Construction and Evaluation of the Immunogenicity and Protective Efficacy of Recombinant Replication-Deficient Human Adenovirus-5 Expressing Genotype VII Newcastle Disease Virus F Protein and Infectious Bursal Disease Virus VP2 Protein
Abstract
1. Introduction
2. Materials and Methods
2.1. Plasmids, Cells, SPF Chickens, SPF Chicken Embryos, and Viruses
2.2. Cloning of NDV F and IBDV VP2 Genes
2.3. Construction of Recombinant Replication-Defective Adenoviruses
2.4. Analysis of Target Gene Transcription
2.5. Western Blot
2.6. Growth Curve Plotting and Purification of Recombinant Adenoviruses
2.7. Immunization with Recombinant Adenoviruses
2.8. Detection of Serum Antibodies and Cellular Immunity
2.9. Virus Challenge
2.10. Statistical Analysis
3. Results
3.1. Construction and Packaging of Recombinant Adenoviruses
3.2. Identification and Growth Curves of Recombinant Adenoviruses
3.3. Immunization with Recombinant Adenoviruses and Comparative Analysis of Serum Antibody Titers in Immunized Chickens
3.4. Assessment of the Cellular Immune Response
3.5. Protective Efficacies against DHN3 Challenge
3.6. Protective Efficacies against BC6/85 Challenge
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Alexander, D.J. Newcastle disease and other avian paramyxoviruses. Rev. Sci. Tech. Oie 2000, 19, 443–462. [Google Scholar] [CrossRef]
- Li, K.; Gao, L.; Gao, H.; Qi, X.; Gao, Y.; Qin, L.; Wang, Y.; Wang, X. Recombinant infectious bursal disease virus expressing Newcastle disease virus (NDV) neutralizing epitope confers partial protection against virulent NDV challenge in chickens. Antivir. Res. 2014, 101, 1–11. [Google Scholar] [CrossRef]
- Steel, J.; Burmakina, S.V.; Thomas, C.; Spackman, E.; Garcia-Sastre, A.; Swayne, D.E.; Palese, P. A combination in-ovo vaccine for avian influenza virus and Newcastle disease virus. Vaccine 2008, 26, 522–531. [Google Scholar] [CrossRef]
- Steward, M.; Vipond, I.B.; Millar, N.S.; Emmerson, P.T. RNA editing in Newcastle disease virus. J. Gen. Virol. 1993, 74 Pt 12, 2539–2547. [Google Scholar] [CrossRef]
- Panda, A.; Huang, Z.; Elankumaran, S.; Rockemann, D.D.; Samal, S.K. Role of fusion protein cleavage site in the virulence of Newcastle disease virus. Microb. Pathog. 2004, 36, 1–10. [Google Scholar] [CrossRef]
- Romer-Oberdorfer, A.; Werner, O.; Veits, J.; Mebatsion, T.; Mettenleiter, T.C. Contribution of the length of the HN protein and the sequence of the F protein cleavage site to Newcastle disease virus pathogenicity. J. Gen. Virol. 2003, 84, 3121–3129. [Google Scholar] [CrossRef]
- Ding, L.; Chen, P.; Bao, X.; Li, A.; Jiang, Y.; Hu, Y.; Ge, J.; Zhao, Y.; Wang, B.; Liu, J.; et al. Recombinant duck enteritis viruses expressing the Newcastle disease virus (NDV) F gene protects chickens from lethal NDV challenge. Vet. Microbiol. 2019, 232, 146–150. [Google Scholar] [CrossRef]
