Activity of Antioxidants from Crocus sativus L. Petals: Potential Preventive Effects towards Cardiovascular System
Abstract
1. Introduction
2. Materials and Methods
2.1. Chemistry
2.1.1. Plant Material
2.1.2. Extraction and Purification
2.1.3. Chemical Analyses
2.1.4. Quantification of Crocin and Kaempferol
2.2. Ex Vivo Guinea Pig Assay
2.2.1. Atria
2.2.2. Aortic Strips
2.2.3. Ileum
2.2.4. Statistical Analysis
2.3. In Vitro Antioxidant Activity Assay
2.3.1. Cell Culture and Treatments
2.3.2. ROS Detection
2.3.3. Cell Viability Assay
2.3.4. Total Antioxidant Activity (TAA)
2.3.5. Real-Time Polymerase Chain Reaction (PCR) Assay
3. Results
3.1. Chemistry
3.2. Effects of SPE, Crocin and Kaempferol towards Cardiac and Smooth Muscle System
3.3. Effects of Crocin and Kaempferol on H9c2 Cellular Viability
4. Discussion
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Micucci, M.; Bolchi, C.; Budriesi, R.; Cevenini, M.; Maroni, L.; Capozza, S.; Chiarini, A.; Pallavicini, M.; Angeletti, A. Antihypertensive phytocomplexes of proven efficacy and well-established use: Mode of action and individual characterization of the active constituents. Phytochemistry 2020, 170, 112222. [Google Scholar] [CrossRef] [PubMed]
- Fallah Huseini, H.; Fakhrzadeh, H.; Larijani, B.; Shikh Samani, A.H. Review of anti-diabetic medicinal plant used in traditional medicine. J. Med. Plants 2006, 1, 1–8. [Google Scholar]
- Ciudad-Mulero, M.; Matallana-González, M.C.; Hurtado, M.C.; Fernández-Ruiz, V.; Morales, P. Antioxidant Phytochemicals in Pulses and their Relation to Human Health: A Review. Curr. Pharm. Des. 2020, 26, 1880–1897. [Google Scholar] [CrossRef] [PubMed]
- WHO Guidelines; WHO: Geneva, Switzerland, 2019.
- Micucci, M.; Malaguti, M.; Gallina Toschi, T.; Di Lecce, G.; Aldini, R.; Angeletti, A.; Chiarini, A.; Budriesi, R.; Hrelia, S. Cardiac and Vascular Synergic Protective Effect of Olea europea L. Leaves and Hibiscus sabdariffa L. Flower Extracts. Oxidative Med. Cell. Longev. 2015, 2015, 318125. [Google Scholar] [CrossRef]
- Chiarini, A.; Micucci, M.; Malaguti, M.; Budriesi, R.; Ioan, P.; Lenzi, M.; Fimognari, C.; Toschi, T.G.; Comandini, P.; Hrelia, S. Sweet Chestnut (Castanea sativa Mill.) Bark Extract: Cardiovascular Activity and Myocyte Protection against Oxidative Damage. Oxidative Med. Cell. Longev. 2013, 2013, 1–10. [Google Scholar] [CrossRef]
- Zeka, K.; Ruparelia, K.; Arroo, R.R.J.; Budriesi, R.; Micucci, M. Flavonoids and Their Metabolites: Prevention in Cardiovascular Diseases and Diabetes. Diseases 2017, 5, 19. [Google Scholar] [CrossRef]
- Farzaei, M.; Singh, A.K.; Kumar, R.; Croley, C.R.; Pandey, A.K.; Coy-Barrera, E.; Patra, J.K.; Das, G.; Kerry, R.G.; Annunziata, G.; et al. Targeting Inflammation by Flavonoids: Novel Therapeutic Strategy for Metabolic Disorders. Int. J. Mol. Sci. 2019, 20, 4957. [Google Scholar] [CrossRef] [PubMed]
- Eggersdorfer, M.; Wyss, A. Carotenoids in human nutrition and health. Arch. Biochem. Biophys. 2018, 652, 18–26. [Google Scholar] [CrossRef]
- Ghaffari, S.; Roshanravan, N. Saffron; An updated review on biological properties with special focus on cardiovascular effects. Biomed. Pharmacother. 2019, 109, 21–27. [Google Scholar] [CrossRef]
- Budriesi, R.; Vivarelli, F.; Canistro, D.; Aldini, R.; Babot, C.; Corazza, I.; Fato, R.; Cirillo, S.; Bergamini, C.; D’Errico, A.; et al. Liver and intestinal protective effects of Castanea sativa Mill. bark extract in high-fat diet rats. PLoS ONE 2018, 13, e0201540. [Google Scholar] [CrossRef]
