Application of HDR-CRISPR/Cas9 and Erythrocyte Binding for Rapid Generation of Recombinant Turkey Herpesvirus-Vectored Avian Influenza Virus Vaccines
Abstract
1. Introduction
2. Materials and Methods
2.1. Virus, Cell, and Transfection
2.2. Construction of gRNA and Donor Plasmids
2.3. HDR-CRISPR/Cas9-Mediated Gene Insertion
2.4. HVT Genome Extraction
2.5. Chicken Red Blood Cell Hemadsorption Assay
2.6. Immunostaining Assays for H7 HA Antigen Detection
2.7. Indirect Immunofluorescence Assay (IFA)
2.8. Western Blot
2.9. Statistical Analysis
3. Results
3.1. Optimization of HDR-CRISPR/Cas9 for Gene Knock-in to HVT
3.2. HDR-CRISPR/Cas9 Knock-in of H7N9 HA into HVT
3.3. Selection of Recombinant HVT–H7HA by Erythrocyte Binding
3.4. Characterization of Recombinant HVT–H7HA
4. Discussion
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Horimoto, T.; Kawaoka, Y. Pandemic threat posed by avian influenza A viruses. Clin. Microbiol. Rev. 2001, 14, 129–149. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Richard-Mazet, A.; Goutebroze, S.; Le Gros, F.X.; Swayne, D.E.; Bublot, M. Immunogenicity and efficacy of fowlpox-vectored and inactivated avian influenza vaccines alone or in a prime-boost schedule in chickens with maternal antibodies. Vet. Res. 2014, 45, 107. [Google Scholar] [CrossRef] [PubMed]
- Bertran, K.; Lee, D.H.; Criado, M.F.; Balzli, C.L.; Killmaster, L.F.; Kapczynski, D.R.; Swayne, D.E. Maternal antibody inhibition of recombinant Newcastle disease virus vectored vaccine in a primary or booster avian influenza vaccination program of broiler chickens. Vaccine 2018, 36, 6361–6372. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kawamura, H.; King, D.J., Jr.; Anderson, D.P. A herpesvirus isolated from kidney cell culture of normal turkeys. Avian Dis. 1969, 13, 853–863. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Prasad, L.B. Effect of maternal antibody on viraemic and antibody responses to cell-associated and cell-free turkey herpesvirus in chickens. Br. Vet. J. 1978, 134, 315–321. [Google Scholar] [CrossRef] [Scilit]
- Sharma, J.M.; Burmester, B.R. Resistance to Marek’s disease at hatching in chickens vaccinated as embryos with the turkey herpesvirus. Avian Dis. 1982, 26, 134–149. [Google Scholar] [CrossRef] [Scilit]
- Li, Y.; Reddy, K.; Reid, S.M.; Cox, W.J.; Brown, I.H.; Britton, P.; Nair, V.; Iqbal, M. Recombinant herpesvirus of turkeys as a vector-based vaccine against highly pathogenic H7N1 avian influenza and Marek’s disease. Vaccine 2011, 29, 8257–8266. [Google Scholar] [CrossRef] [Scilit]
- Esaki, M.; Godoy, A.; Rosenberger, J.K.; Rosenberger, S.C.; Gardin, Y.; Yasuda, A.; Dorsey, K.M. Protection and antibody response caused by turkey herpesvirus vector Newcastle disease vaccine. Avian Dis. 2013, 57, 750–755. [Google Scholar] [CrossRef] [Scilit]
- Vagnozzi, A.; Zavala, G.; Riblet, S.M.; Mundt, A.; Garcia, M. Protection induced by commercially available live-attenuated and recombinant viral vector vaccines against infectious laryngotracheitis virus in broiler chickens. Avian Pathol. 2012, 41, 21–31. [Google Scholar] [CrossRef] [Scilit]
- Darteil, R.; Bublot, M.; Laplace, E.; Bouquet, J.F.; Audonnet, J.C.; Riviere, M. Herpesvirus of turkey recombinant viruses expressing infectious bursal disease virus (IBDV) VP2 immunogen induce protection against an IBDV virulent challenge in chickens. Virology 1995, 211, 481–490. [Google Scholar] [CrossRef] [Scilit]
