Evaluation of Quillaja brasiliensis Saponin-Based Nanoparticles Combined with Leucine Aminopeptidases for Immunoprotection of Sheep Against Fasciola hepatica
Abstract
1. Introduction
2. Materials and Methods
2.1. Production of Recombinant Proteins
2.2. ISCOM-Matrices Adjuvant: Preparation and Characterization
2.3. Immunoprotection Trial
2.4. ELISA
2.4.1. Total IgG
2.4.2. IgG1 and IgG2 Subclasses
2.5. Stimulation and Isolation of Peripheral Blood Leukocytes (PBL)
2.6. Gene Expression Analysis
2.7. Exploratory Analysis of Correlations Pre- and Post-Challenge
2.8. Statistical Analysis
3. Results
3.1. Obtaining Recombinant FhLAP1, FhLAP2, and IMX
3.2. Vaccination Efficacy Based on Worm Recovery and Egg Viability
3.3. Humoral Response Induced by Vaccination with FhLAP1, FhLAP2, and IMX
3.4. Gene Expression Levels Induced by Vaccination with FhLAP1 or FhLAP1/FhLAP2
3.5. Correlation Between Immunological Parameters and Recovery Worm


4. Discussion
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Mehmood, K.; Zhang, H.; Sabir, A.J.; Abbas, R.Z.; Ijaz, M.; Durrani, A.Z.; Saleem, M.H.; Ur Rehman, M.; Iqbal, M.K.; Wang, Y.; et al. A Review on Epidemiology, Global Prevalence and Economical Losses of Fasciolosis in Ruminants. Microb. Pathog. 2017, 109, 253–262. [Google Scholar] [CrossRef]
- Sinclair, K.B. The Pathogenicity of Fasciola hepatica in Pregnant Sheep. Br. Vet. J. 1972, 128, 249–259. [Google Scholar] [CrossRef] [PubMed]
- WHO. Integrating Neglected Tropical Diseases into Global Health and Development: Fourth WHO Report on Neglected Tropical Diseases; WHO: Geneva, Switzerland, 2017; 270p. [Google Scholar]
- Fairweather, I. Liver Fluke Isolates: A Question of Provenance. Vet. Parasitol. 2011, 176, 1–8. [Google Scholar] [CrossRef]
- Stuen, S.; Ersdal, C. Fasciolosis—An Increasing Challenge in the Sheep Industry. Animals 2022, 12, 1491. [Google Scholar] [CrossRef]
- Canevari, J.; Ceballos, L.; Sanabria, R.; Romero, J.; Olaechea, F.; Ortiz, P.; Cabrera, M.; Gayo, V.; Fairweather, I.; Lanusse, C.; et al. Testing Albendazole Resistance in Fasciola hepatica: Validation of an Egg Hatch Test with Isolates from South America and the United Kingdom. J. Helminthol. 2014, 88, 286–292. [Google Scholar] [CrossRef]
- Imperiale, F.; Ortiz, P.; Cabrera, M.; Farias, C.; Sallovitz, J.M.; Iezzi, S.; Pérez, J.; Alvarez, L.; Lanusse, C. Residual Concentrations of the Flukicidal Compound Triclabendazole in Dairy Cows’ Milk and Cheese. Food Addit. Contam.—Part A 2011, 28, 438–445. [Google Scholar] [CrossRef] [PubMed]
- Molina-Hernández, V.; Mulcahy, G.; Pérez, J.; Martínez-Moreno, Á.; Donnelly, S.; O’Neill, S.M.; Dalton, J.P.; Cwiklinski, K. Fasciola hepatica Vaccine: We May Not Be There yet but We’re on the Right Road. Vet. Parasitol. 2015, 208, 101–111. [Google Scholar] [CrossRef]
- Flores-Velázquez, L.M.; Ruiz-Campillo, M.T.; Herrera-Torres, G.; Martínez-Moreno, Á.; Martínez-Moreno, F.J.; Zafra, R.; Buffoni, L.; Rufino-Moya, P.J.; Molina-Hernández, V.; Pérez, J. Fasciolosis: Pathogenesis, Host-Parasite Interactions, and Implication in Vaccine Development. Front. Vet. Sci. 2023, 10, 1270064. [Google Scholar] [CrossRef] [PubMed]
