Combined Effects of Cyclic Hypoxic and Mechanical Stimuli on Human Bone Marrow Mesenchymal Stem Cell Differentiation: A New Approach to the Treatment of Bone Loss
Abstract
:1. Introduction
2. Materials and Methods
2.1. MSCs Culture and Differentiation
2.2. Experimental Conditions
2.2.1. Pretreatment and Differentiation into Osteoblasts and Adipocytes
2.2.2. Cotreatments during Differentiation into Osteoblasts or Adipocytes
2.3. Histochemical Stains
2.4. RNA Isolation and Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR)
2.5. Protein Extraction and Western-Blot Analyses
2.6. Statistical Analyses
3. Results
3.1. Pretreatment with Low-Intensity Vibration Stimuli (Combined with Hypoxic Exposure) Predisposes MSCs Toward an Osteoblastic Phenotype
3.2. Effect of Pretreatment with Low-Intensity Vibration and/or Cyclic Hypoxia on MSCs Differentiation into Osteoblasts or Adipocytes
3.3. Effects of Cotreatment with Low-Intensity Vibration and/or Cyclic Hypoxia in MSCs Differentiation into Osteoblasts or Adipocytes
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Winklmayr, M.; Kluge, C.; Winklmayr, W.; Küchenhoff, H.; Steiner, M.; Ritter, M.; Hartl, A. Radon Balneotherapy and Physical Activity for Osteoporosis Prevention: A Randomized, Placebo-Controlled Intervention Study. Radiat. Environ. Biophys. 2015, 54, 123–136. [Google Scholar] [CrossRef] [PubMed]
- Foessl, I.; Dimai, H.P.; Obermayer-Pietsch, B. Long-Term and Sequential Treatment for Osteoporosis. Nat. Rev. Endocrinol. 2023, 19, 520–533. [Google Scholar] [CrossRef]
- Koller, G.; Goetz, V.; Vandermeer, B.; Homik, J.; McAlister, F.A.; Kendler, D.; Ye, C. Persistence and Adherence to Parenteral Osteoporosis Therapies: A Systematic Review. Osteoporos. Int. 2020, 31, 2093–2102. [Google Scholar] [CrossRef] [PubMed]
- Varenna, M.; Sinigaglia, L. Adherence to treatment of osteoporosis: An open question. Reumatismo 2009, 61, 4–9. [Google Scholar] [CrossRef]
- Rosen, C.J.; Klibanski, A. Bone, Fat, and Body Composition: Evolving Concepts in the Pathogenesis of Osteoporosis. Am. J. Med. 2009, 122, 409–414. [Google Scholar] [CrossRef]
- Shapses, S.A.; Pop, L.C.; Wang, Y. Obesity Is a Concern for Bone Health with Aging. Nutr. Res. 2017, 39, 1–13. [Google Scholar] [CrossRef]
- Kawai, M.; de Paula, F.J.A.; Rosen, C.J. New Insights into Osteoporosis: The Bone-Fat Connection. J. Intern. Med. 2012, 272, 317–329. [Google Scholar] [CrossRef]
- Infante, A.; Rodríguez, C.I. Osteogenesis and Aging: Lessons from Mesenchymal Stem Cells. Stem Cell Res. Ther. 2018, 9, 244. [Google Scholar] [CrossRef]
- Fragala, M.S.; Cadore, E.L.; Dorgo, S.; Izquierdo, M.; Kraemer, W.J.; Peterson, M.D.; Ryan, E.D. Resistance Training for Older Adults: Position Statement From the National Strength and Conditioning Association. J. Strength Cond. Res. 2019, 33, 2019–2052. [Google Scholar] [CrossRef]
- Sievänen, H.; Karinkanta, S.; Moisio-Vilenius, P.; Ripsaluoma, J. Feasibility of Whole-Body Vibration Training in Nursing Home Residents with Low Physical Function: A Pilot Study. Aging Clin. Exp. Res. 2014, 26, 511–517. [Google Scholar] [CrossRef]