- Li, J.; Zheng, S.J. Role of MicroRNAs in Host Defense against Infectious Bursal Disease Virus (IBDV) Infection: A Hidden Front Line. Viruses 2020, 12, 543. [Google Scholar] [CrossRef]
- Ingrao, F.; Rauw, F.; Lambrecht, B.; van den Berg, T. Infectious Bursal Disease: A complex host-pathogen interaction. Dev. Comp. Immunol. 2013, 41, 429–438. [Google Scholar] [CrossRef]
- Spies, U.; Muller, H.; Becht, H. Nucleotide sequence of infectious bursal disease virus genome segment A delineates two major open reading frames. Nucleic Acids Res. 1989, 17, 7982. [Google Scholar] [CrossRef]
- Qiao, Q.; Song, M.; Song, C.; Zhang, Y.; Wang, X.; Huang, Q.; Wang, B.; Yang, P.; Zhao, S.; Li, Y.; et al. Single-Dose Vaccination of Recombinant Chimeric Newcastle Disease Virus (NDV) LaSota Vaccine Strain Expressing Infectious Bursal Disease Virus (IBDV) VP2 Gene Provides Full Protection against Genotype VII NDV and IBDV Challenge. Vaccines 2021, 9, 1483. [Google Scholar] [CrossRef]
- Lee, M.S.; Doong, S.R.; Lai, S.Y.; Ho, J.Y.; Wang, M.Y. Processing of infectious bursal disease virus (IBDV) polyprotein and self-assembly of IBDV-like particles in Hi-5 cells. Biotechnol. Progr. 2006, 22, 763–769. [Google Scholar] [CrossRef]
- Ona, A.; Luque, D.; Abaitua, F.; Maraver, A.; Caston, J.R.; Rodriguez, J.F. The C-terminal domain of the pVP2 precursor is essential for the interaction between VP2 and VP3, the capsid polypeptides of infectious bursal disease virus. Virology 2004, 322, 135–142. [Google Scholar] [CrossRef]
- Guo, X.; Sun, W.; Wei, L.; Wang, X.; Zou, Y.; Zhang, Y.; Li, S.; Wang, N.; Jiang, M.; Zhao, H.; et al. Development and evaluation of a recombinant VP2 neutralizing epitope antigen vaccine candidate for infectious bursal disease virus. Transbound. Emerg. Dis. 2021, 68, 3658–3675. [Google Scholar] [CrossRef]
- Boot, H.J.; ter Huurne, A.A.; Hoekman, A.J.; Peeters, B.P.; Gielkens, A.L. Rescue of very virulent and mosaic infectious bursal disease virus from cloned cDNA: VP2 is not the sole determinant of the very virulent phenotype. J. Virol. 2000, 74, 6701–6711. [Google Scholar] [CrossRef]
- Letzel, T.; Coulibaly, F.; Rey, F.A.; Delmas, B.; Jagt, E.; van Loon, A.A.; Mundt, E. Molecular and structural bases for the antigenicity of VP2 of infectious bursal disease virus. J. Virol. 2007, 81, 12827–12835. [Google Scholar] [CrossRef]
- Chang, J. Adenovirus Vectors: Excellent Tools for Vaccine Development. Immune Netw. 2021, 21, e6. [Google Scholar] [CrossRef]
- Liu, H.; Wu, R.; Liu, K.; Yuan, L.; Huang, X.; Wen, Y.; Ma, X.; Yan, Q.; Zhao, Q.; Wen, X.; et al. Enhanced immune responses against Japanese encephalitis virus using recombinant adenoviruses coexpressing Japanese encephalitis virus envelope and porcine interleukin-6 proteins in mice. Virus Res. 2016, 222, 34–40. [Google Scholar] [CrossRef]