- Acosta, D.; Goni, F.; Carmona, C. Characterization and Partial Purification of a Leucine Aminopeptidase from Fasciola hepatica. J. Parasitol. 1998, 84, 1–7. [Google Scholar] [CrossRef]
- Acosta, D.; Cancela, M.; Piacenza, L.; Roche, L.; Carmona, C.; Tort, J.F. Fasciola hepatica Leucine Aminopeptidase, a Promising Candidate for Vaccination against Ruminant Fasciolosis. Mol. Biochem. Parasitol. 2008, 158, 52–64. [Google Scholar] [CrossRef]
- Williamson, A.L.; Lecchi, P.; Turk, B.E.; Choe, Y.; Hotez, P.J.; McKerrow, J.H.; Cantley, L.C.; Sajid, M.; Craik, C.S.; Loukas, A. A Multi-Enzyme Cascade of Hemoglobin Proteolysis in the Intestine of Blood-Feeding Hookworms. J. Biol. Chem. 2004, 279, 35950–35957. [Google Scholar] [CrossRef]
- McCarthy, E.; Stack, C.; Donnelly, S.M.; Doyle, S.; Mann, V.H.; Brindley, P.J.; Stewart, M.; Day, T.A.; Maule, A.G.; Dalton, J.P. Leucine Aminopeptidase of the Human Blood Flukes, Schistosoma mansoni and Schistosoma japonicum. Int. J. Parasitol. 2004, 34, 703–714. [Google Scholar] [CrossRef]
- Rinaldi, G.; Morales, M.E.; Alrefaei, Y.N.; Cancela, M.; Castillo, E.; Dalton, J.P.; Tort, J.F.; Brindley, P.J. RNA Interference Targeting Leucine Aminopeptidase Blocks Hatching of Schistosoma mansoni Eggs. Mol. Biochem. Parasitol. 2009, 167, 118–126. [Google Scholar] [CrossRef]
- Kang, J.M.; Ju, H.L.; Ju, J.W.; Sohn, W.M.; Kim, T.S.; Bahk, Y.Y.; Hong, S.J.; Na, B.K. Comparative Biochemical and Functional Properties of Two Leucine Aminopeptidases of Clonorchis Sinensis. Mol. Biochem. Parasitol. 2012, 182, 17–26. [Google Scholar] [CrossRef] [PubMed]
- Maggioli, G.; Rinaldi, G.; Giaudrone, I.; Berasain, P.; Tort, J.F.; Brindley, P.J.; Carmona, C. Expression, Purification and Characterization of Two Leucine Aminopeptidases of the Blood Fluke, Schistosoma mansoni. Mol. Biochem. Parasitol. 2018, 219, 17–23. [Google Scholar] [CrossRef]
- Maggioli, G.; Acosta, D.; Silveira, F.; Rossi, S.; Giacaman, S.; Basika, T.; Gayo, V.; Rosadilla, D.; Roche, L.; Tort, J.; et al. The Recombinant Gut-Associated M17 Leucine Aminopeptidase in Combination with Different Adjuvants Confers a High Level of Protection against Fasciola hepatica Infection in Sheep. Vaccine 2011, 29, 9057–9063. [Google Scholar] [CrossRef] [PubMed]
- Cwiklinski, K.; Jewhurst, H.; McVeigh, P.; Barbour, T.; Maule, A.G.; Tort, J.; O’Neill, S.M.; Robinson, M.W.; Donnelly, S.; Dalton, J.P. Infection by the Helminth Parasite Fasciola hepatica Requires Rapid Regulation of Metabolic, Virulence, and Invasive Factors to Adjust to Its Mammalian Host. Mol. Cell. Proteom. 2018, 17, 792–809. [Google Scholar] [CrossRef] [PubMed]
- Cwiklinski, K.; Robinson, M.W.; Donnelly, S.; Dalton, J.P. Complementary Transcriptomic and Proteomic Analyses Reveal the Cellular and Molecular Processes That Drive Growth and Development of Fasciola hepatica in the Host Liver. BMC Genom. 2021, 22, 46. [Google Scholar] [CrossRef]