- Jiang, T.A. Health Benefits of Culinary Herbs and Spices. J. AOAC Int. 2019, 102, 395–411. [Google Scholar] [CrossRef] [PubMed]
- Hosseinzadeh, H.; Nassiri-Asl, M. Avicenna’s (Ibn Sina) the canon of medicine and saffron (Crocus sativus): A review. Phytother Res. 2013, 27, 475–483. [Google Scholar] [CrossRef] [PubMed]
- Christodoulou, E.; Kadoglou, N.P.; Kostomitsopoulos, N.; Valsami, G. Saffron: A natural product with potential pharmaceutical applications. J. Pharm. Pharmacol. 2015, 67, 1634–1649. [Google Scholar] [CrossRef] [PubMed]
- Zeka, K.; Ruparelia, K.C.; Continenza, M.A.; Stagos, D.; Vegliò, F.; Arroo, R.R. Petals of Crocus sativus L. as a potential source of the antioxidants crocin and kaempferol. Fitoterapia 2015, 107, 128–134. [Google Scholar] [CrossRef]
- Zeka, K.; Ruparelia, K.C.; Sansone, C.; Macchiarelli, G.; Continenza, M.A.; Arroo, R.R. New Hydrogels Enriched with Antioxidants from Saffron Crocus Can Find Applications in Wound Treatment and/or Beautification. Skin Pharmacol. Physiol. 2018, 31, 95–98. [Google Scholar] [CrossRef]
- Rahmani, J.; Manzari, N.; Thompson, J.; Clark, C.C.T.; Villanueva, G.; Kord-Varkaneh, H.; Mirmiran, P. The effect of saffron on weight and lipid profile: A systematic review, meta-analysis, and dose-response of randomized clinical trials. Phytother. Res. 2019, 33, 2244–2255. [Google Scholar] [CrossRef] [PubMed]
- Aleali, A.M.; Amani, R.; Shahbazian, H.; Namjooyan, F.; Latifi, S.M.; Cheraghian, B. The effect of hydroalcoholic Saffron (Crocus sativus L.) extract on fasting plasma glucose, HbA1c, lipid profile, liver, and renal function tests in patients with type 2 diabetes mellitus: A randomized double-blind clinical trial. Phytother. Res. 2019, 33, 1648–1657. [Google Scholar] [CrossRef]
- Khoddami, A.; Wilkes, M.A.; Roberts, T.H. Techniques for Analysis of Plant Phenolic Compounds. Molecules 2013, 18, 2328–2375. [Google Scholar] [CrossRef]
- Hassani, F.V.; Naseri, V.; Razavi, B.M.; Mehri, S.; Abnous, K.; Hosseinzadeh, H. Antidepressant effects of crocin and its effects on transcript and protein levels of CREB, BDNF, and VGF in rat hippocampus. DARU J. Pharm. Sci. 2014, 22, 16. [Google Scholar] [CrossRef] [PubMed]
- Carmona, M.; Sanchez, A.M.; Ferreres, F.; Zalacain, A.; Tomás-Barberán, F.; Alonso, G.L. Identification of the flavonoid fraction in saffron spice by LC/DAD/MS/MS: Comparative study of samples from different geographical origins. Food Chem. 2007, 100, 445–450. [Google Scholar] [CrossRef]
- Carosati, E.; Budriesi, R.; Ioan, P.; Cruciani, G.; Fusi, F.; Frosini, M.; Saponara, S.; Gasparrini, F.; Ciogli, A.; Villani, C.; et al. Stereoselective behavior of the functional diltiazem analogue 1-[(4-chlorophenyl)sulfonyl]-2-(2-thienyl)pyrrolidine, a new L-type calcium channel blocker. J. Med. Chem. 2009, 52, 6637–6648. [Google Scholar] [CrossRef]
- Micucci, M.; Protti, M.; Aldini, R.; Frosini, M.; Corazza, I.; Marzetti, C.; Mattioli, L.B.; Tocci, G.; Chiarini, A.; Mercolini, L.; et al. Thymus vulgaris L. Essential Oil Solid Formulation: Chemical Profile and Spasmolytic and Antimicrobial Effects. Biomolecules 2020, 10, 860. [Google Scholar] [CrossRef]
- Hill, I.D.; Tallarida, R.J.; Murray, R.B. Manual of Pharmacologic Calculations with Computer Programs. J. R. Stat. Soc. Ser. C Appl. Stat. 1982, 31, 307. [Google Scholar] [CrossRef]
- Motulsky, H.; Christopoulos, A. Fitting Models to Biological Data Using Linear and Non Linear Regression. 2003. Available online: https://www.facm.ucl.ac.be/cooperation/Vietnam/WBI-Vietnam-October-2011/Modelling/RegressionBook.pdf (accessed on 17 June 2020).
