Erigeron annuus (L.) Pers. Extract Inhibits Reactive Oxygen Species (ROS) Production and Fat Accumulation in 3T3-L1 Cells by Activating an AMP-Dependent Kinase Signaling Pathway
Abstract
1. Introduction
2. Materials and Methods
2.1. Reagents
2.2. Preparation EAP Extracts
2.3. Cell Culture and Differentiation
2.4. Cell Viability Assay
2.5. NBT Assay and Oil Red O (ORO) Staining
2.6. Real-Time Polymerase Chain Reaction (RT-PCR)
2.7. Analysis of Protein Level
2.8. Statistical Analysis
3. Results
3.1. EAP Water Extract Inhibits Lipid Accumulation and Ros Production in 3t3-l1 Adipocytes
3.2. Effect of EAP Water Extract on Adipogenic and Lipogenic Gene Expressions
3.3. EAP Water Extract Enhances AMPK Phosphorylation and Its Downregulation ACC
4. Discussion
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Kahn, B.B.; Flier, J.S. Obesity and insulin resistance. J. Clin. Investig. 2000, 106, 473–481. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kopelman, P.G. Obesity as a medical problem. Nature 2000, 404, 635–643. [Google Scholar] [CrossRef] [Scilit]
- Harmon, A.W.; Harp, J.B. Differential effects of flavonoids on 3T3-L1 adipogenesis and lipolysis. Am. J. Physiol. Cell Physiol. 2001, 280, C807–C813. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hirosumi, J.; Tuncman, G.; Chang, L.; Gorgun, C.Z.; Uysal, K.T.; Maeda, K.; Karin, M.; Hotamisligil, G.S. A central role for JNK in obesity and insulin resistance. Nature 2002, 420, 333–336. [Google Scholar] [CrossRef] [Scilit]
- Mokdad, A.H.; Ford, E.S.; Bowman, B.A.; Dietz, W.H.; Vinicor, F.; Bales, V.S.; Marks, J.S. Prevalence of obesity, diabetes, and obesity-related health risk factors, 2001. JAMA 2003, 289, 76–79. [Google Scholar] [CrossRef] [Scilit]
- Jeon, W.J.; Oh, J.S.; Park, M.S.; Ji, G.E. Anti-hyperglycemic effect of fermented ginseng in type 2 diabetes mellitus mouse model. Phytother. Res. 2013, 27, 166–172. [Google Scholar] [CrossRef] [Scilit]
- Park, H.J.; Della-Fera, M.A.; Hausman, D.B.; Rayalam, S.; Ambati, S.; Baile, C.A. Genistein inhibits differentiation of primary human adipocytes. J. Nutr. Biochem. 2009, 20, 140–148. [Google Scholar] [CrossRef] [Scilit]
- Xu, H.; Barnes, G.T.; Yang, Q.; Tan, G.; Yang, D.; Chou, C.J.; Sole, J.; Nichols, A.; Ross, J.S.; Tartaglia, L.A.; et al. Chronic inflammation in fat plays a crucial role in the development of obesity-related insulin resistance. J. Clin. Investig. 2003, 112, 1821–1830. [Google Scholar] [CrossRef] [PubMed]
- Lin, J.; Della-Fera, M.A.; Baile, C.A. Green tea polyphenol epigallocatechin gallate inhibits adipogenesis and induces apoptosis in 3T3-L1 adipocytes. Obes. Res. 2005, 13, 982–990. [Google Scholar] [PubMed]
- Rayalam, S.; Della-Fera, M.A.; Baile, C.A. Phytochemicals and regulation of the adipocyte life cycle. J. Nutr. Biochem. 2008, 19, 717–726. [Google Scholar] [CrossRef] [Scilit]
- Park, S.Y.; Hwang, J.T.; Lee, Y.K.; Kim, Y.M.; Park, O.J. AMP-activated Kinase Regulates Adipocyte Differentiation Process in 3T3-L1 Adipocytes Treated with Selenium. J. Life Sci. 2009, 19, 423–428. [Google Scholar]
- Sowers, J.R. Obesity and cardiovascular disease. Clin. Chem. 1998, 44, 1821–1825. [Google Scholar]
- Shojima, N.; Sakoda, H.; Ogihara, T.; Fujishiro, M.; Katagiri, H.; Anai, M.; Onishi, Y.; Ono, H.; Inukai, K.; Abe, M.; et al. Humoral regulation of resistin expression in 3T3-L1 and mouse adipose cells. Diabetes 2002, 51, 1737–1744. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lee, S.J.; Umano, K.; Shibamoto, T.; Lee, K.G. Identification of volatile components in basil (Ocimum basilicum L.) and thyme leaves (Thymus vulgaris L.) and their antioxidant properties. Food Chem. 2005, 91, 131–137. [Google Scholar] [CrossRef] [Scilit]