- Checa, J.; Salazar, C.; Goyeche, A.; Rivera, M.; Silveira, F.; Maggioli, G. A Promising New Target to Control Fasciolosis: Fasciola hepatica Leucine Aminopeptidase 2. Vet. Parasitol. 2023, 320, 109959. [Google Scholar] [CrossRef]
- Morais, V.; Suarez, N.; Cibulski, S.; Silveira, F. Leaf Saponins of Quillaja brasiliensis as Powerful Vaccine Adjuvants. Pharmaceutics 2025, 17, 966. [Google Scholar] [CrossRef]
- Maina, T.W.; Grego, E.A.; Boggiatto, P.M.; Sacco, R.E.; Narasimhan, B.; McGill, J.L. Applications of Nanovaccines for Disease Prevention in Cattle. Front. Bioeng. Biotechnol. 2020, 8, 608050. [Google Scholar] [CrossRef] [PubMed]
- Gao, X.; Zhu, X.; Liu, X.; Zhou, C.; Shang, Y.; Wu, T.; Jia, H.; Zhang, Z.; Li, Y.; Xin, T. A Ferritin-Based Eg95 Nanoparticle Vaccine Adjuvanted with PCpG Eliciting Robust Immune Responses Against Cystic Echinococcosis in Mice Model. Int. J. Nanomed. 2025, 20, 309–325. [Google Scholar] [CrossRef] [PubMed]
- Wang, Q.Q.; Muhammad, T.A.; Muhammad, W.H.; Muhammad, A.M.; Muhammad, H.; Yan, R.F.; Xu, L.X.; Song, X.K.; Li, X.R. Hepatocellular Carcinoma-Associated Antigen 59 and ADP-Ribosylation Factor 1 with Poly (Lactic-Co-Glycolic Acid): A Promising Candidate as Nanovaccine against Haemonchosis. Microb. Pathog. 2022, 168, 105614. [Google Scholar] [CrossRef]
- Xinxin, Z.; Xianzhou, L.; Dandan, P.; Yan, W.; Zhenyu, L. Immunization with the Glutathione S-Transferase Sj26GST with Chi-CpG NP against Schistosoma japonicum in Mice. Microb. Pathog. 2024, 195, 106847. [Google Scholar] [CrossRef]
- Solano-Parada, J.; Gonzalez-Gonzalez, G.; de Pablos Torró, L.M.; Brazil dos Santos, M.F.; Espino, A.M.; Burgos, M.; Osuna, A. Effectiveness of Intranasal Vaccination against Angiostrongylus costaricensis Using a Serine/Threonine Phosphatase 2 A Synthetic Peptide and Recombinant Antigens. Vaccine 2010, 28, 5185–5196. [Google Scholar] [CrossRef]
- Cibulski, S.P.; Mourglia-Ettlin, G.; Teixeira, T.F.; Quirici, L.; Roehe, P.M.; Ferreira, F.; Silveira, F. Novel ISCOMs from Quillaja brasiliensis Saponins Induce Mucosal and Systemic Antibody Production, T-Cell Responses and Improved Antigen Uptake. Vaccine 2016, 34, 1162–1171. [Google Scholar] [CrossRef]
- Cibulski, S.P.; Rivera-Patron, M.; Mourglia-Ettlin, G.; Casaravilla, C.; Yendo, A.C.A.; Fett-Neto, A.G.; Chabalgoity, J.A.; Moreno, M.; Roehe, P.M.; Silveira, F. Quillaja brasiliensis Saponin-Based Nanoparticulate Adjuvants Are Capable of Triggering Early Immune Responses. Sci. Rep. 2018, 8, 13582. [Google Scholar] [CrossRef]
- Mulcahy, G.; O’Connor, F.; Clery, D.; Hogan, S.F.; Dowd, A.J.; Andrews, S.J.; Dalton, J.P. Immune Responses of Cattle to Experimental Anti-Fasciola hepatica Vaccines. Res. Vet. Sci. 1999, 67, 27–33. [Google Scholar] [CrossRef]
- Golden, O.; Flynn, R.J.; Read, C.; Sekiya, M.; Donnelly, S.M.; Stack, C.; Dalton, J.P.; Mulcahy, G. Protection of Cattle against a Natural Infection of Fasciola hepatica by Vaccination with Recombinant Cathepsin L1 (RFhCL1). Vaccine 2010, 28, 5551–5557. [Google Scholar] [CrossRef]