- Motulsky, H.J. Prism 5 Statistics Guide; GraphPad Software Inc.: San Diego, CA, USA, 2007; Available online: https://cdn.graphpad.com/faq/2/file/Prism_v5_Statistics_Guide.pdf (accessed on 17 June 2020).
- Angeloni, C.; Hrelia, S. Quercetin Reduces Inflammatory Responses in LPS-Stimulated Cardiomyoblasts. Oxidative Med. Cell. Longev. 2012, 2012, 1–8. [Google Scholar] [CrossRef]
- Giusti, L.; Angeloni, C.; Barbalace, M.C.; Lacerenza, S.; Ciregia, F.; Ronci, M.; Urbani, A.; Manera, C.; Digiacomo, M.; Macchia, M.; et al. A Proteomic Approach to Uncover Neuroprotective Mechanisms of Oleocanthal against Oxidative Stress. Int. J. Mol. Sci. 2018, 19, 2329. [Google Scholar] [CrossRef]
- Re, R.; Pellegrini, N.; Proteggente, A.; Pannala, A.; Yang, M.; Rice-Evans, C. Antioxidant activity applying an improved ABTS radical cation decolorization assay. Free. Radic. Biol. Med. 1999, 26, 1231–1237. [Google Scholar] [CrossRef]
- Hrelia, S.; Fiorentini, D.; Maraldi, T.; Angeloni, C.; Bordoni, A.; Biagi, P.L.; Hakim, G. Doxorubicin induces early lipid peroxidation associated with changes in glucose transport in cultured cardiomyocytes. Biochim. Biophys. Acta (BBA) Biomembr. 2002, 1567, 150–156. [Google Scholar] [CrossRef]
- Ioan, P.; Carosati, E.; Micucci, M.; Cruciani, G.; Broccatelli, F.; Zhorov, B.S.; Chiarini, A.; Budriesi, R. 1,4-Dihydropyridine scaffold in medicinal chemistry, the story so far and perspectives (part 1): Action in ion channels and GPCRs. Curr. Med. Chem. 2011, 18, 4901–4922. [Google Scholar] [CrossRef]
- Carosati, E.; Ioan, P.; Micucci, M.; Broccatelli, F.; Cruciani, G.; Zhorov, B.; Chiarini, A.; Budriesi, R. 1,4-Dihydropyridine Scaffold in Medicinal Chemistry, The Story So Far And Perspectives (Part 2): Action in Other Targets and Antitargets. Curr. Med. Chem. 2012, 19, 4306–4323. [Google Scholar] [CrossRef]
- Nudelman, V.; Zahalka, M.A.; Nudelman, A.; Rephaeli, A.; Kessler-Icekson, G. Cardioprotection by AN-7, a prodrug of the histone deacetylase inhibitor butyric acid: Selective activity in hypoxic cardiomyocytes and cardiofibroblasts. Eur. J. Pharmacol. 2020, 882, 173255. [Google Scholar] [CrossRef]
- Talukder, M.A.H.; Johnson, W.M.; Varadharaj, S.; Lian, J.; Kearns, P.N.; El-Mahdy, M.A.; Liu, X.; Zweier, J.L. Chronic cigarette smoking causes hypertension, increased oxidative stress, impaired NO bioavailability, endothelial dysfunction, and cardiac remodeling in mice. Am. J. Physiol. Circ. Physiol. 2011, 300, H388–H396. [Google Scholar] [CrossRef]
- Malaguti, M.; Angeloni, C.; Hrelia, S. Nutraceutical Bioactive Compounds Promote Healthspan Counteracting Cardiovascular Diseases. J. Am. Coll. Nutr. 2015, 34, 22–27. [Google Scholar] [CrossRef] [PubMed]
- Alfa, H.H.; Arroo, R.R.J. Over 3 decades of research on dietary flavonoid antioxidants and cancer prevention: What have we achieved? Phytochem. Rev. 2019, 18, 989–1004. [Google Scholar] [CrossRef]
- Imenshahidi, M.; Hosseinzadeh, H.; Javadpour, Y. Hypotensive effect of aqueous saffron extract (Crocus sativus L.) and its constituents, safranal and crocin, in normotensive and hypertensive rats. Phytother. Res. 2010, 24, 990–994. [Google Scholar] [CrossRef]
