Next Article in Journal
Mango Postharvest Technologies: An Observational Study of the Yieldwise Initiative in Kenya
Next Article in Special Issue
Breeding Capsicum chinense Lines with High Levels of Capsaicinoids and Capsinoids in the Fruit
Previous Article in Journal
Prospects of Developing Novel Genetic Resources by Chemical and Physical Mutagenesis to Enlarge the Genetic Window in Bread Wheat Varieties
Previous Article in Special Issue
Breeding for Nutritional and Organoleptic Quality in Vegetable Crops: The Case of Tomato and Cauliflower
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Using Simple Sequence Repeats in 9 Brassica Complex Species to Assess Hypertrophic Curd Induction

by
Simone Treccarichi
1,*,
Cornelia Di Gaetano
2,
Fulvio Di Stefano
3,
Mauro Gasparini
3 and
Ferdinando Branca
1
1
Food and Environment (Di3A), Department of Agriculture, University of Catania, 95131 Catania, Italy
2
Department of Medical Science, University of Turin, 10126 Turin, Italy
3
Department of Mathematical Science, Politecnico di Torino, 10126 Turin, Italy
*
Author to whom correspondence should be addressed.
Agriculture 2021, 11(7), 622; https://doi.org/10.3390/agriculture11070622
Submission received: 31 March 2021 / Revised: 23 June 2021 / Accepted: 28 June 2021 / Published: 1 July 2021
(This article belongs to the Special Issue Breeding and Genetics of Horticultural Crops)

Abstract

Five Simple Sequence Repeats (SSRs) were used to assess the relationship between inflorescence characteristics and their allelic variation in 53 Brassica oleracea and Brassica wild relatives (n = 9). Curd morphometric traits, such as weight (CW), height (CH), diameter (CD1), shape (CS) inflorescence curvature angle (CA), and its curd stem diameter (CD2), were measured. The aim of the work was to analyze the relationships among the allelic patterns of the SSRs primers utilized, and their status of homo or heterozygosity registered at each locus, as well as the inflorescence morphometric traits in order to individuate genomic regions stimulating the hypertrophy of this reproductive organ. The relationships found explain the diversity among B. oleracea complex species (n = 9) for the inflorescence size and structure, allowing important time reduction during the breeding process by crossing wild species, transferring useful resistance, and organoleptic and nutraceutical traits. The five SSRs loci were BoABI1, BoAP1, BoPLD1, BoTHL1, and PBCGSSRBo39. According to the allelic variation ascertained, we evaluated the heterozygosity index (H) for each SSR above cited. The results showed a significant interaction between the H index of the BoPLD1 gene and the inflorescence characteristics, summarized by the First Principal Component (PC1) (p-value = 0.0244); we ascertained a negative correlation between the H index and inflorescence characteristics, namely CW, CH, CD1, CD2, CA. The homozygosity BoPLD1 alelles, indicated by the H index, affect the inflorescence characteristics and broccoli and cauliflower yields.

1. Introduction

Brassica crops include several interesting species which are strictly related to crop wild relatives (CWRs) during their domestication process [1]. The Mediterranean region represents one of the main domestication and diversification centers of Brassica genus, in particular in Sicily where the cytodeme is represented by several wild relatives such as Brassica macrocarpa Guss., B. villosa Biv., B. rupestris, and B. incana [2].
The brassica genus includes three diploids (2n) (AA, BB, CC) and three tetraploids (4n) (AABB, AACC, BBCC) main species as described in the U’s triangle model [3]. The B. oleracea complex species (n = 9) belongs to genome C (n = 9) and it represents the primary gene pool of the Brassica genus. This genus shows high genetic variability due to the genetic self-incompatibility characterizing the landraces and their CWRs and to several domestication processes [4]. Genetic diversity of B. oleracea is shown by the several varieties obtained by different domestication processes in a number of geographic areas which include broccoli, cauliflower, cabbage, kale, kohlrabi, savoy cabbage, and Brussel sprouts.
Brassica wild relatives could be a source of cytoplasmic male sterility (androsterility) for the development of hybrid seed of Brassica crops and they can provide genes for resistance to different diseases and pests and for these traits they can be used in breeding programs [5].
Cauliflower and broccoli are characterized by the floral induction of hypertrophic inflorescence [6]. Broccoli crop, as reported by Viani, originated from wild cabbage while cauliflower head derived from the improving process of broccoli addressed to the reduction of branches length, flower bud size, and the absence of their pigmentation.
Flower development genes were studied by Bowman et al. who found several genes involved such as apetala 1 and cauliflower in Arabidopsis [7]. These genes are closely related to members of the MADH-box genes family and a mutant copy of them is present in B. oleracea genome. Irish and Sussex characterized several floral phenotypes produced by the recessive homeotic apetala 1 (ap1) mutation in Arabidopsis and the homozygote for this mutation showed weak inflorescence affecting floral primordia formation [8].
Smith and King proposed a simple genetic model based on segregation of recessive alleles for BoAP1 and BoCAL candidate genes which showed differences in stage of arrest between cauliflower and Calabrese broccoli [9]. According to Smith and King’s allelic distribution genetic model, the domestication process reduced the allelic diversity by promoting loci affecting the arrest of floral development which determined the inflorescence hypertrophy and then the domestication for cauliflower’s curd phenotype; the Sicilian Purple was indicated as an important intermediate of this domestication process [10].
BoABI1, BoAP1, BoPLD1, and BoTHL1were designed to amplify genomic DNA region by Tonguc and Griffiths [11]. They were used to assess genetic similarity between several B. oleracea cultivars, belonging to three varietal groups (cabbage, cauliflower, and broccoli) while PBCGSSRBo39 was designed by Burgess et al. [12] to provide a useful molecular marker for crop improvement which was derived from shotgun sequencing programs.
Simple sequence repeats markers can be a useful tool to find genetic relationships among genotypes and related species provided from different countries. They can be used also as chloroplastic SSRs (cpSSRs) to avoid multiple gene copy number problems in polyploidy species [13].
In this study, the inflorescence morphometric traits of several accessions of broccoli and cauliflower landraces and commercial varieties, and Brassica relatives were measured [14], and additionally the five SSRs above cited were utilized to analyze the allelic variation among the accessions used and to associate them with inflorescence characteristics.