- Ambriovic, A.; Adam, M.; Monteil, M.; Paulin, D.; Eloit, M. Efficacy of replication-defective adenovirus-vectored vaccines: Protection following intramuscular injection is linked to promoter efficiency in muscle representative cells. Virology 1997, 238, 327–335. [Google Scholar] [CrossRef]
- Wang, N.; Huang, M.; Fung, T.S.; Luo, Q.; Ye, J.X.; Du, Q.R.; Wen, L.H.; Liu, D.X.; Chen, R.A. Rapid Development of an Effective Newcastle Disease Virus Vaccine Candidate by Attenuation of a Genotype VII Velogenic Isolate Using a Simple Infectious Cloning System. Front. Vet. Sci. 2020, 7, 648. [Google Scholar] [CrossRef]
- Taghavian, O.; Spiegel, H.; Hauck, R.; Hafez, H.M.; Fischer, R.; Schillberg, S. Protective oral vaccination against infectious bursal disease virus using the major viral antigenic protein VP2 produced in Pichia pastoris. PLoS ONE 2013, 8, e83210. [Google Scholar] [CrossRef] [PubMed]
- Szymczak, A.L.; Workman, C.J.; Wang, Y.; Vignali, K.M.; Dilioglou, S.; Vanin, E.F.; Vignali, D.A. Correction of multi-gene deficiency in vivo using a single ‘self-cleaving’ 2A peptide-based retroviral vector. Nat. Biotechnol. 2004, 22, 589–594. [Google Scholar] [CrossRef]
- Chng, J.; Wang, T.; Nian, R.; Lau, A.; Hoi, K.M.; Ho, S.C.; Gagnon, P.; Bi, X.; Yang, Y. Cleavage efficient 2A peptides for high level monoclonal antibody expression in CHO cells. Mabs-Austin 2015, 7, 403–412. [Google Scholar] [CrossRef]
- Torti, C.; Prosperi, M.; Motta, D.; Digiambenedetto, S.; Maggiolo, F.; Paraninfo, G.; Ripamonti, D.; Cologni, G.; Fabbiani, M.; Caputo, S.L.; et al. Factors influencing the normalization of CD4+ T-cell count, percentage and CD4+/CD8+ T-cell ratio in HIV-infected patients on long-term suppressive antiretroviral therapy. Clin. Microbiol. Infect. 2012, 18, 449–458. [Google Scholar] [CrossRef] [PubMed]
- Xiang, B.; Chen, L.; Cai, J.; Liang, J.; Lin, Q.; Xu, C.; Ding, C.; Liao, M.; Ren, T. Insights into Genomic Epidemiology, Evolution, and Transmission Dynamics of Genotype VII of Class II Newcastle Disease Virus in China. Pathogens 2020, 9, 837. [Google Scholar] [CrossRef]
- Fan, L.; Wu, T.; Hussain, A.; Gao, Y.; Zeng, X.; Wang, Y.; Gao, L.; Li, K.; Wang, Y.; Liu, C.; et al. Novel variant strains of infectious bursal disease virus isolated in China. Vet. Microbiol. 2019, 230, 212–220. [Google Scholar] [CrossRef]
- Xu, A.; Pei, Y.; Zhang, K.; Xue, J.; Ruan, S.; Zhang, G. Phylogenetic analyses and pathogenicity of a variant infectious bursal disease virus strain isolated in China. Virus Res. 2020, 276, 197833. [Google Scholar] [CrossRef] [PubMed]
- Havenga, M.; Vogels, R.; Zuijdgeest, D.; Radosevic, K.; Mueller, S.; Sieuwerts, M.; Weichold, F.; Damen, I.; Kaspers, J.; Lemckert, A.; et al. Novel replication-incompetent adenoviral B-group vectors: High vector stability and yield in PER.C6 cells. J. Gen. Virol. 2006, 87, 2135–2143. [Google Scholar] [CrossRef]
