y.S.; Huang, Z.T.; Wei, S.X.; Zeng, G.R.; Xue, L.X. An analysis of the physiological races of wheat stem rust in 1963. Acta Polym. Sin. 1963, 4, 294–296. [Google Scholar]
- Yao, P.; Cao, Y.Y.; Liu, W.Z.; Wu, Y.S. Race population trend of Puccinia graminis f. sp. tritici in 1990-1994 in China. Acta Phytophylacica Sin. 1997, 24, 297–302. [Google Scholar]
- Stakman, E.C.; Steward, D.M.; Loegering, W.Q. Identification of physiologic races of Puccinia graminis var. tritici. U.S. Dep. Agric. Agric. Res. Serv. 1962, 3, 33–39. [Google Scholar]
- Dubin, H.J.; Johnson, R.; Stubbs, R.W. Postulated genes for resistance to stripe rust in selected CIMMYT and related wheats. Plant Dis. 1989, 73, 472–475. [Google Scholar] [CrossRef]
- Wu, X.X.; Lin, Q.J.; Ni, X.Y.; Sun, Q.; Chen, R.Z.; Xu, X.F.; Qiu, Y.C.; Li, T.Y. Characterization of wheat monogenic lines with known Sr genes and wheat lines with resistance to the Ug99 race group for resistance to prevalent races of Puccinia graminis f. sp. tritici in China. Plant Dis. 2020, 104, 1939–1943. [Google Scholar] [CrossRef] [PubMed]
- Roelfs, A.P.; Singh, R.P.; Saari, E.E. Rust Diseases of Wheat: Concepts and Methods of Disease Management; CIMMYT: Veracruz, Mexico, 1992. [Google Scholar]
- Zhang, W.; Lukaszewski, A.J.; Kolmer, J.; Soria, M.A.; Goyal, S.; Dubcovsky, J. Molecular characterization of durum and common wheat recombinant lines carrying leaf rust resistance (Lr19) and yellow pigment (Y) genes from Lophopyrum ponticum. Theor. Appl. Genet. 2005, 111, 573–582. [Google Scholar] [CrossRef] [PubMed]
- Han, J.D.; Cao, Y.Y.; Sun, Z.G. 2007-2008 Race dynamics of Puccinia graminis f. sp. tritici in China and the virulence of CIMMYT wheat germplasm resistant to Ug99. J. Triticeae Crops 2010, 30, 163–166. [Google Scholar]
- Wang, X.; McCallum, B.D.; Fetch, T.; Bakkeren, G.; Saville, B.J. Sr36 and Sr5 mediated resistance response to Puccinia graminis f. sp. tritici is associated with callose deposition in wheat guard cells. Phytopathology 2015, 105, 728–737. [Google Scholar]
- Ma, Y. Preliminary molecular detection of straw rust resistance gene Sr22 in some wheat germplasm. Heilongjiang Agric. Sci. 2013, 1, 7–10. [Google Scholar]
- McIntosh, R.A.; Dyck, P.L.; Green, G.J. Inheritance of leaf rust and stem rust resistances in wheat cultivars Agent and Agatha. Aust. J. Agric. Res. 1976, 28, 37–45. [Google Scholar] [CrossRef]
- Wu, X.X.; Zang, C.Q.; Zhang, Y.Z.; Xu, Y.W.; Wang, S.; Li, T.Y.; Gao, L. Characterization of wheat monogenic lines with known Sr genes and wheat cultivars for resistance to three new races of Puccinia graminis f. sp. tritici in China. J. Integr. Agric. 2023, 22, 1740–1749. [Google Scholar] [CrossRef]
- Hiebert, C.W.; Kassa, M.T.; McCartney, C.A.; You, F.M.; Rouse, M.N.; Fobert, P.; Fetch, T.G. Genetics and mapping of seedling resistance to Ug99 stem rust in winter wheat cultivar Triumph 64 and differentiation of SrTmp, SrCad, and Sr42. Theor. Appl. Genet. 2016, 129, 2171–2177. [Google Scholar] [CrossRef]
- Helguera, M.; Khan, I.A.; Kolmer, J.; Lijavetzky, D.; Li, Z.Q.; Dubcovsky, J. PCR assays for the Lr37-Yr17-Sr38 cluster of rust resistance genes and their use to develop isogenic hard red spring wheat lines. Crop Sci. 2003, 43, 1839–1847. [Google Scholar] [CrossRef]
Figure 1.
