Deletion of Two Genes in Burkholderia pseudomallei MSHR668 That Target Essential Amino Acids Protect Acutely Infected BALB/c Mice and Promote Long Term Survival
Abstract
1. Introduction
2. Materials and Methods
2.1. Bacterial Strains, Plasmids, Primers, and Growth Conditions
2.2. DNA Manipulation
2.3. PCR Amplifications
2.4. Plasmid Conjugations
2.5. Construction of B. Pseudomallei Mutants
2.6. Animals and Vaccinations
2.7. Animal Challenges
2.8. Antibody Determination
2.9. Spleen Cell Preparation
2.10. Stimulation of Splenocytes and interferon (IFN)-γ Expression
2.11. Statistical Analyses
3. Results
3.1. Initial Vaccination Studies with Mutations Made in B. pseudomallei MSHR668
3.2. Comparison of 668 ∆hisF, 668 ∆ilvI, and Other MSHR668 Deletion Derivatives as Live Attenuated Vaccines
3.3. Inactivated Whole-Cell B. Pseudomallei Vaccine Candidates
3.4. Stimulation of Splenocytes from Whole-Cell Vaccinated Mice Shows the Development of a Cell-Mediated Acquired Immune Response to B. pseudomallei
3.5. B. pseudomallei 668 ∆hisF Is Highly Attenuated in NOD/SCID Mice
4. Discussion
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Limmathurotsakul, D.; Golding, N.; Dance, D.A.B.; Messina, J.P.; Pigott, D.M.; Moyes, C.L.; Rolim, D.B.; Bertherat, E.; Day, N.P.J.; Peacock, S.J.; et al. Predicted global distribution of Burkholderia pseudomallei and burden of melioidosis. Nat. Microbiol. 2016, 1, 15008. [Google Scholar] [CrossRef]
- Currie, B.J.; Fisher, D.A.; Howard, D.M.; Burrow, J.N.; Lo, D.; Selva-Nayagam, S.; Anstey, N.M.; Huffam, S.E.; Snelling, P.L.; Marks, P.J.; et al. Endemic melioidosis in tropical northern Australia: A 10-year prospective study and review of the literature. Clin. Infect. Dis. 2000, 31, 981–986. [Google Scholar] [CrossRef] [PubMed]
- Limmathurotsakul, D.; Wongratanacheewin, S.; Teerawattanasook, N.; Wongsuvan, G.; Chaisuksant, S.; Chetchotisakd, P.; Chaowagul, W.; Day, N.P.; Peacock, S.J. Increasing incidence of human melioidosis in Northeast Thailand. Am. J. Trop. Med. Hyg. 2010, 82, 1113–1117. [Google Scholar] [CrossRef] [PubMed]
- Currie, B.J.; Jacups, S.P.; Cheng, A.C.; Fisher, D.A.; Anstey, N.M.; Huffam, S.E.; Krause, V.L. Melioidosis epidemiology and risk factors from a prospective whole-population study in northern Australia. Trop. Med. Int. Health 2004, 9, 1167–1174. [Google Scholar] [CrossRef] [PubMed]
- Suputtamongkol, Y.; Chaowagul, W.; Chetchotisakd, P.; Lertpatanasuwun, N.; Intaranongpai, S.; Ruchutrakool, T.; Budhsarawong, D.; Mootsikapun, P.; Wuthiekanun, V.; Teerawatasook, N.; et al. Risk factors for melioidosis and bacteremic melioidosis. Clin. Infect. Dis. 1999, 29, 408–413. [Google Scholar] [CrossRef] [PubMed]
- Webb, J.R.; Sarovich, D.S.; Price, E.P.; Ward, L.M.; Mayo, M.; Currie, B.J. Burkholderia pseudomallei Lipopolysaccharide Genotype Does Not Correlate with Severity or Outcome in Melioidosis: Host Risk Factors Remain the Critical Determinant. In Open Forum Infectious Diseases; Oxford University Press: New York, NY, USA, 2019; Volume 6. [Google Scholar]
- Cheng, A.C.; Currie, B.J. Melioidosis: Epidemiology, pathophysiology, and management. Clin. Microbiol. Rev. 2005, 18, 383–416. [Google Scholar] [CrossRef] [PubMed]