2. Materials and Methods

Plant material was represented by fifty-three accessions belonging to the Department of Agriculture, Food and Environment (Di3A) of the University of Catania-UNICT (Table 1). Seeds were sown in the first week of July in cellular trays placed under greenhouse conditions. The seedlings were transplanted after 5 weeks on the experimental farm of the University of Catania, (37°27′ N, 15°40′ E, 10 m a.s.l.) in single rows, with 1.0 m between the rows and 0.5 m between the plants along the rows, at crop density of 2 plants/m2. The experimental design was composed of four replicates (10 plants each) placed in randomized blocks as described by Branca et al. [15]; plants were grown in open fields.
For the accessions, inflorescence morphological data were registered following the International Board for Plant Genetic Resources (IBPGR) [16] descriptors related to the curd. Inflorescence morpho-biometric traits such as weight (CW), height (CH), diameter (CD1), shape (CS), angle of curvature (CA), and inflorescence stem thickness (CD2) were measured and calculated at the laboratory of Biotechnology of Vegetable and Flower Crops of the Di3A UNICT department. The inflorescence before anthesis was cut five centimeters before the first branch of inflorescence and for it the CW was registered by analytical balance, the CH and CD1 were calculated using a meter rule while CD2 was calculated using a caliber. The inflorescence shape (CS) parameter can be used to distinguish broccoli and cauliflowers from the CWRs and is derived from the ratio between CH and CD1. Curvature angle CA was registered with a goniometer by calculating the angle limited to between the central vertical inflorescence axes and the tangent to the extreme part of it.
For morphological data, the mean values of the analyzed parameters of every accession were used to prepare a numerical matrix.
Genomic DNA was extracted from seedlings upon reaching the 6–8 leaved stage in young leaves tissues as reported by Tonguç and Griffiths utilizing the kit GenEluteTM Plant Genomic DNA Miniprep (Sigma Aldrich Inc.).
Extracted DNA was measured using a spectrophotometer Shimadzu at wavelengths of 260 and 280 nm, quantified by visual comparison on ethidium bromide-stained agarose gels. The final DNA concentration followed the protocol established by Branca et al. (2018) which includes 200 ng of template DNA.
The primers flanking SSR sequences (Table 2) were obtained in accordance with Tonguc and Griffiths (2004) for BoTHL1, BoAP1, BoPLD1, and BoABI1; concerning the PBCGSSRBO39 primers sequence, this was retrieved by Burgess et al. The position of the primers was checked using Assembly: GCA_0006955251.1 within Ensembl.
Five SSRs primers used were chosen following Branca et al., selecting them from ten primers, performed by Branca et al. for phylogenetic analysis and to assess the genetic similarity between several B. oleracea cultivars and wild Brassica species, belonging to two varietal groups (cauliflower and broccoli) as well as to estimate genetic divergence using FST statistic; broccoli cultivars clustered with cauliflower cultivars as predicted and wild species showed major genetic differences [13].
The basic local alignment search tool (BLAST) was performed to check amplicon size and to compare results with amplificated sequences registered in an online database which was represented by BLAST (version 1.17) and Ensembl. The Uniprot database (release 2021, version 3) was used to study encoding regions close to the gene of interest.
The SSRs studied are located in different regions of the plant genome: BoABI1 is located in chromosome 1 region: 1,229,915,511-12,992,170 within the gene Bo1g041870 coding the ABI1 protein. The second SSR BoTHL1 is located on chromosome: 17,254,558: 17,255,176 within the Bo9g058820 gene, a homolog of thioredoxin 3 in Arabidopsis thaliana. The microsatellite PBCGSSRBo39 is located inside the Bo7g105720 gene on chromosome 7, BoAP1 is located inside chromosome 6: 33,883,667-33,887,357 inside the Bo6g108600 gene, one of MADS-box gene family members (Ap1Like).
BoPLD1 marker is located in the fifth chromosome in B. oleracea from 46,037,340 bp to 46,037,606 bp.
After DNA purification, PCR-based amplification was performed in 20 μL of final volume. The reaction mixture was composed of 200 ng of DNA template, 200 µM of each dNTP 3.75 mM MgCl2, 1X Taq DNA polymerase buffer, and 2 mM Primer according to Branca et al. (2018). DNA amplification was conducted in a Perkin Elmer 9700 thermocycler (ABI, Foster City, CA, USA) with the following parameters: initial denaturation at 94 °C for 5 min, followed by 35 cycles of denaturation at 94 °C for 30 s, primer annealing at 50 °C for 1 min, and extension at 72 °C for 1 min, with a final extension at 72 °C for 7 min. At the end of reaction, amplicons were stored at 4 °C. PCR products were loaded into 4% agarose gels (UNILAB Life Science, Taipei, Taiwan) and the electrophoresis run at a voltage of 100 V for 5–6 h in 1 X TBE buffer [15]. Capillary electrophoresis was performed using ABI PRISM 3130 Genetic 191 Analyser (Applied Biosystems, Waltham, MA, USA) as described by Branca et al. (2013) and Branca et al. Fragment sizes were determined by the GeneMapper 3.7 software (Applied Biosystems, Waltham, MA, USA). The allele peaks were checked by performing capillary electrophoresis and also checked using GeneMapper software. Each allele peak was manually rechecked by the operator.