- Umar, A.; Imam, G.; Yimin, W.; Kerim, P.; Tohti, I.; Berke, B.; Moore, N. Antihypertensive effects of Ocimum basilicum L. (OBL) on blood pressure in renovascular hypertensive rats. Hypertens Res. 2010, 33, 727–730. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Steppan, C.M.; Bailey, S.T.; Bhat, S.; Brown, E.J.; Banerjee, R.R.; Wright, C.M.; Patel, H.R.; Ahima, R.S.; Lazar, M.A. The hormone resistin links obesity to diabetes. Nature 2001, 409, 307–312. [Google Scholar] [CrossRef] [Scilit]
- Turnbaugh, P.J.; Ley, R.E.; Mahowald, M.A.; Magrini, V.; Mardis, E.R.; Gordon, J.I. An obesity-associated gut microbiome with increased capacity for energy harvest. Nature 2006, 444, 1027–1031. [Google Scholar] [CrossRef] [Scilit]
- Iizuka, K.; Miller, B.; Uyeda, K. Deficiency of carbohydrate-activated transcription factor ChREBP prevents obesity and improves plasma glucose control in leptin-deficient (ob/ob) mice. Am. J. Physiol. Endocrinol. Metab. 2006, 291, E358–E364. [Google Scholar] [CrossRef] [Scilit]
- Scagelb, J.L.C.F. Chicoric acid levels in commercial basil (Ocimum basilicum) and Echinacea purpurea products. J. Funct. Foods 2010, 2, 77–84. [Google Scholar]
- Kim, E.J.; Jung, S.N.; Son, K.H.; Kim, S.R.; Ha, T.Y.; Park, M.G.; Jo, I.G.; Park, J.G.; Choe, W.; Kim, S.S.; et al. Antidiabetes and antiobesity effect of cryptotanshinone via activation of AMP-activated protein kinase. Mol. Pharmacol. 2007, 72, 62–72. [Google Scholar] [CrossRef] [Scilit]
- Kim, H.K.; Nelson-Dooley, C.; Della-Fera, M.A.; Yang, J.Y.; Zhang, W.; Duan, J.; Hartzell, D.L.; Hamrick, M.W.; Baile, C.A. Genistein decreases food intake, body weight, and fat pad weight and causes adipose tissue apoptosis in ovariectomized female mice. J. Nutr. 2006, 136, 409–414. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kim, S.O.; Yun, S.J.; Lee, E.H. The water extract of adlay seed (Coix lachrymajobi var. mayuen) exhibits anti-obesity effects through neuroendocrine modulation. Am. J. Chin. Med. 2007, 35, 297–308. [Google Scholar] [CrossRef] [Scilit]
- Kropski, J.A.; Keckley, P.H.; Jensen, G.L. School-based obesity prevention programs: An evidence-based review. Obes. (Silver Spring) 2008, 16, 1009–1018. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Luo, Q.; Li, Y.; Deng, J.; Zhang, Z. PARP-1 inhibitor sensitizes arsenic trioxide in hepatocellular carcinoma cells via abrogation of G2/M checkpoint and suppression of DNA damage repair. Chem. Biol. Interact. 2015, 226, 12–22. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tsai, P.J.; Davis, J.; Bryant-Greenwood, G. Systemic and placental leptin and its receptors in pregnancies associated with obesity. Reprod. Sci. 2015, 22, 189–197. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Weisberg, S.P.; McCann, D.; Desai, M.; Rosenbaum, M.; Leibel, R.L.; Ferrante, A.W., Jr. Obesity is associated with macrophage accumulation in adipose tissue. J. Clin. Investig. 2003, 112, 1796–1808. [Google Scholar] [CrossRef]
- Wellen, K.E.; Hotamisligil, G.S. Obesity-induced inflammatory changes in adipose tissue. J. Clin. Investig. 2003, 112, 1785–1788. [Google Scholar] [CrossRef] [PubMed]
- Weyer, C.; Funahashi, T.; Tanaka, S.; Hotta, K.; Matsuzawa, Y.; Pratley, R.E.; Tataranni, P.A. Hypoadiponectinemia in obesity and type 2 diabetes: Close association with insulin resistance and hyperinsulinemia. J. Clin. Endocrinol. Metab. 2001, 86, 1930–1935. [Google Scholar] [CrossRef] [PubMed]