- Wiersinga, W.J.; Currie, B.J.; Peacock, S.J. Melioidosis. N. Engl. J. Med. 2012, 367, 1035–1044. [Google Scholar] [CrossRef]
- Dance, D.A.; Wuthiekanun, V.; Chaowagul, W.; White, N.J. The antimicrobial susceptibility of Pseudomonas pseudomallei. Emergence of resistance in vitro and during treatment. J. Antimicrob. Chemother. 1989, 24, 295–309. [Google Scholar] [CrossRef]
- Rhodes, K.A.; Schweizer, H.P. Antibiotic resistance in Burkholderia species. Drug Resist. Updates 2016, 28, 82–90. [Google Scholar] [CrossRef]
- Wuthiekanun, V.; Amornchai, P.; Saiprom, N.; Chantratita, N.; Chierakul, W.; Koh, G.C.; Chaowagul, W.; Day, N.P.; Limmathurotsakul, D.; Peacock, S.J. Survey of antimicrobial resistance in clinical Burkholderia pseudomallei isolates over two decades in Northeast Thailand. Antimicrob. Agents Chemother. 2011, 55, 5388–5391. [Google Scholar] [CrossRef]
- Titball, R.W.; Burtnick, M.N.; Bancroft, G.J.; Brett, P.J. Burkholderia pseudomallei and Burkholderia mallei vaccines: Are we close to clinical trials? Vaccine 2017, 35, 5981–5989. [Google Scholar] [CrossRef] [PubMed]
- Limmathurotsakul, D.; Funnell, S.G.; Torres, A.G.; Morici, L.A.; Brett, P.J.; Dunachie, S.; Atkins, T.; Altmann, D.M.; Bancroft, G.; Peacock, S.J. Consensus on the development of vaccines against naturally acquired melioidosis. Emerg. Infect. Dis. 2015, 21, e141480. [Google Scholar] [CrossRef] [PubMed]
- Trevino, S.R.; Klimko, C.P.; Reed, M.C.; Aponte-Cuadrado, M.J.; Hunter, M.; Shoe, J.L.; Meyer, J.R.; Dankmeyer, J.L.; Biryukov, S.S.; Quirk, A.V.; et al. Disease progression in mice exposed to low-doses of aerosolized clinical isolates of Burkholderia pseudomallei. PLoS ONE 2018, 13, e0208277. [Google Scholar] [CrossRef]
- Norris, M.H.; Schweizer, H.P.; Tuanyok, A. Structural diversity of Burkholderia pseudomallei lipopolysaccharides affects innate immune signaling. PLoS Negl. Trop. Dis. 2017, 11, e0005571. [Google Scholar] [CrossRef]
- Tuanyok, A.; Stone, J.K.; Mayo, M.; Kaestli, M.; Gruendike, J.; Georgia, S.; Warrington, S.; Mullins, T.; Allender, C.J.; Wagner, D.M.; et al. The genetic and molecular basis of O-antigenic diversity in Burkholderia pseudomallei lipopolysaccharide. PLoS Negl. Trop. Dis. 2012, 6, e1453. [Google Scholar] [CrossRef]
- Welkos, S.L.; Klimko, C.P.; Kern, S.J.; Bearss, J.J.; Bozue, J.A.; Bernhards, R.C.; Trevino, S.R.; Waag, D.M.; Amemiya, K.; Worsham, P.L.; et al. Characterization of Burkholderia pseudomallei strains using a murine intraperitoneal infection model and in vitro macrophage assays. PLoS ONE 2015, 10, e0124667. [Google Scholar] [CrossRef]
- Simon, R.; Priefer, U.; Puhler, A. A broad host range mobilization system for in vivo genetic engineering: Tranposon mutagenesis in gram negative bacteria. Bio/Technology 1983, 1, 784–791. [Google Scholar] [CrossRef]
- Atkins, T.; Prior, R.G.; Mack, K.; Russell, P.; Nelson, M.; Oyston, P.C.; Dougan, G.; Titball, R.W. A mutant of Burkholderia pseudomallei, auxotrophic in the branched chain amino acid biosynthetic pathway, is attenuated and protective in a murine model of melioidosis. Infect. Immun. 2002, 70, 5290–5294. [Google Scholar] [CrossRef]