- DeFrates, K.G.; Franco, D.; Heber-Katz, E.; Messersmith, P.B. Unlocking Mammalian Regeneration through Hypoxia Inducible Factor One Alpha Signaling. Biomaterials 2021, 269, 120646. [Google Scholar] [CrossRef] [PubMed]
- Camacho-Cardenosa, M.; Camacho-Cardenosa, A.; Timón, R.; Olcina, G.; Tomas-Carus, P.; Brazo-Sayavera, J. Can Hypoxic Conditioning Improve Bone Metabolism? A Systematic Review. Int. J. Environ. Res. Public Health 2019, 16, 1799. [Google Scholar] [CrossRef] [PubMed]
- Scott, B.R.; Slattery, K.M.; Sculley, D.V.; Dascombe, B.J. Hypoxia and Resistance Exercise: A Comparison of Localized and Systemic Methods. Sports Med. 2014, 44, 1037–1054. [Google Scholar] [CrossRef] [PubMed]
- Pramsohler, S.; Burtscher, M.; Faulhaber, M.; Gatterer, H.; Rausch, L.; Eliasson, A.; Netzer, N.C. Endurance Training in Normobaric Hypoxia Imposes Less Physical Stress for Geriatric Rehabilitation. Front. Physiol. 2017, 8, 514. [Google Scholar] [CrossRef] [PubMed]
- Hannah, S.S.; McFadden, S.; McNeilly, A.; McClean, C. “Take My Bone Away?” Hypoxia and Bone: A Narrative Review. J. Cell. Physiol. 2021, 236, 721–740. [Google Scholar] [CrossRef]
- Camacho-Cardenosa, M.; Camacho-Cardenosa, A.; Burtscher, M.; Brazo-Sayavera, J.; Tomas-Carus, P.; Olcina, G.; Timón, R. Effects of Whole-Body Vibration Training Combined With Cyclic Hypoxia on Bone Mineral Density in Elderly People. Front. Physiol. 2019, 10, 1122. [Google Scholar] [CrossRef]
- Timón, R.; González-Custodio, A.; Gusi, N.; Olcina, G. Effects of Intermittent Hypoxia and Whole-Body Vibration Training on Health-Related Outcomes in Older Adults. Aging Clin. Exp. Res. 2024, 36, 6. [Google Scholar] [CrossRef]
- Lee, J.; Kim, H.-S.; Kim, S.-M.; Kim, D.-I.; Lee, C.-W. Hypoxia Upregulates Mitotic Cyclins Which Contribute to the Multipotency of Human Mesenchymal Stem Cells by Expanding Proliferation Lifespan. Mol. Cells 2018, 41, 207–213. [Google Scholar] [CrossRef]
- Pulido-Escribano, V.; Torrecillas-Baena, B.; Camacho-Cardenosa, M.; Dorado, G.; Gálvez-Moreno, M.Á.; Casado-Díaz, A. Role of Hypoxia Preconditioning in Therapeutic Potential of Mesenchymal Stem-Cell-Derived Extracellular Vesicles. World J. Stem Cells 2022, 14, 453–472. [Google Scholar] [CrossRef]
- Samal, J.R.K.; Rangasami, V.K.; Samanta, S.; Varghese, O.P.; Oommen, O.P. Discrepancies on the Role of Oxygen Gradient and Culture Condition on Mesenchymal Stem Cell Fate. Adv. Healthc. Mater. 2021, 10, 2002058. [Google Scholar] [CrossRef]
- Dos Santos, F.; Andrade, P.Z.; Boura, J.S.; Abecasis, M.M.; da Silva, C.L.; Cabral, J.M.S. Ex Vivo Expansion of Human Mesenchymal Stem Cells: A More Effective Cell Proliferation Kinetics and Metabolism under Hypoxia. J. Cell. Physiol. 2010, 223, 27–35. [Google Scholar] [CrossRef] [PubMed]
- Volkmer, E.; Kallukalam, B.C.; Maertz, J.; Otto, S.; Drosse, I.; Polzer, H.; Bocker, W.; Stengele, M.; Docheva, D.; Mutschler, W.; et al. Hypoxic Preconditioning of Human Mesenchymal Stem Cells Overcomes Hypoxia-Induced Inhibition of Osteogenic Differentiation. Tissue Eng. Part A 2010, 16, 153–164. [Google Scholar] [CrossRef] [PubMed]
- Yang, D.-C.; Yang, M.-H.; Tsai, C.-C.; Huang, T.-F.; Chen, Y.-H.; Hung, S.-C. Hypoxia Inhibits Osteogenesis in Human Mesenchymal Stem Cells through Direct Regulation of RUNX2 by TWIST. PLoS ONE 2011, 6, e23965. [Google Scholar] [CrossRef] [PubMed]