- Shafei, M.N.; Faramarzi, A.; Rad, A.K.; Anaeigoudari, A. Crocin prevents acute angiotensin II-induced hypertension in anesthetized rats. Avicenna J. Phytomed. 2017, 7, 345–352. [Google Scholar] [CrossRef]
- Plangar, A.F.; Anaeigoudari, A.; Khajavirad, A.; Shafei, M.N. Beneficial Cardiovascular Effects of Hydroalcoholic Extract from Crocus Sativus in Hypertension Induced by Angiotensin II. J. Pharmacopunct. 2019, 22, 95–101. [Google Scholar] [CrossRef]
- Liu, T.; Chu, X.; Wang, H.; Zhang, X.; Zhang, Y.; Guo, H.; Liu, Z.; Dong, Y.; Liu, H.; Liu, Y.; et al. Crocin, a carotenoid component of Crocus cativus, exerts inhibitory effects on L-type Ca2+ current, Ca2+ transient, and contractility in rat ventricular myocytes. Can. J. Physiol. Pharmacol. 2016, 94, 302–308. [Google Scholar] [CrossRef]
- Fatehi-Hassanabad, Z.; Rashidabady, T.; Fatehi-Hassanabad, Z. Effects of Crocus sativus petals’ extract on rat blood pressure and on responses induced by electrical field stimulation in the rat isolated vas deferens and guinea-pig ileum. J. Ethnopharmacol. 2003, 84, 199–203. [Google Scholar] [CrossRef]
- Karkoula, E.; Lemonakis, N.; Kokras, N.; Dalla, C.; Gikas, E.; Skaltsounis, A.-L.; Tsarbopoulos, A. Trans-crocin 4 is not hydrolyzed to crocetin following i.p. administration in mice, while it shows penetration through the blood brain barrier. Fitoterapia 2018, 129, 62–72. [Google Scholar] [CrossRef]
- Colombo, M.; Melchiades, G.D.L.; Michels, L.R.; Figueiró, F.; Bassani, V.L.; Teixeira, H.F.; Koester, L.S. Solid Dispersion of Kaempferol: Formulation Development, Characterization, and Oral Bioavailability Assessment. AAPS PharmSciTech 2019, 20, 106. [Google Scholar] [CrossRef]
- Rahim, V.B.; Khammar, M.T.; Rakhshandeh, H.; Samzadeh-Kermani, A.; Hosseini, A.; Askari, V.R.; Rahimi, V.B. Crocin protects cardiomyocytes against LPS-Induced inflammation. Pharmacol. Rep. 2019, 71, 1228–1234. [Google Scholar] [CrossRef]
- Wang, X.; Yuan, B.; Cheng, B.; Liu, Y.; Zhang, B.; Wang, X.; Lin, X.; Yang, B.; Gong, G. Crocin Alleviates Myocardial Ischemia/Reperfusion-Induced Endoplasmic Reticulum Stress via Regulation of miR-34a/Sirt1/Nrf2 Pathway. Shock 2019, 51, 123–130. [Google Scholar] [CrossRef]
- Choi, E.M. Kaempferol protects MC3T3-E1 cells through antioxidant effect and regulation of mitochondrial function. Food Chem. Toxicol. 2011, 49, 1800–1805. [Google Scholar] [CrossRef] [PubMed]
- Li, L.; Shao, Y.; Zheng, H.; Niu, H. Kaempferol regulates mir-15b/bcl-2/tlr4 to alleviate ogd-induced injury in h9c2 cells. Int. Heart J. 2020, 61, 585–594. [Google Scholar] [CrossRef]
- Santos, C.X.; Anilkumar, N.; Zhang, M.; Brewer, A.C.; Shah, A.M. Redox signaling in cardiac myocytes. Free Radic. Biol. Med. 2011, 50, 777–793. [Google Scholar] [CrossRef]









| Gene | Primer |
|---|---|
| β-actin forward | AAGACCTCTATGCCAACAC |
| β-actin reverse | TGATCTTCATGGTGCTAGG |
| Nrf2 forward | CCATTTGTAGATGACCATGAG |
| Nrf2 reverse | GTATTAAGACACTGTAACTCGG |