- Holden, M.T.; Titball, R.W.; Peacock, S.J.; Cerdeno-Tarraga, A.M.; Atkins, T.; Crossman, L.C.; Pitt, T.; Churcher, C.; Mungall, K.; Bentley, S.D.; et al. Genomic plasticity of the causative agent of melioidosis, Burkholderia pseudomallei. Proc. Natl. Acad. Sci. USA 2004, 101, 14240–14245. [Google Scholar] [CrossRef]
- Tuanyok, A.; Leadem, B.R.; Auerbach, R.K.; Beckstrom-Sternberg, S.M.; Beckstrom-Sternberg, J.S.; Mayo, M.; Wuthiekanun, V.; Brettin, T.S.; Nierman, W.C.; Peacock, S.J.; et al. Genomic islands from five strains of Burkholderia pseudomallei. BMC Genom. 2008, 9, 566. [Google Scholar] [CrossRef]
- Propst, K.L.; Mima, T.; Choi, K.H.; Dow, S.W.; Schweizer, H.P. A Burkholderia pseudomallei ∆purM mutant is avirulent in immunocompetent and immunodeficient animals: Candidate strain for exclusion from select-agent lists. Infect. Immun. 2010, 78, 3136–3143. [Google Scholar] [CrossRef]
- Burtnick, M.N.; Brett, P.J.; DeShazer, D. Proteomic analysis of the Burkholderia pseudomallei type II secretome reveals hydrolytic enzymes, novel proteins, and the deubiquitinase TssM. Infect. Immun. 2014, 82, 3214–3226. [Google Scholar] [CrossRef] [PubMed]
- Sim, B.M.Q.; Chantratita, N.; Ooi, W.F.; Nandi, T.; Tewhey, R.; Wuthiekanun, V.; Thaipadungpanit, J.; Tumapa, S.; Ariyaratne, P.; Sung, W.K.; et al. Genomic acquisition of a capsular polysaccharide virulence cluster by non-pathogenic Burkholderia isolates. Genome Biol. 2010, 11, R89. [Google Scholar] [CrossRef]
- Ulrich, R.L.; Amemiya, K.; Waag, D.M.; Roy, C.J.; DeShazer, D. Aerogenic vaccination with a Burkholderia mallei auxotroph protects against aerosol-initiated glanders in mice. Vaccine 2005, 23, 1986–1992. [Google Scholar] [CrossRef] [PubMed]
- Hamad, M.A.; Zajdowicz, S.L.; Holmes, R.K.; Voskuil, M.I. An allelic exchange system for compliant genetic manipulation of the select agents Burkholderia pseudomallei and Burkholderia mallei. Gene 2009, 430, 123–131. [Google Scholar] [CrossRef] [PubMed]
- Burtnick, M.N.; Brett, P.J.; Harding, S.V.; Ngugi, S.A.; Ribot, W.J.; Chantratita, N.; Scorpio, A.; Milne, T.S.; Dean, R.E.; Fritz, D.L.; et al. The cluster 1 type VI secretion system is a major virulence determinant in Burkholderia pseudomallei. Infect. Immun. 2011, 79, 1512–1525. [Google Scholar] [CrossRef] [PubMed]
- Schell, M.A.; Ulrich, R.L.; Ribot, W.J.; Brueggemann, E.E.; Hines, H.B.; Chen, D.; Lipscomb, L.; Kim, H.S.; Mrázek, J.; Nierman, W.C.; et al. Type VI secretion is a major virulence determinant in Burkholderia mallei. Mol. Microbiol. 2007, 64, 1466–1485. [Google Scholar] [CrossRef] [PubMed]
- López, C.M.; Rholl, D.A.; Trunck, L.A.; Schweizer, H.P. Versatile dual-technology system for markerless allele replacement in Burkholderia pseudomallei. Appl. Environ. Microbiol. 2009, 75, 6496–6503. [Google Scholar] [CrossRef]
- Biggins, J.B.; Kang, H.S.; Ternei, M.A.; DeShazer, D.; Brady, S.F. The chemical arsenal of Burkholderia pseudomallei is essential for pathogenicity. J. Am. Chem. Soc. 2014, 136, 9484–9490. [Google Scholar] [CrossRef]
- Bosma, G.C.; Custer, R.P.; Bosma, M.J. A severe combined immunodeficiency mutation in the mouse. Nature 1983, 301, 527–530. [Google Scholar] [CrossRef]
- Bosma, M.J.; Carroll, A.M. The SCID mouse mutant: Definition, characterization, and potential uses. Annu. Rev. Immunol. 1991, 9, 323–350. [Google Scholar] [CrossRef] [PubMed]