Detection results for parts of the wheat cultivar with markers SCSS30.2576 and Iag95. (A) SCSS30.2576; (B) Iag95.
Figure 1.
Detection results for parts of the wheat cultivar with markers SCSS30.2576 and Iag95. (A) SCSS30.2576; (B) Iag95.
Table 1.
Genome location, sequence of primer, and conditions for PCR amplification of molecular marker.
Table 1.
Genome location, sequence of primer, and conditions for PCR amplification of molecular marker.
| Gene | Chromosome | Marker | Sequence of Primer (5′→3′) | PCR Amplification Conditions | Size of Markers (bp) | |
|---|---|---|---|---|---|---|
| Temperature (°C)/Time | N. of Cycles | |||||
| Sr24 | 3DL | Sr24#50 | CACCCGTGACATGCTCGTA AACAGGAAATGAGCAACGATGT | 94/3 min | 1 | 500 |
| 94/30 s; 57/30 s; 72/40 s | 30 | |||||
| 20/1 min | 1 | |||||
| Sr25 | 7DL | Gb | CATCCTTGGGGACCTC CCAGCTCGCATACATCCA | 94/3 min | 1 | 191 |
| 94/30 s; 60/30 s; 72/40 s | 30 | |||||
| 20/1 min | 1 | |||||
| Sr26 | 6AL | Sr26#43 | AATCGTCCACATTGGCTTCT CGCAACAAAATCATGCACTA | 94/3 min | 1 | 207 |
| 94/30 s; 56/30 s; 72/40 s | 30 | |||||
| 20/1 min | 1 | |||||
| Sr31 | 1BL | SCSS30.2576 | GTCCGACAATACGAACGATT CCGACAATACGAACGCCTTG | 95/5 min | 1 | 576 |
| 95/1 min; 60/1 min; 72/30 s | 35 | |||||
| 72/10 min | 1 | |||||
| Iag95 | CTCTGTGGATAGTTACTTGATCGA CCTAGAACATGCATGGCTGTTACA | 94/3 min | 1 | 1100 | ||
| 94/30 s; 55/60 s; 72/70 s | 30 | |||||
| 25/60 s | 1 | |||||
| Sr32 | 2AS | csSr32#2 | CAAATGAATAGAAAAACCCGTGCT CACACACTGTTTTCCGTTGC | 94/3 min | 1 | 152 |
| 94/30 s; 60/60 s; 72/70 s | 30 | |||||
| 25/60 s | 1 | |||||
| Sr38 | 2AS | VENTRIUP-LN2 | GGGGCTACTGACCAAGGCT TGCAGCTACAGCAGTATGTACACAAAA | 94/45 s | 1 | 259 |
| 94/45 s; 65/30 s; 72/1 min | 30 | |||||
| 72/7 min | 1 | |||||
Table 2.
Seedling test of 43 wheat lines inoculated with 10 races of P. graminis f. sp. tritici.