- Yang, Z.Y.; Kong, W.P.; Huang, Y.; Roberts, A.; Murphy, B.R.; Subbarao, K.; Nabel, G.J. A DNA vaccine induces SARS coronavirus neutralization and protective immunity in mice. Nature 2004, 428, 561–564. [Google Scholar] [CrossRef]
- Sullivan, N.J.; Geisbert, T.W.; Geisbert, J.B.; Shedlock, D.J.; Xu, L.; Lamoreaux, L.; Custers, J.H.; Popernack, P.M.; Yang, Z.Y.; Pau, M.G.; et al. Immune protection of nonhuman primates against Ebola virus with single low-dose adenovirus vectors encoding modified GPs. PLoS Med. 2006, 3, e177. [Google Scholar] [CrossRef]
- Gao, W.; Soloff, A.C.; Lu, X.; Montecalvo, A.; Nguyen, D.C.; Matsuoka, Y.; Robbins, P.D.; Swayne, D.E.; Donis, R.O.; Katz, J.M.; et al. Protection of mice and poultry from lethal H5N1 avian influenza virus through adenovirus-based immunization. J. Virol. 2006, 80, 1959–1964. [Google Scholar] [CrossRef] [PubMed]
- Zhu, J.; Huang, X.; Yang, Y. Innate immune response to adenoviral vectors is mediated by both Toll-like receptor-dependent and -independent pathways. J. Virol. 2007, 81, 3170–3180. [Google Scholar] [CrossRef] [PubMed]
- Sharma, A.; Tandon, M.; Ahi, Y.S.; Bangari, D.S.; Vemulapalli, R.; Mittal, S.K. Evaluation of cross-reactive cell-mediated immune responses among human, bovine and porcine adenoviruses. Gene Ther. 2010, 17, 634–642. [Google Scholar] [CrossRef] [PubMed]
- Zhu, F.C.; Wurie, A.H.; Hou, L.H.; Liang, Q.; Li, Y.H.; Russell, J.B.; Wu, S.P.; Li, J.X.; Hu, Y.M.; Guo, Q.; et al. Safety and immunogenicity of a recombinant adenovirus type-5 vector-based Ebola vaccine in healthy adults in Sierra Leone: A single-centre, randomised, double-blind, placebo-controlled, phase 2 trial. Lancet 2017, 389, 621–628. [Google Scholar] [CrossRef]
- Vemula, S.V.; Mittal, S.K. Production of adenovirus vectors and their use as a delivery system for influenza vaccines. Expert Opin. Biol. Ther. 2010, 10, 1469–1487. [Google Scholar] [CrossRef]
- Imperiale, M.J.; Kochanek, S. Adenovirus vectors: Biology, design, and production. Curr. Top. Microbiol. 2004, 273, 335–357. [Google Scholar] [CrossRef]
- Li, D.; Du, Q.; Wu, B.; Li, J.; Chang, L.; Zhao, X.; Huang, Y.; Tong, D. Immunogenicity of adenovirus vaccines expressing the PCV2 capsid protein in pigs. Vaccine 2017, 35, 4722–4729. [Google Scholar] [CrossRef] [PubMed]
- Hassan, A.O.; Amen, O.; Sayedahmed, E.E.; Vemula, S.V.; Amoah, S.; York, I.; Gangappa, S.; Sambhara, S.; Mittal, S.K. Adenovirus vector-based multi-epitope vaccine provides partial protection against H5, H7, and H9 avian influenza viruses. PLoS ONE 2017, 12, e186244. [Google Scholar] [CrossRef]
- Tang, J.; Yin, D.; Wang, R.; Zhou, Q.; Zhou, X.; Xing, X.; Liu, H.M.; Liu, G.; Wang, G. A recombinant adenovirus expressing the E protein of duck Tembusu virus induces protective immunity in duck. J. Vet. Med. Sci. 2019, 81, 314–320. [Google Scholar] [CrossRef]