- Shultz, L.D.; Schweitzer, P.A.; Christianson, S.W.; Gott, B.; Schweitzer, I.B.; Tennent, B.; McKenna, S.; Mobraaten, L.; Rajan, T.V.; Greiner, D.L. Multiple defects in innate and adaptive immunologic function in NOD/LtSz-scid mice. J. Immunol. 1995, 154, 180–191. [Google Scholar] [PubMed]
- Amemiya, K.; Bush, G.V.; DeShazer, D.; Waag, D.M. Nonviable Burkholderia mallei induces a mixed Th1- and Th2-like cytokine response in BALB/c mice. Infect. Immun. 2002, 70, 2319–2325. [Google Scholar] [CrossRef] [PubMed]
- Amemiya, K.; Meyers, J.L.; Trevino, S.R.; Chanh, T.C.; Norris, S.L.; Waag, D.M. Interleukin-12 induces a Th1-like response to Burkholderia mallei and limited protection in BALB/c mice. Vaccine 2006, 24, 1413–1420. [Google Scholar] [CrossRef] [PubMed]
- Scott, A.E.; Laws, T.R.; D’Elia, R.V.; Stokes, M.G.; Nandi, T.; Williamson, E.D.; Tan, P.; Prior, J.L.; Atkins, T.P. Protection against experimental melioidosis following immunization with live Burkholderia thailandensis expressing a manno-heptose capsule. Clin. Vaccine Immunol. 2013, 20, 1041–1047. [Google Scholar] [CrossRef] [PubMed]
- Brett, P.J.; Mah, D.C.W.; Woods, D.E. Isolation and characterization of Pseudomonas pseudomallei flagellin proteins. Immun. Infect. 1994, 62, 1914–1919. [Google Scholar]
- Pilatz, S.; Breitbach, K.; Hein, N.; Fehlhaber, B.; Schulze, J.; Brenneke, B.; Eberl, L.; Steinmetz, I. Identification of Burkholderia pseudomallei genes required for the intracellular life cycle and in vivo virulence. Infect. Immun. 2006, 74, 3576–3586. [Google Scholar] [CrossRef]
- Biggins, J.B.; Liu, X.; Feng, Z.; Brady, S.F. Metabolites from the induced expression of cryptic single operons found in the genome of Burkholderia pseudomallei. J. Am. Chem. Soc. 2011, 133, 1638–1641. [Google Scholar] [CrossRef]
- Hopf, V.; Göhler, A.; Eske-Pogodda, K.; Bast, A.; Steinmetz, I.; Breitbach, K. BPSS1504, a cluster 1 type VI secretion gene, is involved in intracellular survival and virulence of Burkholderia pseudomallei. Infect. Immun. 2014, 82, 2006–2015. [Google Scholar] [CrossRef]
- Woo, P.C.; Leung, P.K.; Wong, S.S.; Ho, P.L.; Yuen, K.Y. groEL encodes a highly antigenic protein in Burkholderia pseudomallei. Clin. Diagn. Lab. Immunol. 2001, 8, 832–836. [Google Scholar] [CrossRef]
- Amemiya, K.; Meyers, J.L.; DeShazer, D.; Riggins, R.N.; Halasohoris, S.; England, M.; Ribot, W.; Norris, S.L.; Waag, D.M. Detection of the host immune response to Burkholderia mallei heat-shock proteins GroEL and DnaK in a glanders patient and infected mice. Diagn. Microbiol. Infect. Dis. 2007, 59, 137–147. [Google Scholar] [CrossRef] [PubMed]
- Santanirand, P.; Harley, V.S.; Dance, D.A.; Drasar, B.S.; Bancroft, G.J. Obligatory role of gamma interferon for host survival in a murine model of infection with Burkholderia pseudomallei. Infect. Immun. 1999, 67, 3593–6000. [Google Scholar] [PubMed]
- Tippayawat, P.; Saenwongsa, W.; Mahawantung, J.; Suwannasaen, D.; Chetchotisakd, P.; Limmathurotsakul, D.; Peacock, S.; Felgner, P.L.; Atkins, H.S.; Titball, R.W.; et al. Phenotypic and functional characterization of human memory T cell responses to Burkholderia pseudomallei. PLoS Negl. Trop. Dis. 2009, 3, e407. [Google Scholar] [CrossRef] [PubMed]