| No. | Lines | Infection Types a | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Pgt 1 b | Pgt 2 | Pgt 3 | Pgt 4 | Pgt 5 | Pgt 6 | Pgt 7 | Pgt 8 | Pgt 9 | Pgt 10 | ||
| 1 | ISr5-Ra (Sr5) | 4 | 4 | 3 | 4 | 4 | 3 | 3 | 1 | 1 | 1 |
| 2 | ISr6-Ra (Sr6) | 3 | 3 | 3 | 3 | 3+ | 3 | 3+ | 3 | 3+ | 3 |
| 3 | ISr7b-Ra (Sr7b) | 4 | 3 | 3 | 3+ | 3 | 4 | 4 | 4 | 3 | 4 |
| 4 | ISr8a-Ra (Sr8a) | 4 | 3 | 3 | 4 | 1 | 4 | 3 | 3+ | 3+ | 4 |
| 5 | ISr9a-Ra (Sr9a) | 4 | 4 | 4 | 4 | 4 | 3+ | 4 | 3 | 3 | 4 |
| 6 | W2691Sr9b (Sr9b) | 4 | 4 | 4 | 4 | 4 | 3 | 3 | 3+ | 4 | 3 |
| 7 | ISr9d-Ra (Sr9d) | 4 | 3+ | 3 | 3 | 4 | 4 | 3+ | 4 | 4 | 3 |
| 8 | Vernstine (Sr9e) | 0 | ;1 | 1+ | ; | ; | 1 | 1 | 1− | ; | 1− |
| 9 | CnsSr9f (Sr9f) | 4 | 4 | 3 | 4 | 3 | 4 | 4 | 3+ | 4 | 3 |
| 10 | CnsSr9g (Sr9g) | 4 | 3+ | 3 | 3+ | 4 | 3 | 4 | 3 | 4 | 4 |
| 11 | W2691Sr10 (Sr10) | 2 | 3− | 3− | ; | 1 | 1 + N | 3 | 3 | 3 | 3 |
| 12 | Lee (Sr11) | 4 | 3+ | 1 | 4 | 4 | 0 | 3 | 4 | 4 | 3 |
| 13 | Bt/TcSr12 (Sr12) | 4 | 2 | 3 | 1+ | 3+ | 3 | 3− | 4 | 3− | 3 |
| 14 | W2691Sr13 (Sr13) | 0 | 3− | 3− | 1+ | 1 | 1+ | 3 | 3 | 3− | 3 |
| 15 | W2691Sr15 (Sr15) | 0 | 4 | 3− | ; | 3 | 3 | 3+ | 3+ | 4 | 3 |
| 16 | ISr16-Ra (Sr16) | 4 | 3+ | 3 | 3− | 3+ | 3 | 3 | 3 | 3 | 4 |
| 17 | Prelude/8*Mq/2*/Esp 5/8/9 (Sr17) | 1− | ; | 1 | ; | ; | 0 | ; | 3 | 3 | 4 |
| 18 | LcSr18R1 (Sr18) | 0 | 3− | 3 | 3+ | 3 | 1− | 3+ | 4 | 1+ | 4 |
| 19 | LcSr19Mq (Sr19) | 0 | 2 | 1 | 0 | 1 | 1+ | 3 | 1+ | 0 | 1 |
| 20 | CnS_T_mono_deri (Sr21) | 1 | 1 | 2 | 1 | 1− | 1+ | 1− | 1 | 1− | 2 |
| 21 | SwSr22T.B. (Sr22) | 2 | 2 | 0 | 3+ | 0 | 1+ | 0 | 1 | 3− | 0 |
| 22 | Exchange selection (Sr23) | 1 | 1+ | 4 | 0 | 1 | ; | ; | 1 | 3 | 3 |
| 23 | LcSr24Ag (Sr24) | 3 | 3+ | 3 | 4 | 3− | 3 | 3 | 3 | ;1− | 3C |
| 24 | LcSr25Ars (Sr25) | 0 | 3− | 0 | 3 | 0 | 1 | 4 | 3+ | 0 | 0 |
| 25 | Eagle (Sr26) | 0 | 1+ | 1 | 2 | 1 | 1 | 1+ | 1 | 0 | 1 |
| 26 | 73,214,3-1/9*LMPG (Sr27) | 3 | 1 | 4 | 0 | 1+ | 4 | 3− | 3 | 3+ | 1− |