3. Data Analysis

Allelic detection occurred in coding allelic status on the basis of their molecular weights using numeric scores: 2 (homozygosity), 1 (heterozygosity), and 0 (absence of any allele).
Allelic frequency data were elaborated to calculate heterozygosity index (H) which indicates the frequencies of heterozygosity in a population; an H value close to 1 suggests a large degree of heterozygosity within the populations while an H value close to 0 suggests homozygosity. Statistical analysis was performed to evaluate the correlation between the heterozygosity index for each locus and the inflorescence morpho-biometric traits as CW, CD1, CD2, and PC1.
For statistical analysis, the main inflorescence morpho-biometric characteristics, with exception of CS were used to calculate the Principal Component Analysis (PCA) to obtain a single parameter to summarize the inflorescence characteristics. CS was discarded due to the origin of this parameter which is derived from CH and CD1. PCA was performed using RStudio software 3.6.3 and a linear regression model was used to obtain information about the relationships between the heterozygosity index of each locus and the inflorescence bio-morphometric traits. PCA data were scaled to have unit values.

4. Results

Inflorescence morphometric traits CW, CH, CD1, CD2, and angle of curvature CA were registered for the Di3A accessions establishing a morphological database (Table 3).
The inflorescence morphometric variance was detected using data on plant bio-morphometric parameters recorded on Sicilian broccoli and cauliflower landraces and their F1 hybrids which show a large diversity among the genotypes.
The curd weight showed higher values for cauliflower landraces and F1 hybrids, than the CWRs analyzed, which registered lower values. Among cauliflower accessions, CV 171 Menhir F1 recorded the highest value (10,958 g); landrace curds weighed less than those collected from F1 hybrids and that explain the worldwide diffusion of these genotypes due to their yield. Curd diameter (CD1) was related to CW and, as registered, showed lower values in CWRs accessions while cultivated accessions with higher CD1 values, such as CV 99 S2 B recorded the largest curd diameter, respectively 21.1 cm (Table 3).
Broccoli types showed an elongated inflorescence as shown by CS values while cauliflowers showed more compact and flattened curd such as compared to the CWRs. Broccoli landraces showed the highest CS values compared to commercial cultivars.
The curvature angle (CA) also showed the large phenotypical variability among broccoli and cauliflowers landraces and hybrids F1, and their CWRs. CA distinguish well cauliflowers from broccoli and CWRs; cauliflowers were characterized by the highest CA value. Broccoli accessions showed lower CA values than cauliflowers. CWRs were characterized by the absence of the hypertrophic inflorescence developed from the apical meristem and they showed the lowest CA values; B. macrocarpa accession Favignana 1 showed the lowest CA value (7°).
Phenotypical variability was explained using a correlation model for each bio-morphometric descriptor; PC1 showed 46.75% of the total variance among the accessions (Table 4) and it is significantly correlated to CW, CD1, CD2 and CA. PC2 overlaps with CH which is one of the major traits affecting inflorescence morphology and therefore it was not used for this analysis.
Morphometric traits were subsequently elaborated and correlated to the genetic data by statistical analysis.
Each SSR locus exhibited a different number of alleles among the accessions studied: BoTHL1 showed eight alleles, PBCGSSRBo39 eleven alleles, BoPLD1 six alleles, BoAP1 showed twelve alleles, and BoABI1 nine alleles. Allelic data were processed to measure genetic diversity for each locus within the different Brassica accessions examined and to calculate the H index (Table 5).
The correlation between CW and the five locus H index did not show significant p-value, although the BoPLD1 one was weakly significant (smaller than 0.10). On the other hand, significant correlations were observed among BoPLD1 H index and CD1, CD2, and PC1 (Table 5). The negative sign of the estimate coefficient confirms the association between the heterozygosity index and BoPLD1; when the H index increases the size of the inflorescence and the thickness of the stem decrease. The analysis also showed no significant correlation between the H index of the other loci (BoAP1, BoTHL1, BoAB1, PBCGSSRBo39) and inflorescence characteristics.

