Characterization of Brucella abortus Mutant A19mut2, a Potential DIVA Vaccine Candidate with a Modification on Lipopolysaccharide
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethics Statement
2.2. Brucella Strains and Cultural Conditions
2.3. Mutant Construction
2.4. Bacterial Growth Determination
2.5. Acridine Yellow Agglutination and Heat Agglutination Tests
2.6. LPS Extraction
2.7. SDS-PAGE and Western Blotting
2.8. Stress Resistance Assay
2.9. Virulence Test
2.10. Histopathological Examination
2.11. Evaluation of Antibody Response in Mice Serum
2.12. Detection of Cytokine in Supernatants of Splenocytes
2.13. Protective Efficacy Analysis
2.14. Statistical Analysis
3. Results
3.1. A19-Derived Mutant A19mut2 Was Constructed Successfully with an Antigenically Modified O-PS
3.2. A19mut2 Reduced Its Ability to Resist Acidic pH, but Not Hydrogen Peroxide, Polymyxin B, and Sodium Nitroprusside (SNP)
3.3. A19mut2 Showed Similar Residual Virulence Compared to the A19 Strain
3.4. A19mut2 Induced Humoral- and Cellular-Mediated Immune Response
3.5. Vaccination with A19mut2 Confers a Similar Protection to A19 Immunization in a Mice Model
3.6. A19mut2-Immunized Mice Can Be Discriminated from A19 Immunization via LPS-Coated ELISA
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Xie, J.; Wang, J.; Li, Z.; Wang, W.; Pang, Y.; He, Y. Ontology-based meta-analysis of animal and human adverse events associated with licensed Brucellosis vaccines. Front. Pharmacol. 2018, 9, 503. [Google Scholar] [CrossRef]
- Zamri-Saad, M.; Kamarudin, M.I. Control of animal brucellosis: The Malaysian experience. Asian. Pac. J. Trop. Med. 2016, 9, 1136–1140. [Google Scholar] [CrossRef] [PubMed]
- Yang, J.; He, C.; Zhang, H.; Liu, M.; Zhao, H.; Ren, L.; Wu, D.; Du, F.; Liu, B.; Han, X.; et al. Evaluation and differential diagnosis of a genetic marked Brucella vaccine A19ΔvirB12 for cattle. Front. Immunol. 2021, 12, 679560. [Google Scholar] [CrossRef] [PubMed]
- Perkins, S.D.; Smither, S.J.; Atkins, H.S. Towards a Brucella vaccine for humans. FEMS Microbiol. Rev. 2010, 34, 379–394. [Google Scholar] [CrossRef] [PubMed]
- Grillo, M.J.; Marin, C.M.; Barberan, M.; de Miguel, M.J.; Laroucau, K.; Jacques, I.; Blasco, J.M. Efficacy of bp26 and bp26/omp31 B. melitensis Rev.1 deletion mutants against Brucella ovis in rams. Vaccine 2009, 27, 187–191. [Google Scholar] [CrossRef]
- Aragon-Aranda, B.; de Miguel, M.J.; Martinez-Gomez, E.; Zuniga-Ripa, A.; Salvador-Bescos, M.; Moriyon, I.; Iriarte, M.; Munoz, P.M.; Conde-Alvarez, R. Rev1 wbdR tagged vaccines against Brucella ovis. Vet. Res. 2019, 50, 95. [Google Scholar] [CrossRef]
- Tian, M.; Qu, J.; Li, P.; Bao, Y.; Liu, J.; Ding, C.; Wang, S.; Li, T.; Qi, J.; Yu, S. Identification of novel genes essential for Brucella abortus to establish infection by signature-tagged mutagenesis. Vet. Microbiol. 2019, 230, 130–137. [Google Scholar] [CrossRef]
- Tian, M.; Yin, Y.; Lian, Z.; Li, Z.; Song, M.; Hu, H.; Guan, X.; Ding, C.; Wang, S.; Li, T.; et al. A rough Brucella mutant induced macrophage death depends on secretion activity of T4SS, but not on cellular Txnip- and Caspase-2-mediated signaling pathway. Vet. Microbiol. 2020, 244, 108648. [Google Scholar] [CrossRef]
- Tian, M.; Lian, Z.; Bao, Y.; Bao, S.; Yin, Y.; Li, P.; Ding, C.; Wang, S.; Li, T.; Qi, J.; et al. Identification of a novel, small, conserved hypothetical protein involved in Brucella abortus virulence by modifying the expression of multiple genes. Transbound. Emerg. Dis. 2019, 66, 349–362. [Google Scholar] [CrossRef]