| 27 | W2691Sr28 (Sr28) | 1 | 3 | 3 | 4 | 3− | 3 | 3+ | 3+ | 3+ | 4 |
| 28 | BtS30Wst (Sr30) | 4 | 1+ | ; | 1 | 1− | 1+ | ; | 3+ | 3 | 1 |
| 29 | Sr31/6*LMPG (Sr31) | 2 | 1− | 1 | ; | ; | 1 | ; | 1 | ; | 1− |
| 30 | CnsSr32 (Sr32) | 1+ | 1 | 3 | 4 | ; | 3− | 3+ | 3 | 1 | 3− |
| 31 | RL5450 (Sr33) | 0 | 2 | 2 | 0 | 1+ | 1+ | 2 | 2 | 2 | 1+ |
| 32 | Compair (Sr34) | 3 | 2 | ; | 4 | 1 | 1+ | 3+ | 3+ | 3− | 3+ |
| 33 | Mq(2)5XG2919 (Sr35) | 3 | 1− | ; | 1+ | ; | 0 | 1− | ; | 3− | 4 |
| 34 | CI12632/8*LMPG (Sr36) | 4 | 0 | 0 | 1 | 0 | 0 | 1 | 4 | 4 | 0 |
| 35 | W2691Sr37 (Sr37) | 0 | 3− | 0 | 1 | ; | 1 | 1+ | 1 | 4 | 1 |
| 36 | Trident (Sr38) | 1 | ;1− | ; | ; | ; | 1 | ; | ; | ; | ; |
| 37 | RL6082 (Sr39) | 3 | 3+ | 3 | 3− | 3 | 3− | 3− | 3 | 3− | 3 |
| 38 | RL6088 (Sr40) | 1 | 1+ | 2 | 0 | 0 | 1+ | 1 | 2 | 1 | 1+ |
| 39 | TAF 2 (Sr44) | 1 | 0 | 2 | 1 | 0 | 1+ | 0 | 2 | 2 | 1+ |
| 40 | Media (Srdp-2) | 4 | 1+ | 1+ | 3 | 0 | − | 1 | 1+ | 3 | 2 |
| 41 | CnsSrTmp (SrTmp) | 3 | 0 | 1 | ; | 1N | 0 | ; | 3N | 1− | 3− |
| 42 | Fed/SrTt3 (SrTt-3) | 2 | 1+ | 2 | 1+ | ; | 2 | 2 | 1+ | 1− | 1 |
| 43 | BTWld (SrWld) | 4 | 2 | 1+ | ; | 1 | − | 1+ | 3 | 3− | 1+ |
| 44 | Little club | 4 | 4 | 4 | 4 | 4 | 3+ | 4 | 4 | 3+ | 4 |
a Infection types were assessed on a 0–4 scale, where high ITs of 3 or 4 were considered resistant, and low ITs of; 0, 1, or 2 were considered susceptible. The symbols + and − indicate slightly larger and smaller pustule sizes, respectively. b Races 1–10 represent the tested races: MTSRR, 34C6MTGSM, 34C3MTGQM, 34C3MKGSM, 34MRGQM, 34MKGQM, 34MTGSM, 21C3CTTTM, 21C3CTTSC, and 21C3CTHTM.
Table 3.
Seedling infection types and absence or presence of Sr genes in 45 wheat cultivars based on molecular markers and gene postulation using 10 races of P. graminis f. sp. tritici.
Table 3.
Seedling infection types and absence or presence of Sr genes in 45 wheat cultivars based on molecular markers and gene postulation using 10 races of P. graminis f. sp. tritici.