5. Discussion

The Di3A core collection describes the evolution of the domestication process from the Brassica wild species (n = 9) to the broccoli and cauliflower crops by comparing the main morphometric traits of the inflorescence and the allele diversity of the molecular primers utilized during human selection.
The domestication process is explained by the use of five SSR primers which show a wide range of alleles among the growing and wild species belonging to the B. oleracea complex species (n = 9). Some alleles, useful for increasing the inflorescence size, were unconsciously subject of selection by the growers in order to fix the hypertrophic inflorescence of broccoli and cauliflower. In addition, the broccoli and cauliflower domestication processes have been affected by the genetic flux among the Brassica wild relatives (n = 9), and the first domesticated sprouting broccoli was permitted to enlarge the inflorescence size gradually and define its shape of the hybrids F1 of broccoli and cauliflower [17]. In Branca et al. Fst was calculated in order to measure the genetic distance among accessions; the genetic diversity shown by the five SSRs primers utilized in relation to the B. oleracea complex species (n = 9) accessions, permitted us to classify them in relation to their domestication process (CWRs, landraces of cauliflowers and broccoli and their hybrids F1. MADS–box genes family includes several transcriptional factors involved in the growth and development of the inflorescence after its reproductive induction, flowering time, fruit development, and ripening [18]. During the last decades, several genomic studies were reported to explain the role played by some homeotic genes involved in the development of the hypertropic inflorescence, called head for broccoli and curd for cauliflower. Several genes such as apetala 1 (AP1) were reported to be involved in the inflorescence structure controlling its meristematic development. The transcript of AP1 gene (RefSeq ID: XP_013590290.1) was described by Sheng et al., 2019 as showing high levels of expression in different tissues and in particular in the curd and the flower [19]. These genes are related to the development of the reproductive organs and they belong to the MADH-box genes family [20]. BoCal is one of the related genes involved in curd formation; the mutant alleles seem to stop flower development and a simple genetic model has been proposed [9].
BoPLD1 marker is located in the fifth chromosome of B. oleracea from 46,037,340 bp to 46,037,606 bp in an untranscribed region (accession: LR031877), near the region encoding Phospolipase D (UniProtKB-A0A3P6FGA7). This catalytic enzyme is encoded from BOLC5T33808H gene and is involved in glycerolphospholipids hydrolysis at the terminal phosphodiesteric bond.
Taking into consideration the stem diameter (CD2) and the diameter of the inflorescence (CD1), the correlation between their values and the H index is significant only for the BoPLD1 locus while it is weakly significant with respect to the weight of the inflorescence (Table 5). The analysis of the negative correlation coefficient between these two inflorescence morphometric traits (CD1 and CD2) permits us to deduce that the more the H index associated with BoPLD1 increases, and the related locus tends to show higher heterozygosity, the more such a parameter affects the inflorescence size. This could be correlated with the observation that in the CWRs there is greater heterozygosity than in the hybrids F1 but the size of the inflorescence, its stem, and its weight decrease for the former. The sequence hosting the microsatellite placed in the initial portion of the gene Bo5g126670, just before the first exon, could not exclude the presence of a repeat affecting the transcription of the gene itself.
The data acquired consent to delineate the next steps of this study sequencing the polymorphisms present in the upstream region of the Bo5g126670 gene that could be involved in the inflorescence hypertrophy of the B. oleracea complex species (n = 9). These variations could be used for marker-assisted selection (MAS) and for individuating in advance, during the breeding program utilized CWRs—the individuals who express hypertrophic inflorescence are an object of interest for further field evaluation.

6. Conclusions

BoPLD1 marker heterozygosity (H index) shows significant interaction with several inflorescence morpho-biometric characteristics and when BoPLD1 alleles tend to homozygosity an increase of inflorescence and curd size are observed. These results permit us to continue to investigate by sequencing these primers to individuate the SNPs useful for distinguishing the broccoli types with hypertrophic inflorescence during the organic breeding programs. The crossing plans among the broccoli breeding lines and the Brassica wild relatives, aiming to transfer forgotten alleles during the domestication process, will be useful for increasing the resistance against biotic and abiotic stresses, and for nutritional, organoleptic and nutraceutical traits. The molecular marker will reduce the cost of evaluation field transplanting with only the selected individuals expressing the broccoli inflorescence phenotype, reducing the number of individuals to grow and to analyze.

Author Contributions

Conceptualization, S.T. and F.B.; methodology, F.B., C.D.G., M.G.; formal analysis, F.D.S.; investigation, S.T.; resources, F.B.; data curation, S.T.; writing—original draft preparation, F.B., C.D.G., S.T.; writing—review and editing, F.B., M.G.; funding acquisition, F.B. All authors have read and agreed to the published version of the manuscript.