- Kulis-Horn, R.K.; Persicke, M.; Kalinowski, J. Histidine biosynthesis, its regulation and biotechnological application in Corynebacterium glutamicum. Microb. Biotechnol. 2014, 7, 5–25. [Google Scholar] [CrossRef] [PubMed]
- Winkler, M.E.; Ramos-Montañez, S. Biosynthesis of histidine. EcoSal Plus 2009, 3. [Google Scholar] [CrossRef] [PubMed]
- Johnson, M.S.; Taylor, B.L. Comparison of methods for specific depletion of ATP in Salmonella typhimurium. Appl. Environ. Microbiol. 1993, 59, 3509–3512. [Google Scholar]
- Klem, T.J.; Davisson, V.J. Imidazole glycerol phosphate synthase: The glutamine amidotransferase in histidine biosynthesis. Biochemistry 1993, 32, 5177–5186. [Google Scholar] [CrossRef]
- Franco, T.A.M.; Blanchard, J.S. Bacterial branched-chain amino acid biosynthesis: Structures, mechanisms, and drugability. Biochemistry 2017, 56, 5849–5865. [Google Scholar] [CrossRef]
- Gedi, V.; Yoon, M.Y. Bacterial acetohydroxyacid synthase and its inhibitors—A summary of their structure, biological activity and current status. FEBS J. 2012, 279, 946–963. [Google Scholar] [CrossRef]
- Liu, Y.; Li, Y.; Wang, X. Acetohydroxyacid synthases: Evolution, structure, and function. Appl. Microbiol. Biotechnol. 2016, 100, 8633–8649. [Google Scholar] [CrossRef]
- Kreisberg, J.F.; Ong, N.T.; Krishna, A.; Joseph, T.L.; Wang, J.; Ong, C.; Ooi, H.A.; Sung, J.C.; Siew, C.C.; Chang, G.C.; et al. Growth inhibition of pathogenic bacteria by sulfonylurea herbicides. Antimicrob. Agents Chemother. 2013, 57, 1513–1517. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Eagle, H. The specific amino acid requirements of a mammalian cell (strain L) in tissue culture. J. Biol. Chem. 1955, 214, 839–852. [Google Scholar] [PubMed]
- McCoy, R.H.; Meyer, C.E.; Rose, W.C. Feeding experiments with mixtures of highly purified amino acids. VII. Isolation and identification of a new essential amino acid. J. Biol. Chem. 1935, 112, 282–302. [Google Scholar]
- Rose, W.C. Feeding experiments with mixtures of highly purified amino acids. I. The inadequacy of diets containing nineteen amino acids. J. Biol. Chem. 1931, 94, 155–165. [Google Scholar]
- Nieves, W.; Petersen, H.; Judy, B.M.; Blumentritt, C.A.; Russell-Lodrigue, K.; Roy, C.J.; Torres, A.G.; Morici, L.A. A Burkholderia pseudomallei outer membrane vesicle vaccine provides protection against lethal sepsis. Clin. Vaccine Immuol. 2014, 21, 747–754. [Google Scholar] [CrossRef]
- Baker, S.M.; Davitt, C.J.H.; Motyka, N.; Kikendall, N.L.; Russell-Lodrigue, K.; Roy, C.J.; Morici, L.A. A Burkholderia pseudomallei outer membrane vesicle vaccine provides cross protection against inhalational glanders in mice and non-human primates. Vaccines 2017, 5, 49. [Google Scholar] [CrossRef]
- Norris, M.H.; Khan, M.S.R.; Chirakul, S.; Schweizer, H.P.; Tuanyok, A. Outer membrane vesicle vaccines from biosafe surrogates prevent acute lethal glanders in mice. Vaccines 2018, 6, 5. [Google Scholar] [CrossRef]





| Strain, Plasmid or Primer | Relevant Characteristics * | Source or Reference |
|---|---|---|
| E. coli | ||
| E. cloni®10G | General cloning and blue/white screening | Lucigen |
| S17-1 | recA thi pro hsdR RP42Tc::MuKm::Tn7 integrated into the chromosome; Sm r, Tp r, Pm s | [18] |