- Zhang, P.; Ha, N.; Dai, Q.; Zhou, S.; Yu, C.; Jiang, L. Hypoxia Suppresses Osteogenesis of Bone Mesenchymal Stem Cells via the Extracellular Signal-regulated 1/2 and P38-mitogen Activated Protein Kinase Signaling Pathways. Mol. Med. Rep. 2017, 16, 5515–5522. [Google Scholar] [CrossRef] [PubMed]
- Boyette, L.B.; Creasey, O.A.; Guzik, L.; Lozito, T.; Tuan, R.S. Human Bone Marrow-Derived Mesenchymal Stem Cells Display Enhanced Clonogenicity but Impaired Differentiation with Hypoxic Preconditioning. Stem Cells Transl. Med. 2014, 3, 241–254. [Google Scholar] [CrossRef] [PubMed]
- Grayson, W.L.; Zhao, F.; Izadpanah, R.; Bunnell, B.; Ma, T. Effects of Hypoxia on Human Mesenchymal Stem Cell Expansion and Plasticity in 3D Constructs. J. Cell. Physiol. 2006, 207, 331–339. [Google Scholar] [CrossRef] [PubMed]
- Hu, Y.; Lou, B.; Wu, X.; Wu, R.; Wang, H.; Gao, L.; Pi, J.; Xu, Y. Comparative Study on In Vitro Culture of Mouse Bone Marrow Mesenchymal Stem Cells. Stem Cells Int. 2018, 2018, 6704583. [Google Scholar] [CrossRef]
- Sheehy, E.J.; Buckley, C.T.; Kelly, D.J. Oxygen Tension Regulates the Osteogenic, Chondrogenic and Endochondral Phenotype of Bone Marrow Derived Mesenchymal Stem Cells. Biochem. Biophys. Res. Commun. 2012, 417, 305–310. [Google Scholar] [CrossRef]
- Dirckx, N.; Tower, R.J.; Mercken, E.M.; Vangoitsenhoven, R.; Moreau-Triby, C.; Breugelmans, T.; Nefyodova, E.; Cardoen, R.; Mathieu, C.; Van der Schueren, B.; et al. Vhl Deletion in Osteoblasts Boosts Cellular Glycolysis and Improves Global Glucose Metabolism. J. Clin. Investig. 2018, 128, 1087–1105. [Google Scholar] [CrossRef]
- Lee, W.C.; Guntur, A.R.; Long, F.; Rosen, C.J. Energy Metabolism of the Osteoblast: Implications for Osteoporosis. Endocr. Rev. 2017, 38, 255–266. [Google Scholar] [CrossRef]
- Camacho-Cardenosa, M.; Quesada-Gómez, J.M.; Camacho-Cardenosa, A.; Leal, A.; Dorado, G.; Torrecillas-Baena, B.; Casado-Díaz, A. Effects of Normobaric Cyclic Hypoxia Exposure on Mesenchymal Stem-Cell Differentiation-Pilot Study on Bone Parameters in Elderly. World J. Stem Cells 2020, 12, 1667–1690. [Google Scholar] [CrossRef] [PubMed]
- Guner, I.; Uzun, D.D.; Yaman, M.O.; Genc, H.; Gelisgen, R.; Korkmaz, G.G.; Hallac, M.; Yelmen, N.; Sahin, G.; Karter, Y.; et al. The Effect of Chronic Long-Term Intermittent Hypobaric Hypoxia on Bone Mineral Density in Rats: Role of Nitric Oxide. Biol. Trace Elem. Res. 2013, 154, 262–267. [Google Scholar] [CrossRef] [PubMed]
- Knowles, H.J. Hypoxic Regulation of Osteoclast Differentiation and Bone Resorption Activity. Hypoxia 2015, 3, 73–82. [Google Scholar] [CrossRef]
- Wang, G.; Wang, J.; Sun, D.; Xin, J.; Wang, L.; Huang, D.; Wu, W.; Xian, C.J. Short-Term Hypoxia Accelerates Bone Loss in Ovariectomized Rats by Suppressing Osteoblastogenesis but Enhancing Osteoclastogenesis. Med. Sci. Monit. 2016, 22, 2962–2971. [Google Scholar] [CrossRef]
- Camacho-Cardenosa, A.; Camacho-Cardenosa, M.; Martínez-Guardado, I.; Leal, A.; Andrada, J.M.V.; Timón, R. Resistance Circuit Training Combined with Hypoxia Stimulates Bone System of Older Adults: A Randomized Trial. Exp. Gerontol. 2022, 169, 111983. [Google Scholar] [CrossRef]