- Morgan, R.W.; Gelb, J., Jr.; Schreurs, C.S.; Lutticken, D.; Rosenberger, J.K.; Sondermeijer, P.J. Protection of chickens from Newcastle and Marek’s diseases with a recombinant herpesvirus of turkeys vaccine expressing the Newcastle disease virus fusion protein. Avian Dis. 1992, 36, 858–870. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gao, H.; Cui, H.; Cui, X.; Shi, X.; Zhao, Y.; Zhao, X.; Quan, Y.; Yan, S.; Zeng, W.; Wang, Y. Expression of HA of HPAI H5N1 virus at US2 gene insertion site of turkey herpesvirus induced better protection than that at US10 gene insertion site. PLoS ONE 2011, 6, e22549. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Palya, V.; Kiss, I.; Tatar-Kis, T.; Mato, T.; Felfoldi, B.; Gardin, Y. Advancement in vaccination against Newcastle disease: Recombinant HVT NDV provides high clinical protection and reduces challenge virus shedding with the absence of vaccine reactions. Avian Dis. 2012, 56, 282–287. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tang, N.; Zhang, Y.; Pedrera, M.; Chang, P.; Baigent, S.; Moffat, K.; Shen, Z.; Nair, V.; Yao, Y. A simple and rapid approach to develop recombinant avian herpesvirus vectored vaccines using CRISPR/Cas9 system. Vaccine 2018, 36, 716–722. [Google Scholar] [CrossRef] [Scilit]
- Liu, L.; Wang, T.; Wang, M.; Tong, Q.; Sun, Y.; Pu, J.; Sun, H.; Liu, J. Recombinant turkey herpesvirus expressing H9 hemagglutinin providing protection against H9N2 avian influenza. Virology 2019, 529, 7–15. [Google Scholar] [CrossRef] [Scilit]
- Kapczynski, D.R.; Esaki, M.; Dorsey, K.M.; Jiang, H.; Jackwood, M.; Moraes, M.; Gardin, Y. Vaccine protection of chickens against antigenically diverse H5 highly pathogenic avian influenza isolates with a live HVT vector vaccine expressing the influenza hemagglutinin gene derived from a clade 2.2 avian influenza virus. Vaccine 2015, 33, 1197–1205. [Google Scholar] [CrossRef] [Scilit]
- Palya, V.; Tatar-Kis, T.; Walkone Kovacs, E.; Kiss, I.; Homonnay, Z.; Gardin, Y.; Kertesz, K.; Dan, A. Efficacy of a Recombinant Turkey Herpesvirus AI (H5) Vaccine in Preventing Transmission of Heterologous Highly Pathogenic H5N8 Clade 2.3.4.4b Challenge Virus in Commercial Broilers and Layer Pullets. J. Immunol. Res. 2018, 2018, 3143189. [Google Scholar] [CrossRef] [Scilit]
- Kapczynski, D.R.; Dorsey, K.; Chrzastek, K.; Moraes, M.; Jackwood, M.; Hilt, D.; Gardin, Y. Vaccine Protection of Turkeys Against H5N1 Highly Pathogenic Avian Influenza Virus with a Recombinant Turkey Herpesvirus Expressing the Hemagglutinin Gene of Avian Influenza. Avian Dis. 2016, 60, 413–417. [Google Scholar] [CrossRef] [Scilit]
- Pantin-Jackwood, M.J.; Kapczynski, D.R.; DeJesus, E.; Costa-Hurtado, M.; Dauphin, G.; Tripodi, A.; Dunn, J.R.; Swayne, D.E. Efficacy of a Recombinant Turkey Herpesvirus H5 Vaccine Against Challenge With H5N1 Clades 1.1.2 and 2.3.2.1 Highly Pathogenic Avian Influenza Viruses in Domestic Ducks (Anas platyrhynchos domesticus). Avian Dis. 2016, 60, 22–32. [Google Scholar] [CrossRef] [Scilit]
- Baigent, S.J.; Petherbridge, L.J.; Smith, L.P.; Zhao, Y.; Chesters, P.M.; Nair, V.K. Herpesvirus of turkey reconstituted from bacterial artificial chromosome clones induces protection against Marek’s disease. J. Gen. Virol. 2006, 87 Pt 4, 769–776. [Google Scholar] [CrossRef] [Scilit]