Funding

This research was supported by the project BRESOV (Breeding for Resilient, Efficient and Sustainable Organic Vegetable production) funded by EU H2020 Programme SFS-07-2017. Grant Agreement n. 774244.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Snogerup, S.; Gustafsson, M.; Von Bothmer, R. Brassica sect. Brassica (Brassicaceae) I. Taxonomy and Variation. Willdenowia 1990, 19, 271–365. [Google Scholar]
  2. Gustafsson, M.; Lannér, C. Overview of the Brassica oleracea complex: Their distribution and ecological specificities. Bocconea 1997, 1, 7. [Google Scholar]
  3. Nagaharu, U. Genome Analysis in Brassica with Special Reference to the Experimental Formation of B. Napus and Peculiar Mode of Fertilization. Jpn. J. Bot. 1935, 7, 389–452. [Google Scholar]
  4. Branca, F.; Maggioni, L. Exploiting Sicilian Brassica oleracea L. complex species for the innovation of the agricultural systems and products: A review analysis. Acta Hortic. 2020, 1267, 187–196. [Google Scholar] [CrossRef] [Scilit]
  5. Rakow, G. Species Origin and Economic Importance of Brassica. In Brassica; Biotechnology in Agriculture and Forestry; Pua, E.-C., Douglas, C.J., Eds.; Springer: Berlin/Heidelberg, Germany, 2004; pp. 3–11. [Google Scholar] [CrossRef] [Scilit]
  6. Maggioni, L.; Von Bothmer, R.; Poulsen, G.; Branca, F. Origin and Domestication of Cole Crops (Brassica oleracea L.): Linguistic and Literary Considerations 1. Econ. Bot. 2010, 64, 109–123. [Google Scholar] [CrossRef] [Scilit]
  7. Bowman, J.; Alvarez, J.; Weigel, D.; Meyerowitz, E.M.; Smyth, D. Control of flower development in Arabidopsis thaliana by APETALA1 and interacting genes. Development 1991, 119, 721–743. [Google Scholar] [CrossRef] [Scilit]
  8. Irish, V.F.; Sussex, I.M. Function of the apetala-1 gene during Arabidopsis floral development. Plant Cell 1990, 2, 741–753. [Google Scholar] [PubMed]
  9. Smith, L.B.; King, G.J. The distribution of BoCAL-a alleles in Brassica oleracea is consistent with a genetic model for curd development and domestication of the cauliflower. Mol. Breed. 2000, 6, 603–613. [Google Scholar] [CrossRef] [Scilit]
  10. King, G.J. Using molecular allelic variation to understand domestication process and conserve diversity in Brassica crops. Acta Hortic. 2003, 598, 181–186. [Google Scholar] [CrossRef] [Scilit]
  11. Tonguç, M.; Griffiths, P.D. Genetic relationships of Brassica vegetables determined using database derived simple sequence repeats. Euphytica 2004, 137, 193–201. [Google Scholar] [CrossRef] [Scilit]
  12. Burgess, B.; Mountford, H.; Hopkins, C.J.; Love, C.; Ling, A.E.; Spangenberg, G.C.; Edwards, D.; Batley, J. Identification and characterization of simple sequence repeat (SSR) markers derived in silico from Brassica oleracea genome shotgun sequences: PRIMER NOTE. Mol. Ecol. Notes 2006, 6, 1191–1194. [Google Scholar] [CrossRef] [Scilit]
  13. Las Casas, G.; Distefano, G.; Caruso, M.; Nicolosi, E.; Gentile, A.; La Malfa, S. Relationships among cultivated Opuntia ficus-indica genotypes and related species assessed by cytoplasmic markers. Genet. Resour. Crop Evol. 2018, 65, 759–7873. [Google Scholar] [CrossRef] [Scilit]
  14. Branca, F.; Ragusa, L.; Tribulato, A.; Di Gaetano, C.; Calì, F. Genetic relationships of Brassica vegetables and wild relatives in Southern Italy determined by five SSR. Acta Hortic. 2013, 1005, 189–196. [Google Scholar] [CrossRef] [Scilit]
  15. Branca, F.; Chiarenza, G.L.; Cavallaro, C.; Gu, H.; Zhao, Z.; Tribulato, A. Diversity of Sicilian broccoli (Brassica oleracea var. italica) and cauliflower (Brassica oleracea var. botrytis) landraces and their distinctive bio-morphological, antioxidant, and genetic traits. Genet. Resour. Crop Evol. 2018, 65, 485–502. [Google Scholar] [CrossRef] [Scilit]
  16. Descriptors for Brassica and Raphanus; International Board for Plant Genetic Resources: Rome, Italy, 1990; p. 51.