- Villa-Mancera, A.; Méndez-Mendoza, M. Protection and Antibody Isotype Responses against Fasciola hepatica with Specific Antibody to PIII-Displayed Peptide Mimotopes of Cathepsin L1 in Sheep. Vet. J. 2012, 194, 108–112. [Google Scholar] [CrossRef] [PubMed]
- Villa-Mancera, A.; Quiroz-Romero, H.; Correa, D.; Ibarra, F.; Reyes-Pérez, M.; Reyes-Vivas, H.; López-Velázquez, G.; Gazarian, K.; Gazarian, T.; Alonso, R.A. Induction of Immunity in Sheep to Fasciola hepatica with Mimotopes of Cathepsin L Selected from a Phage Display Library. Parasitology 2008, 135, 1437–1445. [Google Scholar] [CrossRef] [PubMed]
- Beesley, N.J.; Caminade, C.; Charlier, J.; Flynn, R.J.; Hodgkinson, J.E.; Martinez-Moreno, A.; Martinez-Valladares, M.; Perez, J.; Rinaldi, L.; Williams, D.J.L. Fasciola and Fasciolosis in Ruminants in Europe: Identifying Research Needs. Transbound. Emerg. Dis. 2018, 65, 199–216. [Google Scholar] [CrossRef]
- Spithill, T.W.; Toet, H.; Rathinasamy, V.; Zerna, G.; Swan, J.; Cameron, T.; Smooker, P.M.; Piedrafita, D.M.; Dempster, R.; Beddoe, T. Vaccines for Fasciola: New Thinking for an Old Problem. Fasciolosis II 2021, 379–422. [Google Scholar] [CrossRef]
- Yendo, A.C.A.; de Costa, F.; Kauffmann, C.; Fleck, J.D.; Gosmann, G.; Fett-Neto, A.G. Purification of an Immunoadjuvant Saponin Fraction from Quillaja brasiliensis Leaves by Reversed-Phase Silica Gel Chromatography. Methods Mol. Biol. 2017, 1494, 87–93. [Google Scholar] [CrossRef]
- Rivera-Patron, M.; Cibulski, S.P.; Miraballes, I.; Silveira, F. Formulation of IMXQB: Nanoparticles Based on Quillaja brasiliensis Saponins to Be Used as Vaccine Adjuvants. Methods Mol. Biol. 2022, 2469, 183–191. [Google Scholar] [CrossRef]
- Jayaraj, R.; Piedrafita, D.; Dynon, K.; Grams, R.; Spithill, T.W.; Smooker, P.M. Vaccination against Fasciolosis by a Multivalent Vaccine of Stage-Specific Antigens. Vet. Parasitol. 2009, 160, 230–236. [Google Scholar] [CrossRef]
- Gayo, V.; Cancela, M.; Acosta, D. Maintenance of Life Cycle Stages of Fasciola hepatica in the Laboratory. Methods Mol. Biol. 2020, 2137, 1–14. [Google Scholar] [CrossRef] [PubMed]
- Fairweather, I.; McShane, D.D.; Shaw, L.; Ellison, S.E.; O’Hagan, N.T.; York, E.A.; Trudgett, A.; Brennan, G.P. Development of an Egg Hatch Assay for the Diagnosis of Triclabendazole Resistance in Fasciola hepatica: Proof of Concept. Vet. Parasitol. 2012, 183, 249–259. [Google Scholar] [CrossRef] [PubMed]
- Rossi, A.; Guarnaschelli, J.; Rial, A.; Moreno, M.; Rivera-Patron, M.; Iriarte, A.; Chabalgoity, J.A. Humoral and Cellular Immune Responses in Cattle upon Clostridium Chauvoei Vaccination and Challenge. Front. Immunol. 2025, 16, 1584168. [Google Scholar] [CrossRef]
- Budhia, S.; Haring, L.F.; McConnell, I.; Blacklaws, B.A. Quantitation of Ovine Cytokine MRNA by Real-Time RT–PCR. J. Immunol. Methods 2006, 309, 160–172. [Google Scholar] [CrossRef]
- Wattegedera, S.R.; Watson, D.M.; Hope, J.C.; Kaiser, P.; Sales, J.; McInnes, C.J.; Entrican, G. Relative Quantitative Kinetics of Interferon-Gamma and Interleukin-10 MRNA and Protein Production by Activated Ovine Peripheral Blood Mononuclear Cells. Vet. Immunol. Immunopathol. 2010, 136, 34–42. [Google Scholar] [CrossRef]