- Salvador-Bescos, M.; Gil-Ramirez, Y.; Zuniga-Ripa, A.; Martinez-Gomez, E.; de Miguel, M.J.; Munoz, P.M.; Cloeckaert, A.; Zygmunt, M.S.; Moriyon, I.; Iriarte, M.; et al. WadD, a new Brucella lipopolysaccharide core glycosyltransferase identified by genomic search and phenotypic characterization. Front. Microbiol. 2018, 9, 2293. [Google Scholar] [CrossRef]
- Garin-Bastuji, B.; Bowden, R.A.; Dubray, G.; Limet, J.N. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis and immunoblotting analysis of smooth-lipopolysaccharide heterogeneity among Brucella biovars related to A and M specificities. J. Clin. Microbiol. 1990, 28, 2169–2174. [Google Scholar] [CrossRef]
- Kahl-McDonagh, M.M.; Ficht, T.A. Evaluation of protection afforded by Brucella abortus and Brucella melitensis unmarked deletion mutants exhibiting different rates of clearance in BALB/c mice. Infect. Immun. 2006, 74, 4048–4057. [Google Scholar] [CrossRef]
- Poveda-Urkixo, I.; Ramirez, G.A.; Grillo, M.J. Kinetics of placental infection by different smooth Brucella strains in mice. Pathogens 2022, 11, 279. [Google Scholar] [CrossRef]
- Truong, Q.L.; Cho, Y.; Park, S.; Kim, K.; Hahn, T.W. Brucella abortus ΔcydCΔcydD and ΔcydCΔpurD double-mutants are highly attenuated and confer long-term protective immunity against virulent Brucella abortus. Vaccine 2016, 34, 237–244. [Google Scholar] [CrossRef]
- Arenas-Gamboa, A.M.; Ficht, T.A.; Kahl-McDonagh, M.M.; Rice-Ficht, A.C. Immunization with a single dose of a microencapsulated Brucella melitensis mutant enhances protection against wild-type challenge. Infect. Immun. 2008, 76, 2448–2455. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Yin, S.; Guo, F.; Meng, R.; Chen, C.; Zhang, H.; Li, Z.; Fu, Q.; Shi, H.; Hu, S.; et al. A potent Brucella abortus 2308Δery live vaccine allows for the differentiation between natural and vaccinated infection. J. Microbiol. 2014, 52, 681–688. [Google Scholar] [CrossRef]
- Zhang, J.; Guo, F.; Chen, C.; Li, Z.; Zhang, H.; Wang, Y.; Zhang, K.; Du, G.; Li, Y.; Wang, J.; et al. Brucella melitensis 16MΔhfq attenuation confers protection against wild-type challenge in BALB/c mice. Microbiol. Immunol. 2013, 57, 502–510. [Google Scholar] [CrossRef] [PubMed]
- Masjedian Jezi, F.; Razavi, S.; Mirnejad, R.; Zamani, K. Immunogenic and protective antigens of Brucella as vaccine candidates. Comp. Immunol. Microbiol. Infect. Dis. 2019, 65, 29–36. [Google Scholar] [CrossRef] [PubMed]
- Cardoso, P.G.; Macedo, G.C.; Azevedo, V.; Oliveira, S.C. Brucella spp. noncanonical LPS: Structure, biosynthesis, and interaction with host immune system. Microb. Cell. Fact. 2006, 5, 13. [Google Scholar] [CrossRef] [PubMed]
- Martinez-Gomez, E.; Stahle, J.; Gil-Ramirez, Y.; Zuniga-Ripa, A.; Zaccheus, M.; Moriyon, I.; Iriarte, M.; Widmalm, G.; Conde-Alvarez, R. Genomic insertion of a heterologous acetyltransferase generates a new lipopolysaccharide antigenic structure in Brucella abortus and Brucella melitensis. Front. Microbiol. 2018, 9, 1092. [Google Scholar] [CrossRef]
- Xiong, X.; Li, B.; Zhou, Z.; Gu, G.; Li, M.; Liu, J.; Jiao, H. The VirB system plays a crucial role in Brucella intracellular infection. Int. J. Mol. Sci. 2021, 22, 13637. [Google Scholar] [CrossRef]
- Truong, Q.L.; Cho, Y.; Park, S.; Park, B.K.; Hahn, T.W. Brucella abortus mutants lacking ATP-binding cassette transporter proteins are highly attenuated in virulence and confer protective immunity against virulent B. abortus challenge in BALB/c mice. Microb. Pathog. 2016, 95, 175–185. [Google Scholar] [CrossRef]