  17. Maggioni, L.; Jørgensen, R.B.; von Bothmer, R.; Poulsen, G.; Branca, F. Signs of Inter-crossing between Leafy Kale Landraces and Brassica rupestris in South Italy. Acta Hortic. 2013, 151, 165–172. [Google Scholar] [CrossRef] [Scilit]
  18. Saedler, H.; Becker, A.; Winter, K.U.; Kirchner, C.; Theissen, G. MADS-box genes are involved in floral development and evolution. Acta Biochim. Pol. 2001, 48, 351–358. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  19. Sheng, X.-G.; Zhao, Z.-Q.; Wang, J.-S.; Yu, H.-F.; Shen, Y.-S.; Zeng, X.-Y.; Gu, H.-H. Genome wide analysis of MADS-box gene family in Brassica oleracea reveals conservation and variation in flower development. BMC Plant Biol. 2019, 19, 106. [Google Scholar] [CrossRef] [Scilit]
  20. Wils, C.R.; Kaufmann, K. Gene-regulatory networks controlling inflorescence and flower development in Arabidopsis thaliana. Biochim. Biophys. Acta BBA Gene Regul. Mech. 2017, 1860, 95–105. [Google Scholar] [CrossRef] [Scilit]
Table 1. List of B. oleracea complex species (n = 9) accessions utilized.
Table 1. List of B. oleracea complex species (n = 9) accessions utilized.
Accession CodeLaboratory CodeOriginSpecies
UNICT 3876CV 171 Menhir F1ISI sementiCV
UNICT 3190BR 15 S 1 AModica (RG)CV
UNICT 4137CV 99 S2 BAdrano (CT)CV
UNICT 4145BR 13 S3 ACModica (RG)CV
UNICT 3878CV 173 Freedom3878 Royal SluisCV
UNICT 4138CV 76 S2Acireale (CT)CV
UNICT 3652CV 159CataniaCV
UNICT 3900BR 13 A X CV98/21DISPA 4CV
UNICT 3902CV 33 S1Royal SluisCV
UNICT 3895CV 98/2 X CV 136 EGDISPA 2CV
UNICT 3880CV 175 White FlashSakataCV
UNICT 3879CV 174 GraffitiISI sementiCV
UNICT 3089CV 75 S3ACAcireale (CT)CV
UNICT 3906CV 24 S4Biancavilla (CT)CV
UNICT 3892CV 98/2 X BR 13 S3DISPA 3CV
UNICT 579BR 41Modica (RG)CV
UNICT 3578BR 165 MarathonEsasemBR
UNICT 3893CV 136 EG X CV98/2DISPA 1CV
UNICT 3671CV 72 S2Catania (CT)CV
UNICT 583BR 46Vittoria (RG)BR
UNICT 658BR 45 S1Acireale (CT)BR
UNICT 3669BR 17 S2Ragusa (RG)CV
UNICT 658BR 129Roccella Valdemone (ME)BR
UNICT 657BR 128Roccella Valdemone (ME)BR
UNICT 651BR 122 PackmanPetoseedBR
UNICT 655BR 126Adrano (CT)BR
UNICT 3674CV 19 S2 APiazza Armerina (EN)CV
UNICT 637BR 106Cefalù (PA)BR
UNICT 3675BR 94 S1Francavilla (ME)BR
UNICT 3668BR 115 S1Troina (EN)BR
UNICT 574BR 36Biancavilla (CT)BR
UNICT 342Brassica macrocarpa 1Favignana (TP)BM
UNICT 733Brassica rupestris 1San Vito Lo Capo (TP)BU
UNICT 342Brassica macrocarpa 2Favignana (TP)BM
UNICT 342Brassica macrocarpa 3Favignana (TP)BM
UNICT 3512Brassica incana 1Agnone Bagni (SR)BY
UNICT 3270Brassica rupestris 2Bivongi (RC)BU
UNICT 3270Brassica rupestris 3Bivongi (RC)BU
UNICT 342Brassica macrocarpa 4Favignana (TP)BM
UNICT 3512Brassica incana 2Agnone Bagni (SR)BY
UNICT 342Brassica macrocarpa 5Favignana (TP)BM
UNICT 732Brassica rupestris 4Roccella Valdemone (ME)BU
UNICT 732Brassica rupestris 2Roccella Valdemone (ME)BU
UNICT 342Brassica macrocarpa 6Favignana (TP)BM
UNICT 736Brassica rupestris 5Ragusa Ibla (RG)BU
UNICT 342Brassica macrocarpa 7Favignana (TP)BM
UNICT 4158Brassica incana 3Sortino (SR)BY
UNICT 736Brassica rupestris 6Ragusa Ibla (RG)BU
UNICT 3040Brassica villosa 1Marianopoli (CL)BV
UNICT 736Brassica rupestris 7Ragusa Ibla (RG)BU
UNICT 342Brassica macrocarpa 8Favignana (TP)BM
UNICT 4158Brassica incana 4Sortino (SR)BY
UNICT 3040Brassica villosa 2Marianopoli (CL)BV
Legend: CV—Cauliflower; BR—Broccoli; BY—B. incana; BM—B. macrocarpa; BU—B. rupestris; BV—B. villosa.
Table 2. List of primers utilized with their sequences and chromosome position.
Table 2. List of primers utilized with their sequences and chromosome position.
GenBankPrimers NameSSR MotifPrimer Sequence
(Forward, Reverse)
Chromosome
AF113918BoPLD1(CT)7(AT)7-1GACCACCGACTCCGATCTC
AGACAAGCAAAATGCAAGGAA
C5
AF180355BoABI1(TC)16TATCAGGGTTTCCTGGGTTG
GTGAACAAGAAGAAAAGAGAGCC
C1
AF273844BoTHL1(CTT)7GCCAAGGAGGAAATCGAAG
AAGTGTCAATAAGGCAACAAGG
C9
U67451BoAP1(AT)9-1GGAGGAACGACCTTGATT