- Montagne, A.; Grépinet, O.; Peloille, M.; Lantier, F.; Lalmanach, A.C. Quantification of Ovine Cytokine Gene Expression by a Competitive RT-PCR Method. J. Immunol. Methods 2001, 253, 83–93. [Google Scholar] [CrossRef]
- Peletto, S.; Bertuzzi, S.; Campanella, C.; Modesto, P.; Maniaci, M.G.; Bellino, C.; Ariello, D.; Quasso, A.; Caramelli, M.; Acutis, P.L. Evaluation of Internal Reference Genes for Quantitative Expression Analysis by Real-Time PCR in Ovine Whole Blood. Int. J. Mol. Sci. 2011, 12, 7732–7747. [Google Scholar] [CrossRef]
- Mahakapuge, T.A.N.; Scheerlinck, J.P.Y.; Rojas, C.A.A.; Every, A.L.; Hagen, J. Assessment of Reference Genes for Reliable Analysis of Gene Transcription by RT-QPCR in Ovine Leukocytes. Vet. Immunol. Immunopathol. 2016, 171, 1–6. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2-ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Zar, J.H. Biostatistical Analysis, 5th ed.; Prentice Hall: Hoboken, NJ, USA, 2010; 949p. [Google Scholar]
- Hammer, Ø.; Harper, D.A.T.; Ryan, P.D. Past: Paleontological Statistics Software Package For Education And Data Analysis. Curr. Sci. 2001, 105, 1352–1357. [Google Scholar]
- Shapiro, S.S.; Wilk, M.B. An Analysis of Variance Test for Normality (Complete Samples). Biometrika 1965, 52, 591. [Google Scholar] [CrossRef]
- Levene, H. Robust Tests for Equality of Variances. In Contributions to Probability and Statistics: Essays in Honor of Harold Hotelling; Stanford University Press: Palo Alto, CA, USA, 1960; pp. 278–292. [Google Scholar]
- Dalton, J.P.; Brindley, P.J. Proteases of Trematodes. Advances in Tremadote Biology; Fried, B., Graczyk, T., Eds.; CRC Press: Boca Raton, FL, USA, 1996; ISBN 9781003574118. [Google Scholar]
- Tort, J.; Brindley, P.J.; Knox, D.; Wolfe, K.H.; Dalton, J.P. Proteinases and Associated Genes of Parasitic Helminths. Adv. Parasitol. 1999, 43, 161–266. [Google Scholar] [CrossRef] [PubMed]
- Piacenza, L.; Acosta, D.; Basmadjian, I.; Dalton, J.P.; Carmona, C. Vaccination with Cathepsin L Proteinases and with Leucine Aminopeptidase Induces High Levels of Protection against Fascioliasis in Sheep. Infect. Immun. 1999, 67, 1954–1961. [Google Scholar] [CrossRef] [PubMed]
- Changklungmoa, N.; Cheukamud, W.; Jaikua, W.; Meemon, K.; Sobhon, P.; Kueakhai, P. Combination Vaccines of Fasciola gigantica Saposin-like Protein-2 and Leucine Aminopeptidase. Trop. Med. Infect. Dis. 2023, 8, 334. [Google Scholar] [CrossRef] [PubMed]
- Molina-hernández, V.; Ruiz-campillo, M.T.; Martínez-moreno, F.J.; Buffoni, L.; Martínez-moreno, Á.; Zafra, R.; Bautista, M.J.; Escamilla, A.; Pérez-caballero, R.; Pérez, J. A Partially Protective Vaccine for Fasciola hepatica Induced Degeneration of Adult Flukes Associated to a Severe Granulomatous Reaction in Sheep. Animals 2021, 11, 2869. [Google Scholar] [CrossRef] [PubMed]
- Nisbet, A.J.; McNeilly, T.N.; Wildblood, L.A.; Morrison, A.A.; Bartley, D.J.; Bartley, Y.; Longhi, C.; McKendrick, I.J.; Palarea-Albaladejo, J.; Matthews, J.B. Successful Immunization against a Parasitic Nematode by Vaccination with Recombinant Proteins. Vaccine 2013, 31, 4017–4023. [Google Scholar] [CrossRef] [PubMed]