| B. pseudomallei | ||
| 576 ∆ilvI | Original mutant was by transposon mutagenesis [19], for this study it was a derivative harboring a 1510-bp internal deletion of ilvI (∆ilvI) | [20] |
| K96243 | Isolated in 1996 from a 34-year-old female diabetic patient in Khon Kaen, Thailand; Gmr, Kmr, Smr, Pmr | This study |
| MSHR668 | Isolated in 1995 in Darwin, Australia from the blood of a 53-year-old male patient with severe melioidosis encephalomyelitis; Gm r, Km r, Sm r, Pm r | [21] |
| Bp82 | 1026b ∆purM derivative deficient in adenine | [22] |
| 668 ∆gspD | MSHR668 derivative harboring a 1476-bp gspD in-frame deletion mutation (∆gspD) | [23] |
| 668 ΔilvI | MSHR668 derivative harboring a 1510-bp internal deletion of ilvI (∆ilvI) | This study |
| 668 ∆gspD ΔilvI | 668 ∆gspD derivative harboring a 1510-bp internal deletion of ilvI (∆ilvI) | This study |
| 668 ΔsyrF | MSHR668 derivative harboring a 3463-bp deletion spanning syrE and 2608-bp at the 5′ end of syrF (ΔsyrF) | This study |
| 668 ∆gspD ΔsyrF | 668 ∆gspD derivative harboring a 3463-bp deletion spanning syrE and 2608-bp at the 5′ end of syrF (ΔsyrF) | This study |
| 668 ΔgltB | MSHR668 derivative harboring a 735-bp gltB in-frame deletion mutation (∆gltB) | This study |
| 668 ΔhisF | MSHR668 derivative harboring a 65-bp hisF deletion mutation (∆hisF) | This study |
| 668 ∆syrF ΔhisF | 668 ΔsyrF derivative harboring a 65-bp hisF deletion mutation (∆hisF) | This study |
| 668 ∆hisF ΔA0269 | 668 ΔhisF derivative harboring a 1314-bp in-frame BURPS668_A0269 deletion mutation (∆A0269) | This study |
| 668 ∆gspD ΔhisF | 668 ∆gspD derivative harboring a 65-bp hisF deletion mutation (∆hisF) | This study |
| 668 Δppc | MSHR668 derivative harboring a 702-bp ppc in-frame deletion mutation (∆ppc) | This study |
| B. thailandensis | ||
| E555 | Isolated from soil in Cambodia in 2005; possesses a B. pseudomallei-like capsular gene cluster | [24] |
| Plasmid | ||
| pCR2.1-TOPO | 3931-bp TA vector; pMB1 oriR; Km r, Apr | Life Technologies |
| pCR2.1-ΔilvI | pCR2.1-TOPO containing ΔilvI PCR product generated with pDD120 [25] and primers ILV1-Nh and ILV4-Nh | This study |
| pCR2.1-gltB | pCR2.1-TOPO containing PCR product generated with MSHR668 gDNA and primers gltB-up and gltB-dn | This study |
| pCR2.1-ΔgltB | pCR2.1-gltB with a deletion of the 735-bp SalI insert within gltB | This study |
| pCR2.1-hisF | pCR2.1-TOPO containing PCR product generated with MSHR668 gDNA and primers hisF-up and hisF-dn | This study |
| pCR2.1-ppc | pCR2.1-TOPO containing PCR product generated with MSHR668 gDNA and primers ppc-up and ppc-dn | This study |
| pCR2.1-A0269 | pCR2.1-TOPO containing PCR product generated with MSHR668 gDNA and primers A0269-up and A0269-dn | This study |
| pCR2.1-ΔA0269 | pCR2.1-A0269 with a deletion of the 1314-bp NruI fragment within BURPS668_A0269 | This study |
| pCR2.1-BpfliC | pCR2.1-TOPO containing PCR product generated with K96243 gDNA and primers BpfliC-up amd BpfliC-dn | This study |
| pMo130 | Suicide vector for allelic exchange in Burkholderia; ColE1 ori, RK2 oriT, xylE, sacB, Kmr | [26] |
| pMo130ΔNX | pMo130 digested with NotI and XbaI, blunt ended, and ligated to eliminate the NotI, PstI, BamHI and XbaI sites | [27] |