| No. | Cultivar | Sr Gene | Infection Types a | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Pgt 1 b | Pgt 2 | Pgt 3 | Pgt 4 | Pgt 5 | Pgt 6 | Pgt 7 | Pgt 8 | Pgt 9 | Pgt 10 | |||
| 1 | Shannong 22 | Sr31 d | 1 | 1 | 0 | 1+ | 1 | 2− | 2 | 1+ | 0 | 1+ |
| 2 | Lunxuan 061 | Sr31 d | 1+ | 1 | 1 | 1+ | 1 | 1+ | 0 | 1+ | 1+ | 1+ |
| 3 | Nongda 5181 | Sr31 d | 2+ | 0 | 0 | 1 | 1 | 2 | 0 | 1+ | 0 | 1+ |
| 4 | Chang 6154 | Sr31 d | 1 | 0 | 0 | 1 | ; | 0 | ; | ; | 0 | − |
| 5 | Chang 4738 | − | 1 | ; | ; | 1 | 1 | 1 | 0 | 2 | 0 | − |
| 6 | Nongda 212 | − | 2 | 1 | 0 | 3 | ; | 1+ | ; | 2 | ; | 1+ |
| 7 | Liaochun 18 | Sr31 d | 1 | ; | 0 | 2 | 1 | 1+ | 0 | 2 | 0 | 0 |
| 8 | Jinuo 200 | Sr31 d | 1 | 0 | 2 | 2− | 1 | 1+ | 0 | 1+ | 0 | 0 |
| 9 | Henong 7106 | Sr31 d | 1− | 0 | 1+ | 1+ | 1 | 0 | 0 | 2 | 0 | 0 |
| 10 | Jimai 518 | Sr31 d | 1 | 1 | 2 | 1 | 1+ | 1+ | 0 | 1+ | 0 | 0 |
| 11 | Jimai 325 | Sr31 d | 2+ | 1 | 2 | 1 | 2− | 1+ | 0 | 1+ | 0 | 1+ |
| 12 | Heng 136 | Sr5 c | 3 | 3 | 3 | 3− | 3 | 4 | 3 | 1+ | 0 | 1+ |
| 13 | Heng 6632 | Sr31 d | 1+ | ; | 1 | 1 | 1 | 1 | 0 | 1+ | 0 | 1 |
| 14 | Cangmai 119 | − | 1 | ; | 1+ | 2 | 1++ | 1+ | 0 | ; | 0 | 1+ |
| 15 | Shannong 19 | Sr31 d | 0 | 1 | 0 | 2 | 1 | 0 | 0 | 0 | 0 | − |
| 16 | Jimai 21 | − | ; | 2 | 0 | 3 | 3− | 3 | 0 | 1− | ; | 1+ |
| 17 | Jimai 22 | SrTmp c | 3 | 1 | 1 | 0 | ; | 1 | 0 | 3 | 0 | 3 |
| 18 | Tanmai 98 | Sr31 d | 1 | 2 | 0 | 2 | 1 | 2 | ; | 1 | 0 | 1+ |
| 19 | Shimai 15 | Sr22 c | 2 | 2+ | 1 | 3 | 1+ | 1+ | 0 | 2 | 3− | 1+ |
| 20 | Henong 826 | Sr5 c | 3 | 4 | 4 | 3+ | 4 | 3+ | 3 | 1+ | 0 | 1+ |
| 21 | H6756 | Sr31 d | 1 | 1− | − | 1+ | 1+ | 0 | 1− | 0 | 0 | 0 |
| 22 | Aikang 58 | Sr31 d | 2+ | ; | 1 | ; | ; | 0 | ; | 0 | 0 | 0 |
| 23 | Jinan 17 | SrTmp c | 3 | 1+ | 1+ | 1 | 1 | 2 | ; | 3− | 0 | 3 |
| 24 | Han 617 | − | 2N | 1 | ; | 2+ | 1+ | 0 | 0 | 1 | 0 | 1− |
| 25 | Gaoyou 9618 | Sr31 d | 1 | 2 | 1 | 2 | 1+ | 2 | 0 | 1− | 0 | ; |
| 26 | Kunpeng 1 | Sr31 d | 1 | 2 | 0 | 2 | 1 | 0 | 0 | 1 | ; | 1 |
| 27 | Lin 4 | Sr31 d | 2+ | 1 | 0 | 0 | 2 | 1 | 1 | 0 | 0 | 0 |
| 28 | Linmai 2 | Sr31 d | 1 | 1 | 1− | 2 | 1 | 1− | 0 | 1− | 0 | 1+ |