| CAT forward | CAAGTTCCATTACAAGACTGAC |
| CAT reverse | TTAAATGGGAAGGTTTCTGC |
| Left Atrium | Right Atrium | |||||
|---|---|---|---|---|---|---|
| Negative Inotropy | Negative Inotropy | Negative Chronotropy | ||||
| Samples | Unit | Activity a M ± S.E.M. | EC50 b | 95% conf int | Activity cM ± S.E.M. | Activity dM ± S.E.M. |
| SPE | 36 ± 0.9 | 40 ± 1.4 | ||||
| [µM] | [--] | [--] | ||||
| (mg/mL) | (1) | (10) | ||||
| Crocin | 73 ± 1.9 | 25 ± 1.2 | 20 ± 1.3 | |||
| [µM] | [5] | 0.17 | 0.12–0.23 | [100] | [100] | |
| (mg/mL) | (0.0048) | (0.00017) | (0.00012–0.00022) | (0.097) | (0.097) | |
| Kaempferol | 87 ± 2.1 | 29 ± 1.1 | 30 ± 0.9 | |||
| [µM] | [5] | 0.15 | 0.083–0.63 | [5] | [50] | |
| (mg/mL) | (0.0014) | (0.000043) | (0.000024–0.00018) | (0.0014) | (0.0014) | |
| Vascular | Non-Vascular | |||||||
|---|---|---|---|---|---|---|---|---|
| Aorta | Ileum | |||||||
| K+ 40 mM | K+ 80 mM | K+ 80 mM | ||||||
| Samples | Unit | Activity a M ± S.E.M. | Activity a M ± S.E.M. | EC50 b | 95% conf int | Activity a M ± S.E.M. | EC50 b | 95% conf lim |
| SPE | 48 ± 1.3 | 89 ± 2.4 | 2.05 | 1.36–3.10 | ||||
| [µM] | [--] | [--] | ||||||
| (mg/mL) | (10) | (10) | ||||||
| Crocin | 3 ± 0.1 | 15 ± 0.3 | ||||||
| [µM] | [50] | [100] | ||||||
| (mg/mL) | (0.0049) | (0.098) | ||||||
| Kaempferol | 42 ± 1.6 | 69 ± 1.9 | 79 ± 2.4 | |||||
| [µM] | [50] | [50] | 20.76 | 12.58–29.37 | [5] | 1.16 | 0.77–2.36 | |
| (mg/mL) | (0.014) | (0.014) | (0.0059) | (0.0036–0.0084) | (0.014) | (0.00033) | (0.00022–0.00068) | |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zeka, K.; Marrazzo, P.; Micucci, M.; Ruparelia, K.C.; Arroo, R.R.J.; Macchiarelli, G.; Annarita Nottola, S.; Continenza, M.A.; Chiarini, A.; Angeloni, C.; et al. Activity of Antioxidants from Crocus sativus L. Petals: Potential Preventive Effects towards Cardiovascular System. Antioxidants 2020, 9, 1102. https://doi.org/10.3390/antiox9111102
Zeka K, Marrazzo P, Micucci M, Ruparelia KC, Arroo RRJ, Macchiarelli G, Annarita Nottola S, Continenza MA, Chiarini A, Angeloni C, et al. Activity of Antioxidants from Crocus sativus L. Petals: Potential Preventive Effects towards Cardiovascular System. Antioxidants. 2020; 9(11):1102. https://doi.org/10.3390/antiox9111102
Chicago/Turabian StyleZeka, Keti, Pasquale Marrazzo, Matteo Micucci, Ketan C. Ruparelia, Randolph R. J. Arroo, Guido Macchiarelli, Stefania Annarita Nottola, Maria Adelaide Continenza, Alberto Chiarini, Cristina Angeloni, and et al. 2020. "Activity of Antioxidants from Crocus sativus L. Petals: Potential Preventive Effects towards Cardiovascular System" Antioxidants 9, no. 11: 1102. https://doi.org/10.3390/antiox9111102
APA StyleZeka, K., Marrazzo, P., Micucci, M., Ruparelia, K. C., Arroo, R. R. J., Macchiarelli, G., Annarita Nottola, S., Continenza, M. A., Chiarini, A., Angeloni, C., Hrelia, S., & Budriesi, R. (2020). Activity of Antioxidants from Crocus sativus L. Petals: Potential Preventive Effects towards Cardiovascular System. Antioxidants, 9(11), 1102. https://doi.org/10.3390/antiox9111102