| pMo130-ΔilvI | pMo130 containing NheI insert from pCR2.1-ΔilvI | This study |
| pMo130-ΔgltB | pMo130 containing NheI insert from pCR2.1-ΔgltB | This study |
| pMo130-hisF | pMo130ΔNX containing NheI insert from pCR2.1-hisF | This study |
| pMo130-ΔhisF | pMo130-hisF digested with NruI and NotI resulting in a 65-bp deletion within hisF | This study |
| pMo130-ppc | pMo130ΔNX containing NheI insert from pCR2.1-ppc | This study |
| pMo130-Δppc | pMo130-ppc derivative containing a deletion of the 702-bp PstI insert within ppc | This study |
| pBHR2 | Broad-host-range plasmid; Kmr | [28] |
| pBHR2-BpfliC | pBHR2 containing NheI insert from pCR2.1-BpfliC in the XbaI site and oriented so that fliC is expressed from the constitutive Cm r promoter | This study |
| pEXKm5 | Gene replacement vector for B. pseudomallei; Kmr | [29] |
| pKOD | pEXKm5 harboring 1 kb of flanking DNA upstream and downstream of a 3463-bp deletion spanning syrE and 2608-bp at the 5′ end of syrF | [30] |
| Primers (5′−3′) | ||
| ILV1-Nh | GCTAGCTTGAGCGCCAACGCCAATGC | eurofins |
| ILV4-Nh | GCTAGCAGACCGACCGTCACGTTCAC | eurofins |
| gltB-up | GCTAGCGCTCGATGGGCAACGATTCG | eurofins |
| gltB-dn | GCTAGCGCCATCTTGATCTGGATCTG | eurofins |
| hisF-up | GCTAGCTGGCTCTAGCTAAACGCATC | eurofins |
| hisF-dn | GCTAGCTCACAACCTCACTGCAATGC | eurofins |
| ppc-up | GCTAGCATCTCGCGAGCATCGATTTG | eurofins |
| ppc-dn | GCTAGCCAACCGCGAGATCGGTCTTC | eurofins |
| A0269-up | GCTAGCCAATTCGAAGGCGGTCGTG | eurofins |
| A0269-dn | GCTAGCGGCGCAGTTCCTTGTTCAGC | eurofins |
| BpfliC-up | GCTAGCGCTCACCGAACGATCGACAC | eurofins |
| BpfliC-dn | GCTAGCTTTGCTGCTGCGTCGTGCTG | eurofins |
| Burkholderia Strain | Amount | Vacination a | Challenge Dose b | No. Survivors | MTD | Sterility/Survivors |
|---|---|---|---|---|---|---|
| Prime | Boost | (i.p.) | (After 30 Days) | (Days) c | Examined f | |
| 1. PBS control | na | na | 6.6 × 105 | 1/10 | 19.8 | na |
| 2. 668 ΔilvI | 4.7 × 105 | 1.2 × 106 | 6.6 × 105 | 10/10 | na | 4/4 |
| 3. 668 ΔgspD ΔilvI | 7.1 × 105 | 4.2 × 105 | 6.6 × 105 | 9/10 | 29 | 4/4 |
| 4. 668 ΔsyrF | 2.3 × 105 | 7.8 × 105 | 6.6 × 105 | 2/9d | 22.3 | 0/2 |
| 5. 668 ΔgspD ΔsyrF e | 4.7 × 105 | 9.9 × 105 | na | na | na | na |
| 6. 668 Δ ppc e | 1.0 × 105 | na | na | na | na | na |
| 7. 688 Δ gltB e | 1.0 × 105 | na | na | na | na | na |
| 8. E555 | 3.7 × 106 | 2.1 × 106 | 6.6 × 105 | 9/9 d | na | 3/4 |
| 9. E555 (pBHR2-BpfliC) | 2.3 × 106 | 2.2 × 106 | 6.6 × 105 | 9/9 d | na | 1/4 |
| Burkholderia Strain a | Antibody Titer b | Ratio IgG2a/IgG1 | ||
|---|---|---|---|---|
| IgG | IgG1 | IgG2a | ||
| PBS control | 50 (1.00) c | 50 (1.00) c | 450 (1.89) | na |
| 668 Δilvl | 18,798 (2.82) (p = 0.0288) d | 41,948 (3.22) (p = 0.0286) | 17,523 (2.08) (p = 0.0202) | 0.42 |
| 668 ΔgspD Δilvl | 39,102 (3.11) (p = 0.0276) | 37,144 (6.10) | 8424 (2.64) | 0.23 |
| 668 ΔsyrF | 2,528,449 (1.44) (p = 0.0009) | 584,911 (1.44) (p = 0.0012) | 1,756,334 (1.44) (p = 0.0011) | 3 |
| E555 | 194,704 (1.44) (p = 0.0016) | 135,000 (1.89) (p = 0060) | 125,843 (2.01) (p = 0.0040) | 0.93 |
| E555(pBHR2-BpfliC) | 64,901 (2.64) (p = 0.0175) | 194,970 (2.64) (p = 0.0132) | 39,102 (3.22) (p = 0.0421) | 0.2 |
| B. pseudomallei Vaccine Strain | Antibody Titer a | Ratio IgG2a/IgG1 | ||