- Li, Z.; Wang, S.; Zhang, J.; Yang, G.; Yuan, B.; Huang, J.; Han, J.; Xi, L.; Xiao, Y.; Chen, C.; et al. Brucella abortus 2308ΔNodVΔNodW double-mutant is highly attenuated and confers protection against wild-type challenge in BALB/c mice. Microb. Pathog. 2017, 106, 30–39. [Google Scholar] [CrossRef]
- Skendros, P.; Boura, P. Immunity to brucellosis. Rev. Sci. Tech. 2013, 32, 137–147. [Google Scholar] [CrossRef] [PubMed]
- Montaraz, J.A.; Winter, A.J.; Hunter, D.M.; Sowa, B.A.; Wu, A.M.; Adams, L.G. Protection against Brucella abortus in mice with O-polysaccharide-specific monoclonal antibodies. Infect. Immun. 1986, 51, 961–963. [Google Scholar] [CrossRef] [PubMed]
- Phillips, M.; Deyoe, B.L.; Canning, P.C. Protection of mice against Brucella abortus infection by inoculation with monoclonal antibodies recognizing Brucella O-antigen. Am. J. Vet. Res. 1989, 50, 2158–2161. [Google Scholar] [PubMed]








| Names | Description | Source |
|---|---|---|
| Bacterial strains | ||
| S2308 | B. abortus wild-type strain 2308; smooth phenotype | CVCC a |
| S2308 NalR | B. abortus wild-type strain 2308 with nalidixic acid resistance; smooth phenotype | [7] |
| RB14 | S2308 derived rough-type mutant with rfbE deletion; rough phenotype | [8] |
| A19 | B. abortus vaccine strain A19; smooth phenotype | CVCC |
| A19mut2 | A19 derived mutant with wbkC replaced by wbdR; smooth phenotype | This study b |
| E. coli DH5α | F−φ80lacZ∆M15∆(lacZYA-argF)U169 recA1 endA1 hsdR17(rk−,mk+) phoA supE44 thi-1 gyrA96 relA1 λ− | TIANGEN c |
| Plasmids | ||
| pKB | pUC19-derived suicide plasmid containing sacB gene; KanR; | [9] |
| pKB-ΔwbkC::wbdR | pKB containing the upstream and downstream fragments of the wbkC gene; the wbkC gene was replaced by the wbdR gene | This study b |
| Primers | ||
| WbkC-F | GGTACCCGGGGATCCTGATGGCAGGGTAGAAGACG | This study d |
| WbkC-R | TGCCTGCAGGTCGACCGTCTTCAAGTGCTGCTCAG | This study d |
| rWbkC-R | TTAAAATGCCTCTTTTTCGTCA | This study d |
| rWbkC-F | AATGGCTTGTTGCTTGTTTAGG | This study d |
| WbdR-F | AAAGAGGCATTTTAAAGAAGTTCGCCACAGTAAATCGAA | This study e |
| WbdR-R | AAGCAACAAGCCATTTTAAATAGATGTTGGCGATCTT | This study e |
| ID-F1 | GATCCCGGTTGTTGATGACG | This study d |
| ID-R1 | GCCCCAGGAGCAAATGTAAC | This study e |
| ID-R2 | GGAAGAAGCGACGGATGAAG | This study d |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Abdelgawad, H.A.; Lian, Z.; Yin, Y.; Fang, T.; Tian, M.; Yu, S. Characterization of Brucella abortus Mutant A19mut2, a Potential DIVA Vaccine Candidate with a Modification on Lipopolysaccharide. Vaccines 2023, 11, 1273. https://doi.org/10.3390/vaccines11071273
Abdelgawad HA, Lian Z, Yin Y, Fang T, Tian M, Yu S. Characterization of Brucella abortus Mutant A19mut2, a Potential DIVA Vaccine Candidate with a Modification on Lipopolysaccharide. Vaccines. 2023; 11(7):1273. https://doi.org/10.3390/vaccines11071273
Chicago/Turabian StyleAbdelgawad, Hosny Ahmed, Zhengmin Lian, Yi Yin, Tian Fang, Mingxing Tian, and Shengqing Yu. 2023. "Characterization of Brucella abortus Mutant A19mut2, a Potential DIVA Vaccine Candidate with a Modification on Lipopolysaccharide" Vaccines 11, no. 7: 1273. https://doi.org/10.3390/vaccines11071273
APA StyleAbdelgawad, H. A., Lian, Z., Yin, Y., Fang, T., Tian, M., & Yu, S. (2023). Characterization of Brucella abortus Mutant A19mut2, a Potential DIVA Vaccine Candidate with a Modification on Lipopolysaccharide. Vaccines, 11(7), 1273. https://doi.org/10.3390/vaccines11071273