| 29 | Nongda 399 | Sr31 d | 2 | 2 | 2− | 2 | + | ; | 0 | 1 | 0 | ; |
| 30 | Lunxuan 103 | − | 1 | 1 | 0 | 1+ | 1 | ; | 0 | ; | 0 | 1 |
| 31 | Kenong 1006 | Sr38 d | ; | 1+ | 0 | 2 | ; | 1 | 0 | ; | 0 | 1 |
| 32 | Jimai 19 | SrTmp c | 3 | 2 | 1 | ; | 1 | 1 | 1 | 3N | 0 | 3 |
| 33 | Han 5316 | Sr19 c | 1 | 1 | ; | 2 | 1 | ; | 3 | ; | 0 | 1+ |
| 34 | Shunmai 1718 | Sr5 c | 4 | 3 | 3 | 3+ | 3+ | 3− | 3− | 1+ | ; | 1+ |
| 35 | Yunhan 618 | Sr5 c | 3+ | 3 | 3 | 4 | 3+ | 3 | 3 | 1+ | 2 | 1 |
| 36 | Jimai 738 strong gluten | − | 1+ | 2 | 0 | 2 | 3− | 3 | ; | 2 | 0 | 1+ |
| 37 | Jishi 02-1 strong gluten | Sr5 c | 3 | 4 | 4 | 3 | 4 | 3 | 3− | 2 | ; | 0 |
| 38 | Yingzao 2018 strong gluten | − | ; | 2− | ; | 2 | ; | ; | ; | 2 | 0 | 1+ |
| 39 | Ke 2009 strong gluten | − | 2 | 2 | 0 | 3+ | 1+ | 1− | 0 | 3 | 0 | 1+ |
| 40 | Shiyou 20 strong gluten | Sr30 d | 4 | 2 | 0 | 2 | 1+ | 1+ | 0 | 3 | 3− | 1+ |
| 41 | Heng S29 | Sr31 d | 2+ | ; | 0 | 0 | ; | ; | 0 | 1 | 0 | 1+ |
| 42 | Kenong 2011 | Sr31 d | 2+ | ; | 2− | 1 | 1+ | 1 | 1+ | 1+ | 0 | 1 |
| 43 | Xingmai 27 | Sr31 d | 1 | 2 | 1 | 1− | 1+ | 1 | 0 | 2 | 0 | 0 |
| 44 | Shannong 28 | SrTmp c | 3 | 1 | 2 | 1 | ; | 1 | 0 | 3 | 0 | 3 |
| 45 | Jimai 120 | Sr31 d | 1 | 2 | 0 | 1− | 1+ | 1 | 0 | 1+ | ; | 1 |
| 46 | Little club | − | 4 | 4 | 4 | 4 | 4 | 3+ | 4 | 4 | 3+ | 4 |
a Infection types were assessed on a 0–4 scale, where high ITs of 3 or 4 were considered resistant, and low ITs of ;, 0, 1, or 2 were considered susceptible. The symbols +, −, and ++ indicate slightly larger and smaller pustule sizes, respectively. b Pgt 1–10 represent the tested races: MTSRR, 34C6MTGSM, 34C3MTGQM, 34C3MKGSM, 34MRGQM, 34MKGQM, 34MTGSM, 21C3CTTTM, 21C3CTTSC, and 21C3CTHTM. c Sr genes derived through gene postulation. d Sr genes confirmed through molecular marker detection.
Table 4.
Pedigree of tested cultivars, and stem rust infection response (IRs) a at the adult-plant stage during 2021 and 2022.
Table 4.
Pedigree of tested cultivars, and stem rust infection response (IRs) a at the adult-plant stage during 2021 and 2022.