- Zhao, Y.; Han, Z.; Zhang, X.; Zhang, X.; Sun, J.; Ma, D.; Liu, S. Construction and immune protection evaluation of recombinant virus expressing Newcastle disease virus F protein by the largest intergenic region of fowlpox virus NX10. Virus Genes 2020, 56, 734–748. [Google Scholar] [CrossRef]
- Jia, W.; Zhang, X.; Wang, H.; Teng, Q.; Xue, J.; Zhang, G. Construction and immune efficacy of a recombinant turkey herpesvirus vaccine strain expressing fusion protein of genotype VII Newcastle disease virus. Vet. Microbiol. 2022, 268, 109429. [Google Scholar] [CrossRef] [PubMed]
- Ge, J.; Liu, Y.; Jin, L.; Gao, D.; Bai, C.; Ping, W. Construction of recombinant baculovirus vaccines for Newcastle disease virus and an assessment of their immunogenicity. J. Biotechnol. 2016, 231, 201–211. [Google Scholar] [CrossRef] [PubMed]
- Wei, X.; Shao, Y.; Han, Z.; Sun, J.; Liu, S. Glycoprotein-C-gene-deleted recombinant infectious laryngotracheitis virus expressing a genotype VII Newcastle disease virus fusion protein protects against virulent infectious laryngotracheitis virus and Newcastle disease virus. Vet. Microbiol. 2020, 250, 108835. [Google Scholar] [CrossRef] [PubMed]
- Ferreira, H.L.; Miller, P.J.; Suarez, D.L. Protection against Different Genotypes of Newcastle Disease Viruses (NDV) Afforded by an Adenovirus-Vectored Fusion Protein and Live NDV Vaccines in Chickens. Vaccines 2021, 9, 182. [Google Scholar] [CrossRef]
- Kurukulasuriya, S.; Ahmed, K.A.; Ojkic, D.; Gunawardana, T.; Goonewardene, K.; Gupta, A.; Chow-Lockerbie, B.; Popowich, S.; Willson, P.; Tikoo, S.K.; et al. Modified live infectious bursal disease virus (IBDV) vaccine delays infection of neonatal broiler chickens with variant IBDV compared to turkey herpesvirus (HVT)-IBDV vectored vaccine. Vaccine 2017, 35, 882–888. [Google Scholar] [CrossRef]
- Yang, S.; Cohen, C.J.; Peng, P.D.; Zhao, Y.; Cassard, L.; Yu, Z.; Zheng, Z.; Jones, S.; Restifo, N.P.; Rosenberg, S.A.; et al. Development of optimal bicistronic lentiviral vectors facilitates high-level TCR gene expression and robust tumor cell recognition. Gene Ther. 2008, 15, 1411–1423. [Google Scholar] [CrossRef]
- Tan, Y.; Liang, H.; Chen, A.; Guo, X. Coexpression of double or triple copies of the rabies virus glycoprotein gene using a ‘self-cleaving’ 2A peptide-based replication-defective human adenovirus serotype 5 vector. Biologicals 2010, 38, 586–593. [Google Scholar] [CrossRef]
Primer | Sequence(5′–3′) | Fragment Length/bp |
---|---|---|
F-F | ATGGGCTCCAAACCTTCTACC | 1662 |
F-R | TCATGCTCTCATGGTGGCTC | |
VP2-F | ATGACAAACCTGCAAGATC | 1356 |
VP2-R | CCTTATGGCCCGGATTATGTC | |
H-F-F | CGCTAGAGATCTGGTACCGTCGACGCCACCATGG GCTCCAAACCTTCTAC | 1740 |
H-F-R | CTTATCTAGAAGCTTAGGCTCGAGTCACTTATCA TCGTCGTCCTTGTAGTCTGCTCTCATGGTGGCTCT | |
H-VP2-F | TCAGATCCGCTAGAGATCTGGTACCGTCGACGC CACCATGACAAACCTGCAAGATC | 1424 |