- Zhang, L.; Yin, Y.; Guo, J.; Jin, L.; Hou, Z. Chronic Intermittent Hypobaric Hypoxia Ameliorates Osteoporosis after Spinal Cord Injury through Balancing Osteoblast and Osteoclast Activities in Rats. Front. Endocrinol. 2023, 14, 1035186. [Google Scholar] [CrossRef]
- Yoo, H.I.; Moon, Y.H.; Kim, M.S. Effects of CoCl2 on Multi-Lineage Differentiation of C3H/10T1/2 Mesenchymal Stem Cells. Korean J. Physiol. Pharmacol. 2016, 20, 53–62. [Google Scholar] [CrossRef]
- Udartseva, O.O.; Andreeva, E.R.; Buravkova, L.B. WNT-Associated Gene Expression in Human Mesenchymal Stromal Cells under Hypoxic Stress. Dokl. Biochem. Biophys. 2015, 465, 354–357. [Google Scholar] [CrossRef] [PubMed]
- Bas, G.; Loisate, S.; Hudon, S.F.; Woods, K.; Hayden, E.J.; Pu, X.; Beard, R.; Oxford, J.T.; Uzer, G. Low Intensity Vibrations Augment Mesenchymal Stem Cell Proliferation and Differentiation Capacity during in Vitro Expansion. Sci. Rep. 2020, 10, 9369. [Google Scholar] [CrossRef]
- Steward, A.J.; Kelly, D.J. Mechanical Regulation of Mesenchymal Stem Cell Differentiation. J. Anat. 2015, 227, 717–731. [Google Scholar] [CrossRef]
- Wakeling, J.M.; Nigg, B.M. Modification of Soft Tissue Vibrations in the Leg by Muscular Activity. J. Appl. Physiol. 2001, 90, 412–420. [Google Scholar] [CrossRef] [PubMed]
- Pagnotti, G.M.; Styner, M.; Uzer, G.; Patel, V.S.; Wright, L.E.; Ness, K.K.; Guise, T.A.; Rubin, J.; Rubin, C.T. Combating Osteoporosis and Obesity with Exercise: Leveraging Cell Mechanosensitivity. Nat. Rev. Endocrinol. 2019, 15, 339–355. [Google Scholar] [CrossRef] [PubMed]
- Uzer, G.; Pongkitwitoon, S.; Chan, M.E.; Judex, S. Vibration Induced Osteogenic Commitment of Mesenchymal Stem Cells Is Enhanced by Cytoskeletal Remodeling but Not Fluid Shear. J. Biomech. 2013, 46, 2296–2302. [Google Scholar] [CrossRef] [PubMed]
- Wen, J.; Bao, M.; Tang, M.; He, X.; Yao, X.; Li, L. Low Magnitude Vibration Alleviates Age-Related Bone Loss by Inhibiting Cell Senescence of Osteogenic Cells in Naturally Senescent Rats. Aging 2021, 13, 12031–12045. [Google Scholar] [CrossRef]
- Lau, E.; Lee, W.D.; Li, J.; Xiao, A.; Davies, J.E.; Wu, Q.; Wang, L.; You, L. Effect of Low-Magnitude, High-Frequency Vibration on Osteogenic Differentiation of Rat Mesenchymal Stromal Cells. J. Orthop. Res. 2011, 29, 1075–1080. [Google Scholar] [CrossRef] [PubMed]
- Yu, X.; Zeng, Y.; Bao, M.; Wen, J.; Zhu, G.; Cao, C.; He, X.; Li, L. Low-Magnitude Vibration Induces Osteogenic Differentiation of Bone Marrow Mesenchymal Stem Cells via miR-378a-3p/Grb2 Pathway to Promote Bone Formation in a Rat Model of Age-Related Bone Loss. FASEB J. 2020, 34, 11754–11771. [Google Scholar] [CrossRef]
- Li, R.; Liang, L.; Dou, Y.; Huang, Z.; Mo, H.; Wang, Y.; Yu, B. Mechanical Strain Regulates Osteogenic and Adipogenic Differentiation of Bone Marrow Mesenchymal Stem Cells. Biomed. Res. Int. 2015, 2015, 873251. [Google Scholar] [CrossRef]
- Trudel, G.; Payne, M.; Mädler, B.; Ramachandran, N.; Lecompte, M.; Wade, C.; Biolo, G.; Blanc, S.; Hughson, R.; Bear, L.; et al. Bone Marrow Fat Accumulation after 60 Days of Bed Rest Persisted 1 Year after Activities Were Resumed along with Hemopoietic Stimulation: The Women International Space Simulation for Exploration Study. J. Appl. Physiol. 2009, 107, 540–548. [Google Scholar] [CrossRef]