| No. | Cultivar | Pedigree | 34MRGQM | 21C3CTHTM | ||
|---|---|---|---|---|---|---|
| 2021 | 2022 | 2021 | 2022 | |||
| 1 | Shannong 22 | Ta1 (Ms2) wheat recurrent selection population | 5 R | 5 R | 0 R | 5 R |
| 2 | Lunxuan 061 | Recurrent quality populations of dwarf male-sterile wheat | 0 R | 5 R | 0 R | 0 R |
| 3 | Nongda 5181 | Nongda 3097/Lunxuan 987 | 0 R | 5 R | 0 R | 0 R |
| 4 | Chang 6154 | Jinmai 63/Yun 8337-17-5-2-1 | 5 R | 5 R | 0 R | 10 R |
| 5 | Chang 4738 | 82230-6/94-5383 | 0 R | 0 R | 0 R | 0 R |
| 6 | Nongda 212 | Nongda 3338/S180 | 0 R | 5 R | 10 R | 10 R |
| 7 | Liaochun 18 | Liaochun 10 mutants | 5 R | 5 R | 0 R | 0 R |
| 8 | Jinuo 200 | 03 Nuo F3-1186/Lankao 906 | 30 R | 5 R | 0 R | 0 R |
| 9 | Henong 7106 | Henong 9923/Henong 4631 | 5 R | 5 R | 0 R | 0 R |
| 10 | Jimai 518 | Taigu Male-sterile populations | 20 R | 10 R | 5 R | 0 R |
| 11 | Jimai 325 | Ji 5157/Shi 02-7221 | 20 R | 5 R | 20 R | 5 R |
| 12 | Heng 136 | Heng 4119/Shijiazhuang 1 | 40 MS | 50 S | 5 R | 0 R |
| 13 | Heng 6632 | Black wheat/Heng 8116 | 5 R | 10 R | 0 R | 0 R |
| 14 | Cangmai 119 | 8341699/CA8694 | 90 S | 80 S | 90 S | 90 S |
| 15 | Shannong 19 | (83(3)-113/1604) F3//886059 | 30 R | 5 R | 30 R | 5 R |
| 16 | Jimai 21 | 865186/Chuannongda 84-1109//Ji 84-5481 | 30 MS | 40 MS | 10 R | 30 R |
| 17 | Jimai 22 | 935024/935106 | 5 R | 5 R | 20 MS | 60 S |
| 18 | Tanmai 98 | Jining 13/942 | 5 R | 5 R | 0 R | 0 R |
| 19 | Shimai 15 | (GS Jimai 38/92R137)/GS Jimai 38 | 30 R | 5 R | 30 R | 20 R |
| 20 | Henong 826 | Shi 6365/95 Guan 26 | 60 S | 50 MS | 10 R | 5 R |
| 21 | H6756 | Laizhou 953/9024-85/Ji 87-5108 | 0 R | 5 R | 0 R | 5 R |
| 22 | Aikang 58 | Zhoumai 11//Wenmai 6/Zhengzhou 8960 | 40 R | 0 R | 0 R | 10 MR |
| 23 | Jinan 17 | Linfen 5064/Lumai 13 | 20 R | 5 R | 80 S | 60 S |
| 24 | Han 6172 | Han 4032/Zhongyin 1 | 10 R | 20 R | 5 R | 10 R |
| 25 | Gaoyou 9618 | 8515-4/8901-11-14 | 50 R | 40 R | 10 R | 20 MR |
| 26 | Kunpeng 1 | 9411 (8901/Annong 8455)/9502 (8903/Xiaobing 33) | 60 R | 50 R | 50 R | 60 R |
| 27 | Lin 4 | Lumai 23/Lin 9015 | 5 R | 5 R | 0 R | 0 R |
| 28 | Linmai 2 | Lumai 23/Lin 90-15 | 0 R | 0 R | 0 R | 0 R |
| 29 | Nongda 399 | Torino/Henong 2552/Nongda 9516//Shi 4185 | 30 MR | 20 MR | 0 R | 5 R |
| 30 | Lunxuan 103 | Shimai 12/Shijiazhuang 8 | 5 R | 5 R | 10 R | 5 R |
| 31 | Kenong 1006 | Kn 9204//Kn 9204/Gaomai 5///9204R | 0 R | 0 R | 0 R | 0 R |
| 32 | Jimai 19 | Lumai 13/Linfen5064 | 0 R | 0 R | 20 MS | 40 MS |
| 33 | Han 5316 | (Han 7808/CA8059) F4//85 Zhong47 | 20 R | 5 R | 5 R | 5 R |
| 34 | Shunmai 1718 | 32S/Gabo | 30 MS | 30 MS | 20 R | 10 R |
| 35 | Yunhan 618 | Yunhan 92-18/Xinchun 9 | 40 MS | 40 MS | 10 R | 10 R |
| 36 | Jimai 738 strong gluten | Gao 9618/Liangxing 99 | 100 S | 90 S | 10 R | 5 R |
| 37 | Jishi 02-1 strong gluten | - | 80 MS | 50 MS | 20 R | 30 R |