- Zafra, R.; Buffoni, L.; Pérez-Caballero, R.; Molina-Hernández, V.; Ruiz-Campillo, M.T.; Pérez, J.; Martínez-Moreno, Á.; Martínez Moreno, F.J. Efficacy of a Multivalent Vaccine against Fasciola hepatica Infection in Sheep. Vet. Res. 2021, 52, 13. [Google Scholar] [CrossRef]
- Mendes, R.E.; Pérez-Écija, R.A.; Zafra, R.; Buffoni, L.; Martínez-Moreno, Á.; Dalton, J.P.; Mulcahy, G.; Pérez, J. Evaluation of Hepatic Changes and Local and Systemic Immune Responses in Goats Immunized with Recombinant Peroxiredoxin (Prx) and Challenged with Fasciola hepatica. Vaccine 2010, 28, 2832–2840. [Google Scholar] [CrossRef]
- Ingale, S.L.; Singh, P.; Raina, O.K.; Mehra, U.R.; Verma, A.K.; Gupta, S.C.; Mulik, S.V. Interferon-Gamma and Interleukin-4 Expression during Fasciola gigantica Primary Infection in Crossbred Bovine Calves as Determined by Real-Time PCR. Vet. Parasitol. 2008, 152, 158–161. [Google Scholar] [CrossRef] [PubMed]
- Wesołowska, A.; Basałaj, K.; Norbury, L.J.; Sielicka, A.; Wędrychowicz, H.; Zawistowska-Deniziak, A. Sex and Vaccination: Insights from Female Rats Vaccinated with Juvenile-Specific Proteases from Fasciola hepatica. Vet. Parasitol. 2018, 255, 91–96. [Google Scholar] [CrossRef]
- Wesołowska, A. Sex-the Most Underappreciated Variable in Research: Insights from Helminth-Infected Hosts. Vet. Res. 2022, 53, 94. [Google Scholar] [CrossRef] [PubMed]
- Okino, C.H.; Niciura, S.C.M.; Minho, A.P.; Esteves, S.N.; Melito, G.R.; Montassier, H.J.; Chagas, A.C.d.S. Divergent Humoral Responses between Males and Females against 24 KDa Excretory-Secretory Protein of Haemonchus Contortus and Influence of Ovine β-Globin Polymorphism. Dev. Comp. Immunol. 2024, 159, 105216. [Google Scholar] [CrossRef]
- Ortega-Vargas, S.; Espitia, C.; Sahagún-Ruiz, A.; Parada, C.; Balderas-Loaeza, A.; Villa-Mancera, A.; Quiroz-Romero, H. Moderate Protection Is Induced by a Chimeric Protein Composed of Leucine Aminopeptidase and Cathepsin L1 against Fasciola hepatica Challenge in Sheep. Vaccine 2019, 37, 3234–3240. [Google Scholar] [CrossRef]
- Lee, R.P.; Jackson, L.A.; Opdebeeck, J.P. Immune Responses of Cattle to Biochemically Modified Antigens from the Midgut of the Cattle Tick, Boophilus Microplus. Parasite Immunol. 1991, 13, 661–672. [Google Scholar] [CrossRef]
- Haçariz, O.; Sayers, G.; McCullough, M.; Garrett, M.; O’Donovan, J.; Mulcahy, G. The Effect of Quil A Adjuvant on the Course of Experimental Fasciola hepatica Infection in Sheep. Vaccine 2009, 27, 45–50. [Google Scholar] [CrossRef]
- Viana, K.F.; Sperandio, N.d.C.; Neto, F.B.; Donatele, D.M.; de Souza, A.B.; dos Santos, A.G.V.; Rivas, A.V.; Barcellos, E.C.d.A.; Martins, I.V.F. Safety and Immunogenicity of an FhSAMS Vaccine Against Fasciola hepatica in Dairy Cattle. Parasite Immunol. 2024, 46, e13074. [Google Scholar] [CrossRef]
- Garza-Cuartero, L.; Geurden, T.; Mahan, S.M.; Hardham, J.M.; Dalton, J.P.; Mulcahy, G. Antibody Recognition of Cathepsin L1-Derived Peptides in Fasciola hepatica-Infected and/or Vaccinated Cattle and Identification of Protective Linear B-Cell Epitopes. Vaccine 2018, 36, 958–968. [Google Scholar] [CrossRef]