- Sen, B.; Xie, Z.; Case, N.; Ma, M.; Rubin, C.; Rubin, J. Mechanical Strain Inhibits Adipogenesis in Mesenchymal Stem Cells by Stimulating a Durable Beta-Catenin Signal. Endocrinology 2008, 149, 6065–6075. [Google Scholar] [CrossRef]
- Bilek, L.D.; Flores, L.E.; Waltman, N.; Mack, L.R.; Smith, K.; Hillstrom, D.; Griffin, M.; Yecies, L.; Jaasma, M. FRI681 OsteoboostTm Is Effective in Preserving Bone Strength and Density of the Spine in Women with Low Bone Mass. J. Endocr. Soc. 2023, 7, A243. [Google Scholar] [CrossRef]
- Casado-Díaz, A.; Santiago-Mora, R.; Jiménez, R.; Caballero-Villarraso, J.; Herrera, C.; Torres, A.; Dorado, G.; Quesada-Gómez, J.M. Cryopreserved human bone marrow mononuclear cells as a source of mesenchymal stromal cells: Application in osteoporosis research. Cytotherapy. 2008, 10, 460–468. [Google Scholar] [CrossRef] [PubMed]
- Gürtler, A.; Kunz, N.; Gomolka, M.; Hornhardt, S.; Friedl, A.A.; McDonald, K.; Kohn, J.E.; Posch, A. Stain-Free technology as a normalization tool in Western blot analysis. Anal. Biochem. 2013, 433, 105–111. [Google Scholar] [CrossRef] [PubMed]
- Gilda, J.E.; Gomes, A.V. Stain-Free total protein staining is a superior loading control to b-actin for Western blots. Anal. Biochem. 2013, 440, 186–188. [Google Scholar] [CrossRef]
- Merle, B.; Garnero, P. The Multiple Facets of Periostin in Bone Metabolism. Osteoporos. Int. 2012, 23, 1199–1212. [Google Scholar] [CrossRef]
- Zhuang, Y.; Zhao, Z.; Cheng, M.; Li, M.; Si, J.; Lin, K.; Yu, H. HIF-1α Regulates Osteogenesis of Periosteum-Derived Stem Cells Under Hypoxia Conditions via Modulating POSTN Expression. Front. Cell Dev. Biol. 2022, 10, 836285. [Google Scholar] [CrossRef] [PubMed]
- Mimura, I.; Nangaku, M.; Kanki, Y.; Tsutsumi, S.; Inoue, T.; Kohro, T.; Yamamoto, S.; Fujita, T.; Shimamura, T.; Suehiro, J.; et al. Dynamic Change of Chromatin Conformation in Response to Hypoxia Enhances the Expression of GLUT3 (SLC2A3) by Cooperative Interaction of Hypoxia-Inducible Factor 1 and KDM3A. Mol. Cell. Biol. 2012, 32, 3018–3032. [Google Scholar] [CrossRef]
- Styner, M.; Thompson, W.R.; Galior, K.; Uzer, G.; Wu, X.; Kadari, S.; Case, N.; Xie, Z.; Sen, B.; Romaine, A.; et al. Bone Marrow Fat Accumulation Accelerated by High Fat Diet Is Suppressed by Exercise. Bone 2014, 64, 39–46. [Google Scholar] [CrossRef] [PubMed]
- Arponen, M.; Jalava, N.; Widjaja, N.; Ivaska, K.K. Glucose Transporters GLUT1, GLUT3, and GLUT4 Have Different Effects on Osteoblast Proliferation and Metabolism. Front. Physiol. 2022, 13, 1035516. [Google Scholar] [CrossRef] [PubMed]
- Donat, A.; Knapstein, P.-R.; Jiang, S.; Baranowsky, A.; Ballhause, T.-M.; Frosch, K.-H.; Keller, J. Glucose Metabolism in Osteoblasts in Healthy and Pathophysiological Conditions. Int. J. Mol. Sci. 2021, 22, 4120. [Google Scholar] [CrossRef]
- Holzwarth, C.; Vaegler, M.; Gieseke, F.; Pfister, S.M.; Handgretinger, R.; Kerst, G.; Müller, I. Low Physiologic Oxygen Tensions Reduce Proliferation and Differentiation of Human Multipotent Mesenchymal Stromal Cells. BMC Cell Biol. 2010, 11, 11. [Google Scholar] [CrossRef]