- Liu, Y.; Li, K.; Gao, Y.; Gao, L.; Zhong, L.; Zhang, Y.; Liu, C.; Zhang, Y.; Wang, X. Recombinant Marek’s Disease Virus as a Vector-Based Vaccine against Avian Leukosis Virus Subgroup J in Chicken. Viruses 2016, 8, 301. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Balzli, C.L.; Bertran, K.; Lee, D.H.; Killmaster, L.; Pritchard, N.; Linz, P.; Mebatsion, T.; Swayne, D.E. The efficacy of recombinant turkey herpesvirus vaccines targeting the H5 of highly pathogenic avian influenza virus from the 2014–2015 North American outbreak. Vaccine 2018, 36, 84–90. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ran, F.A.; Hsu, P.D.; Wright, J.; Agarwala, V.; Scott, D.A.; Zhang, F. Genome engineering using the CRISPR-Cas9 system. Nat. Protoc. 2013, 8, 2281–2308. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chang, P.; Yao, Y.; Tang, N.; Sadeyen, J.R.; Sealy, J.; Clements, A.; Bhat, S.; Munir, M.; Bryant, J.E.; Iqbal, M. The Application of NHEJ-CRISPR/Cas9 and Cre-Lox System in the Generation of Bivalent Duck Enteritis Virus Vaccine against Avian Influenza Virus. Viruses 2018, 10, 81. [Google Scholar] [CrossRef] [Scilit]
- Zou, Z.; Huang, K.; Wei, Y.; Chen, H.; Liu, Z.; Jin, M. Construction of a highly efficient CRISPR/Cas9-mediated duck enteritis virus-based vaccine against H5N1 avian influenza virus and duck Tembusu virus infection. Sci. Rep. 2017, 7, 1478. [Google Scholar] [CrossRef] [Scilit]
- Tang, N.; Zhang, Y.; Pedrera, M.; Chang, P.; Baigent, S.; Moffat, K.; Shen, Z.; Nair, V.; Yao, Y. Generating Recombinant Avian Herpesvirus Vectors with CRISPR/Cas9 Gene Editing. J. Vis. Exp. 2019, 7. [Google Scholar] [CrossRef] [Scilit]
- Bi, Y.; Sun, L.; Gao, D.; Ding, C.; Li, Z.; Li, Y.; Cun, W.; Li, Q. High-efficiency targeted editing of large viral genomes by RNA-guided nucleases. PloS Pathog. 2014, 10, e1004090. [Google Scholar] [CrossRef] [Scilit]
- Yao, Y.; Bassett, A.; Nair, V. Targeted editing of avian herpesvirus vaccine vector using crispr/cas9 nucleases. J. Vaccine Technol 2016, 1, 1–7. [Google Scholar]
- Hirst, G.K. The Quantitative Determination of Influenza Virus and Antibodies by Means of Red Cell Agglutination. J. Exp. Med. 1942, 75, 49–64. [Google Scholar] [CrossRef] [Scilit]
- Panier, S.; Boulton, S.J. Double-strand break repair: 53BP1 comes into focus. Nat. Rev. Mol. Cell Biol. 2014, 15, 7–18. [Google Scholar] [CrossRef] [Scilit]




| gRNA | Target Sequence 5′-3′ | Gene Locus |
|---|---|---|
| HVT gRNA | AAAACACAGTAACCGTTAGAGG | UL45/46 |
| GFP gRNA | AGCTGGACGGCGACGTAAACGG | eGFP |
| Primer Name | Sequence 5′-3′ |
|---|---|
| eGFP forward | ATTATTGGTACCATGGTGAGCAAGGGCGAG |
| eGFP reverse | GCCGCTTCTAGATTACTTGTACAGCTCGTC |
| H7N9 HA forward | ATAGGTACCATGAACACTCAAATCCTG |
| H7N9 HA reverse | AATTCTAGATTATATACAAATAGTGCAC |
| UL45/46 forward | GTCTTCCGGTTAAGGGACAG |
| UL45/46 reverse | CGAACAAGTCGGGAAGTACG |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chang, P.; Ameen, F.; Sealy, J.E.; Sadeyen, J.-R.; Bhat, S.; Li, Y.; Iqbal, M. Application of HDR-CRISPR/Cas9 and Erythrocyte Binding for Rapid Generation of Recombinant Turkey Herpesvirus-Vectored Avian Influenza Virus Vaccines. Vaccines 2019, 7, 192. https://doi.org/10.3390/vaccines7040192
Chang P, Ameen F, Sealy JE, Sadeyen J-R, Bhat S, Li Y, Iqbal M. Application of HDR-CRISPR/Cas9 and Erythrocyte Binding for Rapid Generation of Recombinant Turkey Herpesvirus-Vectored Avian Influenza Virus Vaccines. Vaccines. 2019; 7(4):192. https://doi.org/10.3390/vaccines7040192
Chicago/Turabian StyleChang, Pengxiang, Faisal Ameen, Joshua E. Sealy, Jean-Remy Sadeyen, Sushant Bhat, Yongqing Li, and Munir Iqbal. 2019. "Application of HDR-CRISPR/Cas9 and Erythrocyte Binding for Rapid Generation of Recombinant Turkey Herpesvirus-Vectored Avian Influenza Virus Vaccines" Vaccines 7, no. 4: 192. https://doi.org/10.3390/vaccines7040192
APA StyleChang, P., Ameen, F., Sealy, J. E., Sadeyen, J.-R., Bhat, S., Li, Y., & Iqbal, M. (2019). Application of HDR-CRISPR/Cas9 and Erythrocyte Binding for Rapid Generation of Recombinant Turkey Herpesvirus-Vectored Avian Influenza Virus Vaccines. Vaccines, 7(4), 192. https://doi.org/10.3390/vaccines7040192