- Buonavoglia, D.; Fasanella, A.; Sagazio, P.; Tempesta, M.; Lovane, G.; Buonavoglia, C. Persistence of Antibodies to Mycoplasma agalactiae in Vaccinated Sheep. New Microbiol. 1998, 21, 209–212. [Google Scholar] [PubMed]
- Greco, G.; Corrente, M.; Buonavoglia, D.; Aliberti, A.; Fasanella, A. Inactivated Vaccine Induces Protection against Mycoplasma agalactiae Infection in Sheep. New Microbiol. 2002, 25, 17–20. [Google Scholar]
- Buonavoglia, D.; Greco, G.; Corrente, M.; Greco, M.F.; D’Abramo, M.; Latronico, F.; Fasanella, A.; Decaro, N. Long-Term Immunogenicity and Protection against Mycoplasma agalactiae Induced by an Oil Adjuvant Vaccine in Sheep. Res. Vet. Sci. 2010, 88, 16–19. [Google Scholar] [CrossRef]
- Dalton, J.P.; Robinson, M.W.; Mulcahy, G.; O’Neill, S.M.; Donnelly, S. Immunomodulatory Molecules of Fasciola hepatica: Candidates for Both Vaccine and Immunotherapeutic Development. Vet. Parasitol. 2013, 195, 272–285. [Google Scholar] [CrossRef] [PubMed]
- Fu, Y.; Chryssafidis, A.L.; Browne, J.A.; O’Sullivan, J.; McGettigan, P.A.; Mulcahy, G. Transcriptomic Study on Ovine Immune Responses to Fasciola hepatica Infection. PLoS Negl. Trop. Dis. 2016, 10, e0005015. [Google Scholar] [CrossRef] [PubMed]
- Flynn, R.J.; Mulcahy, G.; Elsheikha, H.M. Coordinating Innate and Adaptive Immunity in Fasciola hepatica Infection: Implications for Control. Vet. Parasitol. 2010, 169, 235–240. [Google Scholar] [CrossRef]
- Pacheco, I.L.; Abril, N.; Zafra, R.; Molina-Hernández, V.; Morales-Prieto, N.; Bautista, M.J.; Ruiz-Campillo, M.T.; Pérez-Caballero, R.; Martínez-Moreno, A.; Pérez, J. Fasciola hepatica Induces Foxp3 T Cell, Proinflammatory and Regulatory Cytokine Overexpression in Liver from Infected Sheep during Early Stages of Infection. Vet. Res. 2018, 49, 56. [Google Scholar] [CrossRef]
- Ruiz-Campillo, M.T.; Barrero-Torres, D.M.; Abril, N.; Pérez, J.; Zafra, R.; Buffoni, L.; Martínez-Moreno, Á.; Martínez-Moreno, F.J.; Molina-Hernández, V. Fasciola hepatica Primoinfections and Reinfections in Sheep Drive Distinct Th1/Th2/Treg Immune Responses in Liver and Hepatic Lymph Node at Early and Late Stages. Vet. Res. 2023, 54, 2. [Google Scholar] [CrossRef] [PubMed]
- Preyavichyapugdee, N.; Sahaphong, S.; Riengrojpitak, S.; Grams, R.; Viyanant, V.; Sobhon, P. Fasciola gigantica and Schistosoma mansoni: Vaccine Potential of Recombinant Glutathione S-Transferase (RFgGST26) against Infections in Mice. Exp. Parasitol. 2008, 119, 229–237. [Google Scholar] [CrossRef] [PubMed]
- Changklungmoa, N.; Kueakhai, P.; Riengrojpitak, S.; Chaithirayanon, K.; Chaichanasak, P.; Preyavichyapugdee, N.; Chantree, P.; Sansri, V.; Itagaki, T.; Sobhon, P. Immunization with Recombinant Leucine Aminopeptidase Showed Protection against Fasciola gigantica in Mice. Parasitol. Res. 2013, 112, 3653–3659. [Google Scholar] [CrossRef] [PubMed]