GCCAAAATATACTATGCGTCT
C6
BH479680PBCGSSRBo39[GGTCG]4AACGCATCCATCCTCACTTC
TAAACCAGCTCGTTCGGTTC
C7
Table 3. Inflorescence morphometric characteristic in descending order, from the heaviest to the lightest. The parameters measured were curd weight (CW), height (H), curvature angle (CA), curd and stem diameters (CD1 and CD2) and principal component 1 (PC1).
Table 3. Inflorescence morphometric characteristic in descending order, from the heaviest to the lightest. The parameters measured were curd weight (CW), height (H), curvature angle (CA), curd and stem diameters (CD1 and CD2) and principal component 1 (PC1).
Laboratory CodeCW (g)CH (cm)CD2 (cm)CD1 (cm)CS (cm)CA (°)PC1
CV 171 Menhir F11095.8 (21.1)11.1 (8.4)42.32 (8.5)18 (8.7)0.62 (9.6)110 (21.9)3.794
BR 15 S 1 A965.7 (37.4)15.4 (14.6)39.82 (16.4)20.7 (17.4)0.74 (16.6)105 (19.4)3.588
CV 99 S2 B666.6 (42.5)15.2 (13.2)34.09 (19.6)21.1 (15.0)0.72 (12.1)112 (20.4)2.925
BR 13 S3 AC628.8 (33.7)16.8 (16.6)38.13 (18.5)19.7 (14.6)0.85 (14.6)101 (22.5)2.742
CV 173 Freedom605 (33.8)89 (16.7)30.99 (10.3)16.9 (11.8)0.53 (12.1)113 (13.3)2.171
CV 76 S2567.3 (38.2)14.5 (15.6)36.96 (19.8)19.5 (13.1)0.74 (17.2)113 (13.5)2.722
CV 159564.9 (37.0)14.5 (20.7)34.55 (12.6)20 (15.1)0.72 (18.7)104 (16.7)2.561
BR 13 A X CV98/21554.5 (56.7)18.8 (20.4)30.84 (26.9)19.5 (19.3)0.96 (29.8)107 (17.7)2.397
CV 33 S1541.5 (54.7)13.7 (24.4)32.25 (21.9)18.9 (29.6)0.72 (18.3)112 (22.3)2.452
CV 98/2 X CV 136 EG503.9 (35.4)16.8 (28.4)32.36 (18.1)16.5 (17.9)1.02 (34.4)100 (27.4)2.039
CV 175 White Flash467.09 (41.1)7.46 (20.9)29.97 (13.3)14.6 (15.7)0.51 (11.1)101 (15.6)1.777
CV 174 Graffiti461.8 (47.1)10.8 (16.1)32.98 (13.9)17.5 (16.4)0.62 (17.4)110 (19.3)2.198
CV 75 S3AC453.5 (49.7)11 (17.2)35.54 (17.9)18.1 (27.3)0.61(22.5)117 (15.8)2.404
CV 24 S4443 (55.9)12.7 (23.0)36.41 (24.2)16.7 (23.8)0.76 (32.4)91 (26.5)1.977
CV 98/2 X BR 13 S3438.8 (84.4)17.6 (24.4)28.81 (28.1)16.8 (29.4)1.05 (34.2)93 (17.7)1.723
BR 41378.3 (46.2)10.2 (21.0)36.8 (16.9)17.2 (19.5)0.59 (17.8)113 (17.5)2.184
BR 165 Marathon319.8 (40.9)14.1 (26.8)3.52 (19.5)12.28 (26.7)1.2 (44.4)76 (29.8)0.061
CV 136 EG X CV98/2317.4 (42.0)17.2 (22.2)29.22 (28.1)14.8 (16.0)1.17 (33.1)98 (21.6)1.410
CV 72 S2305.7 (68.2)8.7 (20.7)31.7 (18.1)15.4 (22.8)0.56 (19.7)92 (25.2)1.470
BR 46279 (39.0)16.6 (18.1)3.84 (17.3)11.1 (23.7)1.5 (28.2)57 (21.5)−0.342
BR 45 S1266.9 (33.4)22.2 (30.9)3.18 (13.2)8.47 (32.7)2.7 (37.4)58 (19.4)−0.595
BR 17 S2263.6 (56.1)11.2 (28.3)34.23 (18.8)14.4 (22.0)0.78 (21.2)91 (23.4)1.379
BR 129226.4 (39.6)18.2 (12.9)3.13 (26.8)7.89 (29.4)2.3 (30.5)49 (27.8)−0.821
BR 128217.7 (58.3)18.2 (18.2)2.93 (29.8)9.49 (31.6)1.9 (29.4)54 (26.3)−0.659
BR 122 Packman212.8 (36.3)12.8 (12.2)3.14 (15.0)7.78 (23.1)1.9 (16.5)46 (24.1)−0.877
BR 126188.3 (51.8)16.6 (23.4)2.87 (24.3)7.7 (28.3)2.2 (24.2)46 (24.1)−0.951
CV 19 S2 A186.6 (41.3)8.4 (17.5)28.6 (16.7)13.6 (15.1)0.61 (18.2)85 (24.8)0.905
BR 106164 (49.0)16.5 (17.9)3.34 (32.4)8.25 (29.5)2 (52.3)46 (32.8)−0.940
BR 94 S1143.9 (42.2)16 (29.0)2.69 (22.7)7.82 (29.0)2.1 (22.6)48 (26.7)−1.008
BR 115 S1109.5 (30.8)15.5 (9.5)2.64 (20.2)7.88 (25.8)2 (23.4)41 (34.2)−1.158
BR 3663.1 (41.7)16.9 (23.5)2.76 (18.9)4.74 (22.3)3.6 (15.5)27 (15.2)−1.664
Brassica macrocarpa 536.7 (21.1)8.2 (12.1)14.5 (16.3)3.4 (23.1)0.23 (27.9)12 (10.2)−1.572
Brassica rupestris33.3 (28.3)27.6 (15.5)16.2 (20.2)3.1 (17.9)0.19 (21.2)14 (11.7)−1.574
Brassica macrocarpa 331.2 (19.8)18.6 (21.2)10.8 (23.6)2.4 (16.2)0.22 (19.8)15 (12.6)−1.781
Brassica macrocarpa 130.9 (23.2)15.4 (18.4)7.3 (20.7)3.1 (19.2)0.42 (38.4)9 (7.9)−1.915
Brassica incana 130.3 (21.9)21.1 (19.2)25.7 (26.3)3.8 (21.7)0.15 (26.5)12 (11.7)−1.201
Brassica rupestris 329.8 (19.8)20.5 (12.2)16.9 (20.5)4.2 (22.2)0.25 (21.6)13 (7.3)−1.463
Brassica rupestris 227.5 (17.5)18.4 (9.1)21.6 (23.4)3.9 (25.4)0.18 (17.8)17 (10.2)−1.271