- Shum, L.C.; White, N.S.; Mills, B.N.; Bentley, K.L.d.M.; Eliseev, R.A. Energy Metabolism in Mesenchymal Stem Cells during Osteogenic Differentiation. Stem Cells Dev. 2016, 25, 114–122. [Google Scholar] [CrossRef] [PubMed]
- Nakazawa, T.; Nakajima, A.; Seki, N.; Okawa, A.; Kato, M.; Moriya, H.; Amizuka, N.; Einhorn, T.A.; Yamazaki, M. Gene Expression of Periostin in the Early Stage of Fracture Healing Detected by cDNA Microarray Analysis. J. Orthop. Res. 2004, 22, 520–525. [Google Scholar] [CrossRef] [PubMed]
- Bonnet, N.; Garnero, P.; Ferrari, S. Periostin Action in Bone. Mol. Cell. Endocrinol. 2016, 432, 75–82. [Google Scholar] [CrossRef]
- Idolazzi, L.; Ridolo, E.; Fassio, A.; Gatti, D.; Montagni, M.; Caminati, M.; Martignago, I.; Incorvaia, C.; Senna, G. Periostin: The Bone and Beyond. Eur. J. Intern. Med. 2017, 38, 12–16. [Google Scholar] [CrossRef]
- Cukierman, E.; Pankov, R.; Yamada, K.M. Cell interactions with three-dimensional matrices. Curr. Opin. Cell Biol. 2002, 14, 633–639. [Google Scholar] [CrossRef]
- Steppe, L.; Liedert, A.; Ignatius, A.; Haffner-Luntzer, M. Influence of Low-Magnitude High-Frequency Vibration on Bone Cells and Bone Regeneration. Front. Bioeng. Biotechnol. 2020, 8, 595139. [Google Scholar] [CrossRef]
- Robling, A.G.; Burr, D.B.; Turner, C.H. Recovery Periods Restore Mechanosensitivity to Dynamically Loaded Bone. J. Exp. Biol. 2001, 204, 3389–3399. [Google Scholar] [CrossRef] [PubMed]
- Merle, B.; Bouet, G.; Rousseau, J.-C.; Bertholon, C.; Garnero, P. Periostin and Transforming Growth Factor β-Induced Protein (TGFβIp) Are Both Expressed by Osteoblasts and Osteoclasts. Cell Biol. Int. 2014, 38, 398–404. [Google Scholar] [CrossRef]
- Afanador, E.; Yokozeki, M.; Oba, Y.; Kitase, Y.; Takahashi, T.; Kudo, A.; Moriyama, K. Messenger RNA Expression of Periostin and Twist Transiently Decrease by Occlusal Hypofunction in Mouse Periodontal Ligament. Arch. Oral Biol. 2005, 50, 1023–1031. [Google Scholar] [CrossRef]
- Tao, Q.; Lu, Y.; Qi, Y.; Yu, D.; Gu, J.; Zhu, Y.; Shi, C.; Liang, X. Hypoxia Promotes the Expression of Von Willebrand Factor in Breast Cancer Cells by Up-Regulating the Transcription Factor YY1 and down-Regulating the Hsa-miR-424. Eur. J. Pharmacol. 2022, 934, 175308. [Google Scholar] [CrossRef]
- Romeo, F.; Falbo, L.; Di Sanzo, M.; Misaggi, R.; Faniello, M.C.; Barni, T.; Cuda, G.; Viglietto, G.; Santoro, C.; Quaresima, B.; et al. Negative Transcriptional Regulation of the Human Periostin Gene by YingYang-1 Transcription Factor. Gene 2011, 487, 129–134. [Google Scholar] [CrossRef]
- Bao, Q.; Chen, S.; Qin, H.; Feng, J.; Liu, H.; Liu, D.; Li, A.; Shen, Y.; Zhong, X.; Li, J.; et al. Constitutive β-Catenin Activation in Osteoblasts Impairs Terminal Osteoblast Differentiation and Bone Quality. Exp. Cell Res. 2017, 350, 123–131. [Google Scholar] [CrossRef] [PubMed]
- Simpson, I.A.; Dwyer, D.; Malide, D.; Moley, K.H.; Travis, A.; Vannucci, S.J. The Facilitative Glucose Transporter GLUT3: 20 Years of Distinction. Am. J. Physiol. Endocrinol. Metab. 2008, 295, E242–E253. [Google Scholar] [CrossRef]