- Buffoni, L.; Garza-Cuartero, L.; Pérez-Caballero, R.; Zafra, R.; Javier Martínez-Moreno, F.; Molina-Hernández, V.; Pérez, J.; Martínez-Moreno, Á.; Mulcahy, G. Identification of Protective Peptides of Fasciola hepatica-Derived Cathepsin L1 (FhCL1) in Vaccinated Sheep by a Linear B-Cell Epitope Mapping Approach. Parasit. Vectors 2020, 13, 390. [Google Scholar] [CrossRef]





| Primer | Seq 5′-3′ | Amplicon Size (bp) |
|---|---|---|
| FoxP3 | F: CCCTTTCACCTATGCCACCC R: ATCTCGTTGAGTGTCCGCTG | 75 |
| IL1β | F: CTGGTGCTGGATAGCCCAT R: GTACGAAGCTCATGCAGAACA | 91 |
| IL2 | F: AGAGAGATCAAGGATTCAATGGAC R. TTACTGTCGCATCATCATATTCAC | 100 |
| IL4 | F: CGCTGAACATCCTCACATCG R: CTCAGTTGCGTTCTTTGGGG | 86 |
| IL5 | F: TCCTCAGCATACAAATCACCAAC R: CAGCATCCCCTTGTGCAGT | 89 |
| IL10 | F: CCCTGCGAAAACAAGAGCAAG R: CACTCATGGCTTTGTAGACACC | 88 |
| IL17 | F: GGCGTCTATGAGAACTGCCT R: ATGACCCCTGCCTTCACAAG | 75 |
| INFγ | F: ACTGGAGGACTTCAAAAGGCT R: ATTGATGGCTTTGCGCTGGAT | 70 |
| TNFα | F: GCACTTCGGGGTAATCGGC R: GCTTGAGAAGATGACCTGAGTGT | 99 |
| GAPDH [41] | F: GGCGTGAACCACGAGAAGTATAA R: CCCTCCACGATGCCAAAGT | 120 |
| Group | Cytokine | Statistic Test |
|---|---|---|
| FhLAP1 | IL-10 | t = 5.782 * |
| TNF-α | t = 3.755 * | |
| IL-17 | t = 9.802 ** | |
| IL-1β | W = −10 ns | |
| TGF-β | t = 0.6095 ns | |
| INF-γ | t = 1.474 ns | |
| FoxP3 | t = 2.916 ns | |
| IL-2 | W = −10 ns | |
| FhLAP1/FhLAP2 | IL-10 | t = 4.214 * |
| TNF-α | t = 0.3767 ns | |
| IL-17 | t = 1.198 ns | |
| IL-1β | W = 10 ns | |
| TGF-β | t = 0.5337 ns | |
| INF-γ | t = 0.3863 ns | |
| FoxP3 | W = −6 ns | |
| IL-2 | W = 2 ns |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Checa, J.; Goyeche, A.; Vettorazzi, R.; Alonzo, P.; Correa, O.; Norbis, W.; Castillo, E.; Cancela, M.; Rossi, A.; Silveira, F.; et al. Evaluation of Quillaja brasiliensis Saponin-Based Nanoparticles Combined with Leucine Aminopeptidases for Immunoprotection of Sheep Against Fasciola hepatica. Vaccines 2025, 13, 1008. https://doi.org/10.3390/vaccines13101008
Checa J, Goyeche A, Vettorazzi R, Alonzo P, Correa O, Norbis W, Castillo E, Cancela M, Rossi A, Silveira F, et al. Evaluation of Quillaja brasiliensis Saponin-Based Nanoparticles Combined with Leucine Aminopeptidases for Immunoprotection of Sheep Against Fasciola hepatica. Vaccines. 2025; 13(10):1008. https://doi.org/10.3390/vaccines13101008
Chicago/Turabian StyleCheca, Jackeline, Antonella Goyeche, Renzo Vettorazzi, Pablo Alonzo, Oscar Correa, Walter Norbis, Estela Castillo, Martin Cancela, Andrea Rossi, Fernando Silveira, and et al. 2025. "Evaluation of Quillaja brasiliensis Saponin-Based Nanoparticles Combined with Leucine Aminopeptidases for Immunoprotection of Sheep Against Fasciola hepatica" Vaccines 13, no. 10: 1008. https://doi.org/10.3390/vaccines13101008
APA StyleCheca, J., Goyeche, A., Vettorazzi, R., Alonzo, P., Correa, O., Norbis, W., Castillo, E., Cancela, M., Rossi, A., Silveira, F., & Maggioli, G. (2025). Evaluation of Quillaja brasiliensis Saponin-Based Nanoparticles Combined with Leucine Aminopeptidases for Immunoprotection of Sheep Against Fasciola hepatica. Vaccines, 13(10), 1008. https://doi.org/10.3390/vaccines13101008