|---|---|---|---|---|
| IgG | IgG1 | IgG2a | ||
| PBS (4) b | 50 (1.00) c | 50 (1.00) | 50 (1.00) | na |
| 576 ΔilvI (3) | 2722 (3.91) | 467 (1.93) | 1170 (4.90) | 2.51 |
| 668 ΔilvI (4) | 5350 (1.45) (p = 0.0009) d | 3377 (1.29) (p = 0.0003) | 4016 (1.28) (p = 0.0003) | 1.19 |
| 668 ΔhisF (4) | 5668 (1.31) (p =0.0009) | 6740 (1.59) (p = 0.0017) | 4766 (1.65) (p = 0.0026) | 0.71 |
| 668 ΔgspD ΔhisF (3) | 13,680 (2.47) (p = 0.0247) | 3175 (1.59) (p = 0.0112) | 8000 (4.80) | 2.52 |
| 668 ΔsyrF ΔhisF (3) | 14,775 (2.55) (p = 0.0256) | 16,000 (2.25) (p = 0.0188) | 2736 (2.57) | 0.17 |
| 668 ΔhisF ΔA0269 (4) | 23,926 (2.65) (p = 0.0079) | 5050 (p = 0.0015) | 5350 (p =0.0320) | 1.06 |
| Vaccine b,c | Antibody Titer a (IRBpK) | Ratio IgG2a/IgG1 | Antibody Titer a | |||
|---|---|---|---|---|---|---|
| (Hcp1) | (Hsp60) | |||||
| IgG | IgG1 | IgG2a | IgG | IgG | ||
| PBS | 53.0 (1.06) | 50.0 (1.00) d | 59.0 (1.12) | na | 50.0 (1.00) | 50.0 (1.00) |
| fBpK (50 μg) | 1903 (1.19) (p <0.0001) e | 1008 (1.18) (p =0.0001) | 224 (1.43) (p = 0.0292) | 0.22 | 50.0 (1.00) | 50.0 (1.00) |
| IRBpK (50 μg) | 75,361 (1.87) (p = 0.0013) | 142,544 (3.41) (p = 0.0074) | 6362 (1.63) (p = 0.0017) | 0.04 | 59.5 (1.19) | 1008 (1.51) (p = 0.0049) |
| fBpK (50 μg) + IRBpK (50μg) | 79,842 (1.38) (p = 0.0001) | 63,496 (1.73) (p = 0.0029) | 10,679 (1.65) (p = 0.0014) | 0.17 | 63.0 (1.18) | 7551 (1.29) (p = 0.0002) |
| 668 ΔhisF ΔA0269 (1 × 106 CFU) | 8016 (2.01) (p = 0.0053) | 4490 (1.27) (p = 0.0002) | 1692 (1.84) (p = 0.0107) | 0.38 | 2834 (1.43) (p = 0.0013) | 5053 (1.46) (p = 0.0149) |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Amemiya, K.; Dankmeyer, J.L.; Biryukov, S.S.; Treviño, S.R.; Klimko, C.P.; Mou, S.M.; Fetterer, D.P.; Garnes, P.G.; Cote, C.K.; Worsham, P.L.; et al. Deletion of Two Genes in Burkholderia pseudomallei MSHR668 That Target Essential Amino Acids Protect Acutely Infected BALB/c Mice and Promote Long Term Survival. Vaccines 2019, 7, 196. https://doi.org/10.3390/vaccines7040196
Amemiya K, Dankmeyer JL, Biryukov SS, Treviño SR, Klimko CP, Mou SM, Fetterer DP, Garnes PG, Cote CK, Worsham PL, et al. Deletion of Two Genes in Burkholderia pseudomallei MSHR668 That Target Essential Amino Acids Protect Acutely Infected BALB/c Mice and Promote Long Term Survival. Vaccines. 2019; 7(4):196. https://doi.org/10.3390/vaccines7040196
Chicago/Turabian StyleAmemiya, Kei, Jennifer L. Dankmeyer, Sergei S. Biryukov, Sylvia R. Treviño, Christopher P. Klimko, Sherry M. Mou, David P. Fetterer, Preston G. Garnes, Christopher K. Cote, Patricia L. Worsham, and et al. 2019. "Deletion of Two Genes in Burkholderia pseudomallei MSHR668 That Target Essential Amino Acids Protect Acutely Infected BALB/c Mice and Promote Long Term Survival" Vaccines 7, no. 4: 196. https://doi.org/10.3390/vaccines7040196
APA StyleAmemiya, K., Dankmeyer, J. L., Biryukov, S. S., Treviño, S. R., Klimko, C. P., Mou, S. M., Fetterer, D. P., Garnes, P. G., Cote, C. K., Worsham, P. L., & DeShazer, D. (2019). Deletion of Two Genes in Burkholderia pseudomallei MSHR668 That Target Essential Amino Acids Protect Acutely Infected BALB/c Mice and Promote Long Term Survival. Vaccines, 7(4), 196. https://doi.org/10.3390/vaccines7040196