- Chen, C.-T.; Shih, Y.-R.V.; Kuo, T.K.; Lee, O.K.; Wei, Y.-H. Coordinated Changes of Mitochondrial Biogenesis and Antioxidant Enzymes during Osteogenic Differentiation of Human Mesenchymal Stem Cells. Stem Cells 2008, 26, 960–968. [Google Scholar] [CrossRef]
- Qian, S.-W.; Li, X.; Zhang, Y.-Y.; Huang, H.-Y.; Liu, Y.; Sun, X.; Tang, Q.-Q. Characterization of Adipocyte Differentiation from Human Mesenchymal Stem Cells in Bone Marrow. BMC Dev. Biol. 2010, 10, 47. [Google Scholar] [CrossRef] [PubMed]
- Kozak, L.P.; Kozak, U.C.; Clarke, G.T. Abnormal Brown and White Fat Development in Transgenic Mice Overexpressing Glycerol 3-Phosphate Dehydrogenase. Genes Dev. 1991, 5, 2256–2264. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.; Jiang, F.; Wang, Z.; Tang, L.; Zou, B.; Xu, P.; Yu, T. Hypoxic Bone Marrow Mesenchymal Cell-Extracellular Vesicles Containing miR-328-3p Promote Lung Cancer Progression via the NF2-Mediated Hippo Axis. J. Cell. Mol. Med. 2021, 25, 96–109. [Google Scholar] [CrossRef]
- Başarır Sivri, F.N.; Çiftçi, S. A New Insight into Fatty Acid Binding Protein 4 Mechanisms and Therapeutic Implications in Obesity-Associated Diseases: A Mini Review. Mol. Nutr. Food Res. 2024, 68, e2300840. [Google Scholar] [CrossRef]
- Shan, T.; Liu, W.; Kuang, S. Fatty Acid Binding Protein 4 Expression Marks a Population of Adipocyte Progenitors in White and Brown Adipose Tissues. FASEB J. 2013, 27, 277–287. [Google Scholar] [CrossRef]
- Fehrer, C.; Brunauer, R.; Laschober, G.; Unterluggauer, H.; Reitinger, S.; Kloss, F.; Gülly, C.; Gassner, R.; Lepperdinger, G. Reduced Oxygen Tension Attenuates Differentiation Capacity of Human Mesenchymal Stem Cells and Prolongs Their Lifespan. Aging Cell 2007, 6, 745–757. [Google Scholar] [CrossRef]
- Sen, B.; Styner, M.; Xie, Z.; Case, N.; Rubin, C.T.; Rubin, J. Mechanical Loading Regulates NFATc1 and Beta-Catenin Signaling through a GSK3beta Control Node. J. Biol. Chem. 2009, 284, 34607–34617. [Google Scholar] [CrossRef]
- Sen, B.; Xie, Z.; Case, N.; Thompson, W.R.; Uzer, G.; Styner, M.; Rubin, J. mTORC2 Regulates Mechanically Induced Cytoskeletal Reorganization and Lineage Selection in Marrow-Derived Mesenchymal Stem Cells. J. Bone Miner. Res. 2014, 29, 78–89. [Google Scholar] [CrossRef] [PubMed]
- Thompson, W.R.; Guilluy, C.; Xie, Z.; Sen, B.; Brobst, K.E.; Yen, S.S.; Uzer, G.; Styner, M.; Case, N.; Burridge, K.; et al. Mechanically Activated Fyn Utilizes mTORC2 to Regulate RhoA and Adipogenesis in Mesenchymal Stem Cells. Stem Cells 2013, 31, 2528–2537. [Google Scholar] [CrossRef] [PubMed]
- Uzer, G.; Thompson, W.R.; Sen, B.; Xie, Z.; Yen, S.S.; Miller, S.; Bas, G.; Styner, M.; Rubin, C.T.; Judex, S.; et al. Cell Mechanosensitivity to Extremely Low Magnitude Signals Is Enabled by a LINCed Nucleus. Stem Cells 2015, 33, 2063–2076. [Google Scholar] [CrossRef]
- Sen, B.; Guilluy, C.; Xie, Z.; Case, N.; Styner, M.; Thomas, J.; Oguz, I.; Rubin, C.; Burridge, K.; Rubin, J. Mechanically Induced Focal Adhesion Assembly Amplifies Anti-Adipogenic Pathways in Mesenchymal Stem Cells. Stem Cells 2011, 29, 1829–1836. [Google Scholar] [CrossRef]
- Cheng, M.-H.; Chang, S.-F. Frailty as a Risk Factor for Falls among Community Dwelling People: Evidence From a Meta-Analysis. J. Nurs. Scholarsh. 2017, 49, 529–536. [Google Scholar] [CrossRef]