H-VP2-R | CGGATATCTTATCTAGAAGCTTAGGCTCGAGCC TTATGGCCCGGATTATGTC | |
P1 | TAGAGATCTGGTACCGTCGACGCCACCATGACA AAC | 1415 |
P2 | GCCAACTTGAGCAGGTCGAAGTTGCCGCTGCCC CTTATGGCCCGGATTATGTC | |
P3 | CCTGCTCAAGTTGGCCGGAGACGTTGAGTCCAA CCCTGGGCCCATGGGCTCCAAACC | 1753 |
H-F-R | CTTATCTAGAAGCTTAGGCTCGAGTCACTTATCA TCGTCGTCCTTGTAGTCTGCTCTCATGGTGGCTCT |
Isolator No. | Name of Immune Reagents | Immunization Dose (per Chick) | Number of SPF Chicks |
---|---|---|---|
1 | HVT-VP2 vector vaccines | 0.2 mL | 7 |
2 | rAd5-VP2 | 108 IFU/0.2 mL | 7 |
3 | rAd5-VP2-F2A-F | 108 IFU/0.2 mL | 14 |
4 | rDHN3-mF | 106 EID50 | 7 |
5 | rAd5-F | 108 IFU/0.2 mL | 7 |
6 | rAd5-EGFP | 108 IFU/0.2 mL | 14 |
7 | PBS | 0.2 mL | 14 |
8 | Control | Not immune to any reagent | 14 |
Group | 3 dpc | 5 dpc | 7 dpc | |||
---|---|---|---|---|---|---|
Oropharynx | Cloaca | Oropharynx | Cloaca | Oropharynx | Cloaca | |
Control | 0/7 | 0/7 | 0/7 | 0/7 | 0/7 | 0/7 |
rDHN3-mF | 0/7 | 0/7 | 0/7 | 0/7 | 0/7 | 0/7 |
rAd5-F | 2/7 | 1/7 | 1/7 | 1/7 | 1/7 | 1/7 |
rAd5-VP2-F2A-F | 2/7 | 2/7 | 2/7 | 1/7 | 1/7 | 1/7 |
rAd5-EGFP | 7/7 | 7/7 | 7/7 | 7/7 | 1/1 | 1/1 |
PBS | 7/7 | 7/7 | 7/7 | 7/7 | NA | NA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xu, T.; Xiong, T.; Xie, W.; Wu, J.; Liu, X.; Li, G.; Lv, Y.; Li, L.; Yang, Z.; Wang, H.; et al. Construction and Evaluation of the Immunogenicity and Protective Efficacy of Recombinant Replication-Deficient Human Adenovirus-5 Expressing Genotype VII Newcastle Disease Virus F Protein and Infectious Bursal Disease Virus VP2 Protein. Vaccines 2023, 11, 1051. https://doi.org/10.3390/vaccines11061051
Xu T, Xiong T, Xie W, Wu J, Liu X, Li G, Lv Y, Li L, Yang Z, Wang H, et al. Construction and Evaluation of the Immunogenicity and Protective Efficacy of Recombinant Replication-Deficient Human Adenovirus-5 Expressing Genotype VII Newcastle Disease Virus F Protein and Infectious Bursal Disease Virus VP2 Protein. Vaccines. 2023; 11(6):1051. https://doi.org/10.3390/vaccines11061051
Chicago/Turabian StyleXu, Ting, Ting Xiong, Wenting Xie, Jing Wu, Xiao Liu, Guimin Li, Yadi Lv, Linyu Li, Zekun Yang, Han Wang, and et al. 2023. "Construction and Evaluation of the Immunogenicity and Protective Efficacy of Recombinant Replication-Deficient Human Adenovirus-5 Expressing Genotype VII Newcastle Disease Virus F Protein and Infectious Bursal Disease Virus VP2 Protein" Vaccines 11, no. 6: 1051. https://doi.org/10.3390/vaccines11061051
APA StyleXu, T., Xiong, T., Xie, W., Wu, J., Liu, X., Li, G., Lv, Y., Li, L., Yang, Z., Wang, H., Liu, D., & Chen, R. (2023). Construction and Evaluation of the Immunogenicity and Protective Efficacy of Recombinant Replication-Deficient Human Adenovirus-5 Expressing Genotype VII Newcastle Disease Virus F Protein and Infectious Bursal Disease Virus VP2 Protein. Vaccines, 11(6), 1051. https://doi.org/10.3390/vaccines11061051