- Xu, X.J.; Gauthier, M.S.; Hess, D.T.; Apovian, C.M.; Cacicedo, J.M.; Gokce, N.; Farb, M.; Valentine, R.J.; Ruderman, N.B. Insulin sensitive and resistant obesity in humans: AMPK activity, oxidative stress, and depot-specific changes in gene expression in adipose tissue. J. Lipid Res. 2012, 53, 792–801. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hardie, D.G. AMPK: A key regulator of energy balance in the single cell and the whole organism. Int. J. Obes. (Lond.) 2008, 32, S7–S12. [Google Scholar] [CrossRef] [Scilit]
- Hwang, J.T.; Park, I.J.; Shin, J.I.; Lee, Y.K.; Lee, S.K.; Baik, H.W.; Ha, J.; Park, O.J. Genistein, EGCG, and capsaicin inhibit adipocyte differentiation process via activating AMP-activated protein kinase. Biochem. Biophys. Res. Commun. 2005, 338, 694–699. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Moon, H.S.; Chung, C.S.; Lee, H.G.; Kim, T.G.; Choi, Y.J.; Cho, C.S. Inhibitory effect of (-)-epigallocatechin-3-gallate on lipid accumulation of 3T3-L1 cells. Obes. (Silver Spring) 2007, 15, 2571–2582. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hotamisligil, G.S.; Arner, P.; Caro, J.F.; Atkinson, R.L.; Spiegelman, B.M. Increased adipose tissue expression of tumor necrosis factor-alpha in human obesity and insulin resistance. J. Clin. Investig. 1995, 95, 2409–2415. [Google Scholar] [CrossRef] [Scilit]
- Hotamisligil, G.S.; Peraldi, P.; Budavari, A.; Ellis, R.; White, M.F.; Spiegelman, B.M. IRS-1-mediated inhibition of insulin receptor tyrosine kinase activity in TNF-alpha- and obesity-induced insulin resistance. Science 1996, 271, 665–668. [Google Scholar] [CrossRef] [Scilit] [PubMed]







| Gene Name | Accession No. | Forward Primer | Reverse Primer |
|---|---|---|---|
| PPARγ 1 | NM_011146 | CGCTGATGCACTGCCTATGA | AGAGGTCCACAGAGCTGATTCC |
| C/EBPα 2 | BC058161 | CGCAAGAGCCGAGATAAAGC | CACGGCTCAGCTGTTCCA |
| aP2 3 | NM_024406 | CATGGCCAAGCCCAACAT | CGCCCAGTTTGAAGGAAATC |
| ACC 4 | NM_133360 | GAATCTCCTGGTGACAATGCTTATT | GGTCTTGCTGAGTTGGGTTAGCT |
| FAS 5 | NM_007988 | CTGAGATCCCAGCACTTCTTGA | GCCTCCGAAGCCAAATGAG |
| LPL 6 | NM_008509 | ATCGGAGAACTGCTCATGATGA | CGGATCCTCTCGATGACGAA |
| Adiponectin | NM_009605 | ATCCACACGTGTACTCAC | AGCATGGTCTACTTCCAG |
| SPEBP-1c 7 | NM_011480.3 | GGACGAGCTGGCCTTCGGTGA | ATAGGGGGCGTCAAACAGGCCC |
| GAPDH 8 | BC083080 | GTATGACTCCACTCACGGCAAA | GGTCTCGCTCCTGGAAGATG |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Choi, Y.-H.; Lee, O.-H.; Zheng, Y.; Kang, I.-J. Erigeron annuus (L.) Pers. Extract Inhibits Reactive Oxygen Species (ROS) Production and Fat Accumulation in 3T3-L1 Cells by Activating an AMP-Dependent Kinase Signaling Pathway. Antioxidants 2019, 8, 139. https://doi.org/10.3390/antiox8050139
Choi Y-H, Lee O-H, Zheng Y, Kang I-J. Erigeron annuus (L.) Pers. Extract Inhibits Reactive Oxygen Species (ROS) Production and Fat Accumulation in 3T3-L1 Cells by Activating an AMP-Dependent Kinase Signaling Pathway. Antioxidants. 2019; 8(5):139. https://doi.org/10.3390/antiox8050139
Chicago/Turabian StyleChoi, Yoon-Hee, Ok-Hwan Lee, Yulong Zheng, and Il-Jun Kang. 2019. "Erigeron annuus (L.) Pers. Extract Inhibits Reactive Oxygen Species (ROS) Production and Fat Accumulation in 3T3-L1 Cells by Activating an AMP-Dependent Kinase Signaling Pathway" Antioxidants 8, no. 5: 139. https://doi.org/10.3390/antiox8050139
APA StyleChoi, Y.-H., Lee, O.-H., Zheng, Y., & Kang, I.-J. (2019). Erigeron annuus (L.) Pers. Extract Inhibits Reactive Oxygen Species (ROS) Production and Fat Accumulation in 3T3-L1 Cells by Activating an AMP-Dependent Kinase Signaling Pathway. Antioxidants, 8(5), 139. https://doi.org/10.3390/antiox8050139