Gene | Primer Sequence (5′ → 3′) (Forward above; Reverse below) | Product Size (bp) |
---|---|---|
Runt-related transcription factor 2 (RUNX2) | TGGTTAATCTCCGCAGGTCAC ACTGTGCTGAAGAGGCTGTTTG | 143 |
Osterix (SP7) | AGCCAGAAGCTGTGAAACCTC AGCTGCAAGCTCTCCATAACC | 163 |
Collagen, type I, alpha 1 (COL1A1) | CGCTGGCCCCAAAGGATCTCCTG GGGGTCCGGGAACACCTCGCTC | 263 |
Integrin-binding sialoprotein (IBSP) | AGGGCAGTAGTGACTCATCCG CGTCCTCTCCATAGCCCAGTGTTG | 171 |
Osteocalcin (BGLAP) | CCATGAGAGCCCTCACACTCC GGTCAGCCAACTCGTCACAGTC | 258 |
Periostin (POSTN) | CCAAATGTCTGTGCCCTTCAAC AGCCTTTCATTCCTTCCATTCTC | 154 |
Transporter Glucose 3 (GLUT3) | AAACTTGCTGCTGAGAAGGACA AGAGCCGATTGTAGCAACTGTG | 167 |
Peroxisome proliferator-activated receptor gamma 2 (PPARG2) | GCGATTCCTTCACTGATACACTG GAGTGGGAGTGGTCTTCCATTAC | 136 |
Lipoprotein lipase (LPL) | AAGAAGCAGCAAAATGTACCTGAAG CCTGATTGGTATGGGTTTCACTC | 113 |
Fatty acid synthase (FASN) | AAGCTGAAGGACCTGTCTAGG CGGAGTGAATCTGGGTTGATG | 146 |
Fatty acid binding protein 4 (FABP4) | GCAGCTTCCTTCTCACCTTGA CCATGCCAGCCACTTTCCT | 155 |
Glycerol-3-Phosphate Dehydrogenase 1 (GPD1) | ATACAGCATCCTCCAGCACAAG GGATGATTCTGCAGGCAGTG | 120 |
Polymerase RNA II polypeptide A (POLR2A) | TTTTGGTGACGACTTGAACTGC CCATCTTGTCCACCACCTCTTC | 125 |
Ribosomal Protein L13a (RPL13a) | CTCTGGACCGTCTCAAGGTGT CTGGTACTTCCAGCCAACCTC | 158 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Camacho-Cardenosa, M.; Pulido-Escribano, V.; Torrecillas-Baena, B.; Quesada-Gómez, J.M.; Herrera-Martínez, A.D.; Sola-Guirado, R.R.; Dorado, G.; Gálvez-Moreno, M.Á.; Casado-Díaz, A. Combined Effects of Cyclic Hypoxic and Mechanical Stimuli on Human Bone Marrow Mesenchymal Stem Cell Differentiation: A New Approach to the Treatment of Bone Loss. J. Clin. Med. 2024, 13, 5805. https://doi.org/10.3390/jcm13195805
Camacho-Cardenosa M, Pulido-Escribano V, Torrecillas-Baena B, Quesada-Gómez JM, Herrera-Martínez AD, Sola-Guirado RR, Dorado G, Gálvez-Moreno MÁ, Casado-Díaz A. Combined Effects of Cyclic Hypoxic and Mechanical Stimuli on Human Bone Marrow Mesenchymal Stem Cell Differentiation: A New Approach to the Treatment of Bone Loss. Journal of Clinical Medicine. 2024; 13(19):5805. https://doi.org/10.3390/jcm13195805
Chicago/Turabian StyleCamacho-Cardenosa, Marta, Victoria Pulido-Escribano, Bárbara Torrecillas-Baena, Jose Manuel Quesada-Gómez, Aura D. Herrera-Martínez, Rafael R. Sola-Guirado, Gabriel Dorado, María Ángeles Gálvez-Moreno, and Antonio Casado-Díaz. 2024. "Combined Effects of Cyclic Hypoxic and Mechanical Stimuli on Human Bone Marrow Mesenchymal Stem Cell Differentiation: A New Approach to the Treatment of Bone Loss" Journal of Clinical Medicine 13, no. 19: 5805. https://doi.org/10.3390/jcm13195805
APA StyleCamacho-Cardenosa, M., Pulido-Escribano, V., Torrecillas-Baena, B., Quesada-Gómez, J. M., Herrera-Martínez, A. D., Sola-Guirado, R. R., Dorado, G., Gálvez-Moreno, M. Á., & Casado-Díaz, A. (2024). Combined Effects of Cyclic Hypoxic and Mechanical Stimuli on Human Bone Marrow Mesenchymal Stem Cell Differentiation: A New Approach to the Treatment of Bone Loss. Journal of Clinical Medicine, 13(19), 5805. https://doi.org/10.3390/jcm13195805