| 38 | Yingzao 2018 strong gluten | - | 30 R | 20 R | 20 R | 5 R |
| 39 | Ke 2009 strong gluten | - | 20 R | 5 R | 10 R | 10 R |
| 40 | Shiyou 20 strong gluten | Ji 935-352/Jinan 17 | 10 R | 5 R | 5 R | 5 R |
| 41 | Heng S29 | Heng 98-5229 systematic breeding | 5 R | 5 R | 10 R | 5 R |
| 42 | Kenong 2011 | Kn 9204/Pubing material PZW-9 | 30 R | 20 R | 10 R | 10 R |
| 43 | Xingmai 27 | - | 10 R | 10 R | 10 R | 5 R |
| 44 | Shannong 28 | Jimai 22/6125 | 5 R | 5 R | 10 MS | 20 MS |
| 45 | Jimai 120 | ISENGRAIN/Shi 20-6091 | 60 R | 50 R | 20 R | 40 R |
| 46 | Little club | - | 90 S | 80 S | 90 S | 90 S |
a IRs, in combination with severity, were scored at the adult-plant stage in the field tests, following the descriptions of Roelfs et al. [31], where R is resistant, MR is moderately resistant, MS is moderately susceptible, and S is susceptible.
Table 5.
Susceptibility and resistance proportion of 45 wheat cultivars to 2 races, 34MRGQM and 21C3CTHTM, at adult-plant stage during 2021 and 2022.
Table 5.
Susceptibility and resistance proportion of 45 wheat cultivars to 2 races, 34MRGQM and 21C3CTHTM, at adult-plant stage during 2021 and 2022.
| Races | Immune | Resistance—Moderately Resistant | Moderately Susceptible—Susceptible | |||
|---|---|---|---|---|---|---|
| 2021 | 2022 | 2021 | 2022 | 2021 | 2022 | |
| 34MRGQM | 8 (17.8) a | 5 (11.1) | 29 (64.4) | 32 (71.1) | 8 (17.8) | 8 (17.8) |
| 21C3CTHTM | 16 (35.6) | 13 (28.9) | 23 (51.1) | 26 (57.8) | 6 (13.3) | 6 (13.3) |
| All races | 5 (7.7) | 3 (4.6) | 28 (43.1) | 30 (66.7) | 12 (18.5) | 12 (18.5) |
a 8 (17.8): The number outside parentheses represents the number of cultivars, and the number inside parentheses represents the percentage of that number.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
MDPI and ACS Style
Gao, F.; Wu, X.; Sun, H.; Wang, Z.; Chen, S.; Zou, L.; Yang, J.; Wei, Y.; Ni, X.; Sun, Q.; et al. Identification of Stem Rust Resistance Genes in Triticum Wheat Cultivars and Evaluation of Their Resistance to Puccinia graminis f. sp. tritici. Agriculture 2024, 14, 198. https://doi.org/10.3390/agriculture14020198
AMA Style
Gao F, Wu X, Sun H, Wang Z, Chen S, Zou L, Yang J, Wei Y, Ni X, Sun Q, et al. Identification of Stem Rust Resistance Genes in Triticum Wheat Cultivars and Evaluation of Their Resistance to Puccinia graminis f. sp. tritici. Agriculture. 2024; 14(2):198. https://doi.org/10.3390/agriculture14020198
Chicago/Turabian StyleGao, Fu, Xianxin Wu, Huiyan Sun, Ziye Wang, Si Chen, Longmei Zou, Jinjing Yang, Yifan Wei, Xinyu Ni, Qian Sun, and et al. 2024. "Identification of Stem Rust Resistance Genes in Triticum Wheat Cultivars and Evaluation of Their Resistance to Puccinia graminis f. sp. tritici" Agriculture 14, no. 2: 198. https://doi.org/10.3390/agriculture14020198
Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.