Brassica macrocarpa 827.2 (18.4)13.2 (21.2)8.5 (19.5)2.9 (19.1)0.34 (18.9)14 (11.9)−1.827
Brassica incana 325.1 (21.8)19.6 (24.6)19.3 (31.3)2.7 (17.1)0.14 (27.1)15 (9.8)−1.477
Brassica macrocarpa 724 (21.2)21.5 (27.2)11.4 (21.2)2.5 (19.5)0.22 (21.0)10 (8.1)−1.837
Brassica rupestris 622.7 (20.1)26.3 (20.4)20.7 (28.2)2.1 (25.3)0.1 (19.2)9 (7.2)−1.573
Brassica rupestris 722.1 (18.9)20.6 (26.1)18.5 (18.4)2.5 (19.2)0.14 (18.8)10 (8.3)−1.591
Brassica macrocarpa 221.7 (18.4)15.8 (21.2)8.2 (19.2)3 (18.8)0.37 (18.9)12 (7.7)−1.873
Brassica rupestris 421.6 (16.2)19.8 (9.1)7.3 (16.3)2.1 (16.9)0.29 (15.9)11 (8.2)−1.998
Brassica macrocarpa 621.6 (20.3)17.6 (13.6)21.4 (19.7)2.1 (17.4)0.1 (16.5)15 (9.0)−1.451
Brassica incana 221.5 (15.2)20.3 (21.1)19.6 (19.1)3.1 (21.1)0.16 (19.8)12 (9.2)−1.482
Brassica rupestris 520.5 (19.0)20.8 (16.9)16.3 (20.1)2.2 (22.2)0.13 (20.5)12 (6.3)−1.670
Brassica villosa 120.1 (18.2)15.1 (12.1)19.8 (19.2)2.6 (18.4)0.13 (19.3)11 (9.2)−1.514
Brassica rupestris 119.8 (16.1)21.6 (19.5)8.9 (16.2)2.1 (14.2)0.24 (16.0)7 (6.1)−2.001
Brassica macrocarpa 419.8 (17.2)23.2 (20.3)19.6 (23.3)2.6 (21.8)0.13 (23.2)11 (8.9)−1.545
Brassica incana 419.7 (9.1)21.2 (23.2)17.3 (21.2)2.5 (18.8)0.14 (20.2)11 (8.0)−1.627
Brassica villosa 219.2 (18.4)14.5 (9.1)18.1 (15.2)2.2 (19.2)0.12 (19.1)10 (6.8)−1.616
Legend: number in brackets indicates standard deviation.
Table 4. Correlation coefficients of single descriptors with the three main principal components (PCs).
Table 4. Correlation coefficients of single descriptors with the three main principal components (PCs).
PC1PC2PC3
CW0.5080.060.229
CH−0.0320.9980.010
CD10.4380.022−0.898
CD20.527−0.0220.251
CA0.5210.0040.279
% variance46.7525.2116.34
Table 5. Multiple regression on several loci heterozygosity indices of four plant growth parameters: CW—Curd weight, CD1—Curd inflorescence diameter; CD2—Curd Stem thickness and their First Principal Component (PC1).
Table 5. Multiple regression on several loci heterozygosity indices of four plant growth parameters: CW—Curd weight, CD1—Curd inflorescence diameter; CD2—Curd Stem thickness and their First Principal Component (PC1).
EstimateStd. Errorp-Value
CW on H indices
BoTHL195.48128.870.4643
PBCGSSRBo39170.24130.620.2021
BoPLD1−248.18137.860.0888
BoAP1142.6799.970.1635
BoABI1−178.45117.180.1379
CD1 on H indices
BoTHL14.50043.06240.1518
PBCGSSRBo39−0.63563.10400.8391
BoPLD1−6.96353.27590.0416
BoAP12.73332.37560.2587
BoABI1−3.39292.78450.2322
CD2 on H indices
BoTHL18.4137.0490.2417
PBCGSSRBo391.6827.1450.8154
BoPLD1−19.0567.5410.0168
BoAP11.1245.4680.8386
BoABI1−12.9266.4100.0525
PC1 on H indices
BoTHL11.13480.88700.2102
PBCGSSRBo390.32600.89900.7193
BoPLD1−2.24530.94880.0244
BoAP10.66610.68810.3405
BoABI1−1.23910.0650.1346
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Treccarichi, S.; Di Gaetano, C.; Di Stefano, F.; Gasparini, M.; Branca, F. Using Simple Sequence Repeats in 9 Brassica Complex Species to Assess Hypertrophic Curd Induction. Agriculture 2021, 11, 622. https://doi.org/10.3390/agriculture11070622

AMA Style

Treccarichi S, Di Gaetano C, Di Stefano F, Gasparini M, Branca F. Using Simple Sequence Repeats in 9 Brassica Complex Species to Assess Hypertrophic Curd Induction. Agriculture. 2021; 11(7):622. https://doi.org/10.3390/agriculture11070622

Chicago/Turabian Style

Treccarichi, Simone, Cornelia Di Gaetano, Fulvio Di Stefano, Mauro Gasparini, and Ferdinando Branca. 2021. "Using Simple Sequence Repeats in 9 Brassica Complex Species to Assess Hypertrophic Curd Induction" Agriculture 11, no. 7: 622. https://doi.org/10.3390/agriculture11070622

APA Style

Treccarichi, S., Di Gaetano, C., Di Stefano, F., Gasparini, M., & Branca, F. (2021). Using Simple Sequence Repeats in 9 Brassica Complex Species to Assess Hypertrophic Curd Induction. Agriculture, 11(7), 622. https://doi.org/10.3390/agriculture11070622

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop