Epicatechin Gallate Ameliorates UVB-Induced Photoaging by Inhibiting p38α-Mediated Autophagy and Oxidative Stress

Abstract

Prolonged exposure to ultraviolet (UV) radiation in sunlight is a major extrinsic factor that impairs skin function and accelerates photoaging. In this study, a murine model of ultraviolet B (UVB)-induced photoaging exhibited characteristic symptoms, including skin roughness, erythema, hyperpigmentation, and increased wrinkle formation. Epicatechin gallate (ECG), a natural flavonoid, has demonstrated potential skin-protective properties. However, its specific effects and mechanisms against UVB-induced photoaging are not fully understood. Here, we investigated the protective role and underlying mechanism of ECG against UVB-induced damage in human epidermal keratinocytes (HaCaT cells). Using network pharmacology, p38 mitogen-activated protein kinase (p38 MAPK), specifically the p38α isoform, was identified as a key potential target of ECG. Our experimental results confirmed that ECG significantly attenuated UVB-induced photoaging. Mechanistically, ECG treatment effectively suppressed UVB-triggered phosphorylation of p38α, promoted autophagic flux (as evidenced by increased LC3B conversion and decreased p62 levels), and substantially reduced intracellular reactive oxygen species (ROS) accumulation. Consequently, ECG mitigated mitochondrial dysfunction, restored normal cell cycle progression, and decreased the expression of senescence-associated markers (p53, p16, p21) and inflammatory cytokines (IL6, TNF-α). In summary, our findings demonstrate that ECG protects against UVB-induced photoaging primarily by inhibiting p38α activation, thereby enhancing autophagy and alleviating oxidative stress. This study positions ECG as a promising therapeutic candidate for preventing and treating skin photoaging.

1. Introduction

Skin aging is a complex biological process regulated by both endogenous mechanisms and exogenous environmental factors [1]. Among external stressors, solar ultraviolet (UV) radiation is the primary driver of extrinsic skin aging, commonly termed photoaging [2]. Chronic or intense UV exposure triggers a cascade of detrimental effects, including degradation of collagen and elastin fibers, disruption of extracellular matrix homeostasis, and ultimately the formation of wrinkles and loss of skin elasticity [3]. At the molecular level, ultraviolet B (UVB) radiation is particularly effective at inducing the overproduction of reactive oxygen species (ROS), which act as key mediators of photodamage. Excess ROS can subsequently activate stress-responsive signaling pathways, including the mitogen-activated protein kinase (MAPK) family, with the p38 pathway playing a prominent role in UV-induced inflammatory and senescence responses.

Autophagy is an evolutionarily conserved catabolic process responsible for the degradation and recycling of intracellular components, from proteins to damaged organelles, and is functional across eukaryotic organisms from yeast to mammals [4]. In the context of skin physiology, autophagy serves as a critical quality-control mechanism, and its dysregulation has been closely linked to the aging phenotype [5]. A growing body of evidence indicates a bidirectional relationship between autophagy and oxidative stress: while excessive ROS can impair autophagic flux, functional autophagy, in turn, helps to mitigate oxidative damage by clearing ROS-generating damaged mitochondria and aggregated proteins, thereby maintaining cellular homeostasis [6]. Current studies indicate that excessive ROS can stimulate cell damage, while autophagy could markedly maintain cellular homeostasis, eliminate cellular waste components by reducing levels of ROS [7]. This protective interplay is often regulated through key signaling nodes, including the MAPK pathways, which modulate autophagy in response to various stressors, including UV radiation [8].

Epicatechin gallate (ECG) is a natural flavonoid belonging to the catechin family, commonly found in foods such as green tea. Compared to other polyphenols like rutin and coumarin, ECG demonstrates superior in vitro antioxidant capacity, including potent ABTS radical scavenging activity and high ferric-reducing antioxidant power [9]. Beyond its antioxidant properties, ECG has been shown to influence cellular fate decisions; for instance, it can induce apoptosis in human melanoma cells by modulating autophagy through the mTOR pathway [10]. While several catechins, such as epigallocatechin gallate (EGCG), have been extensively studied for their photoprotective effects, the specific role of ECG in counteracting UVB-induced skin damage—particularly through mechanisms involving autophagy and p38 MAPK signaling—remains insufficiently explored. This represents a significant gap, given ECG’s potent bioactivity and potential as a skincare agent.

Therefore, this study aims to systematically investigate the protective effects and underlying molecular mechanisms of ECG against UVB-induced photoaging in human epidermal keratinocytes (HaCaT cells). Using a combination of network pharmacology prediction and experimental validation, we identify p38 MAPK as a key target of ECG. We further elucidate how ECG-mediated modulation of p38 signaling enhances autophagic activity, reduces oxidative stress, mitigates mitochondrial dysfunction, and ultimately alleviates cellular senescence. Our findings not only clarify the pharmacological action of ECG but also support its potential application as a novel agent for the prevention and treatment of skin photoaging.

2. Materials and Methods

2.1. Experimental Materials

Superoxide Dismutase (SOD) Assay Kit (S0101S), Reduced Glutathione (GSH) Asssay Kit (S0053), Cellular Senescent β-galactosidase (SA-β-Gal) Staining Kit (C0602) and Catalase (CAT) Assay Kit (S0051), Bafilomycin A1 (BafA1) (Y262115), Hoechst 33342 Staining Solution (C1025) and the 5-Ethynyl-2′-deoxyuridine (EdU) Cell Proliferation Assay Kit (C0078S) were obtained from Beyotime (Shanghai, China). The fluorescent probe 2′,7′-Dichlorodihydrofluorescein diacetate (DCFH-DA) (D103583), Horseradish Peroxidase (HRP)-conjugated Goat Anti-Rabbit Immunoglobulin G (IgG) secondary antibody (cat. #BS13278); rabbit anti-Glyceraldehyde-3-Phosphate Dehydrogenase (GAPDH) antibody (cat. #AP0063) were purchased from Bioworld Technology (Bloomington, IN, USA). Rabbit anti-p38α Mitogen-Activated Protein Kinase (MAPK) antibody (cat. #9212) and rabbit anti-Microtubule-Associated Protein 1A/1B-Light Chain 3 (LC3) antibody (cat. #ab192890). were purchased from Abcam (Cambridge, UK). Rabbit anti-Sequestosome 1 (SQSTM1/p62) antibody (cat. #AF5384) was purchased from Affinity (Changzhou, China). Rabbit anti-Beclin1 (BECN1) antibody (cat. #11306), mouse anti-tubulin antibody (cat. #66031-1-IG), rabbit anti-LaminB1 (LMNB1) antibody (cat. #12987-1-AP), rabbit anti-Cyclin-Dependent Kinase Inhibitor 1A (p21, CDKN1A) antibody (cat. #10355-1-AP) and rabbit anti-LC3 antibody (cat. #14600) were purchased from Proteintech group (Wuhan, China). Rabbit anti-Cyclin-Dependent Kinase Inhibitor 2A (p16, CDKN2A) antibody (cat. #CY5316) was purchased from Abways (Shanghai, China). Mouse anti-Histone H2A.X (phospho-Ser139) (γH2AX) antibody (cat. #M63324M) was purchased from Abmart (Shanghai, China). The p38α MAPK inhibitor Adezmapimod (SB203580, cat. #HY-10256) was purchased from MedChemExpress (Monmouth Junction, NJ, USA). The 2,2-Diphenyl-1-picrylhydrazyl (DPPH) Radical Scavenging Assay Kit and the 2,2′-Azino-bis (3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) Radical Scavenging Assay Kit were obtained from Biosharp Life Sciences (Hefei, China).

2.2. Animals Modeling

Sixteen male ICR mice (4–5 weeks old, 17 ± 1 g) were purchased from Jiangsu Qinglongshan Biotechnology Co., Ltd. (Jingjiang, China) After one week of acclimatization under standard conditions (25 ± 1 °C, 12 h light/dark cycle, ad libitum access to food and water), the dorsal hair of all mice was shaved, followed by application of a depilatory cream to clear a 4 cm × 5 cm area. Mice were then randomly divided into two groups (n = 8/group): (1) Control group: shaving only, no UVB exposure; (2) UVB group: subjected to chronic UVB irradiation. UVB irradiation was delivered using two parallel UVB lamps (Philips TL20W/12 RS, Amsterdam, The Netherlands). The spectral output was centered at 312 nm with a range of 280–315 nm. The irradiance at the dorsal surface of the mice was measured and calibrated to 0.5 mW/cm² using a UV radiometer (UVP UVX Radiometer; Analytik Jena, Upland, CA, USA). Mice in the UVB group were exposed to a single dose of 150 mJ/cm² per session, which corresponded to an exposure duration of 5 min per session. Irradiation was administered three times per week (Monday, Wednesday, Friday) for a total of 4 weeks. During irradiation, mice were placed individually in restraint devices without anesthesia. Skin phenotypic assessments and tissue collection were performed 24 h after the final UVB exposure.

All animal procedures were approved by the Institutional Animal Care and Use Committee of China Pharmaceutical University (Approval No.: 2025-01-001 and Animal Approval Date: 1 January 2025) and conducted in accordance with the ARRIVE guidelines.

2.3. Histopathological Analysis

After the skin tissue was sufficiently fixed, paraffin sections were made and dewaxed to water. Collagen fiber content was assessed by Masson’s trichrome staining, and changes in tissue structure were observed by hematoxylin and eosin (H&E) staining. The stained sections were scanned by the slice scanner (NanoZoomer 2.0 RS; Hamamatsu Photonics, Hamamatsu City, Japan) and quantified by ImageJ software (version 1.53t; National Institutes of Health, Bethesda, MD, USA).

2.4. Detection of UVB-Induced Apoptosis and Cell Cycle by Flow Cytometry

Cells were plated into six-well plates at a density of 3 × 10⁵ cells per well and incubated overnight. Following a 24 h exposure to UVB, mild trypsinization was used to recover HaCaT cells, including the dead floating cells, which were then washed with cold PBS. Apoptosis and cell cycle analyses were performed using kits from Yeasen Biotechnology (Shanghai, China) and KeyGEN Biotechnology (Nanjing, China), respectively. Then, cells were detected by BD FACSymphony™ (BD Biosciences, San Jose, CA, USA) installed with BD Accuri C6 software and analyzed by FlowJo v14.0.

2.5. Colony Formation Assays

For cell colony formation assays, HaCaT cells (5 × 10² cells/mL) were seeded in six-well plates and incubated at 37 °C with 5% CO₂. After two weeks, colonies were stained with 0.2% crystal violet for 30 min, and the number of colonies was counted.

2.6. Immunofluorescence Staining

Samples were washed with PBS, fixed with 4% PFA and permeabilized with 0.1% Triton X-100. Primary antibodies were incubated with the samples at 4 °C overnight. Subsequently, the samples were washed with PBS, incubated with secondary antibodies for 1 h and stained with DAPI (4′,6-diamidino-2-phenylindole; Thermo Fisher Scientific, Waltham, MA, USA).

2.7. Cell Culture

HaCaT (human epidermal keratinocytes) were purchased from the cell bank of the Typical Culture Preservation Committee of the Chinese Academy of Sciences. The cells were cultured in DMEM high glucose medium containing 10% FBS and placed in an incubator at 37 °C with 5% CO₂, then digested with 0.25% trypsin and passaged.

2.8. Determination of Optimal UVB Irradiation Conditions

To establish a sub-lethal photoaging model, HaCaT cells were exposed to a gradient of UVB doses (0, 20, 40, 60, 80, 100, and 120 mJ/cm²) using a UVB lamp (Philips, PL-S 9W/01) emitting in the 280–315 nm spectrum, positioned 5 cm above the cells in PBS. Based on the CCK-8 viability assay results, a dose of 60 mJ/cm² was selected for subsequent experiments as it induced significant cellular stress while maintaining a viability rate suitable for modeling chronic photoaging. To determine the optimal post-irradiation assessment timepoint, cell viability was monitored at 0, 2, 4, 8, 12, 24, and 48 h after exposure to 60 mJ/cm² UVB.

2.9. Cell Viability and ECG Cytotoxicity Assessment

Cell viability was determined using the CCK-8 assay. Briefly, HaCaT cells were seeded in 96-well plates at a density of 3 × 10³ cells per well and allowed to adhere overnight. To assess the non-cytotoxic concentration range of ECG for further experiments, cells were treated with a serial dilution of ECG (0–128 µM) for 24 h. The upper limit of 128 µM was chosen based on preliminary solubility tests and reported bioactive ranges of similar catechins in keratinocyte studies.

For the photo-protection assay, cells were pre-treated with selected non-toxic concentrations of ECG (based on the results of the aforementioned cytotoxicity assay) for a specified period, followed by exposure to the established sub-lethal UVB dose of 60 mJ/cm². After irradiation, cells were incubated for an additional 24 h to allow for the manifestation of UV-induced damage and potential compound effects. Subsequently, 10 µL of CCK-8 reagent was added to each well, and the plates were incubated at 37 °C for 3 h. The absorbance at 450 nm was measured using a microplate reader (Molecular Devices, LLC, San Jose, CA, USA). All experiments were performed with a minimum of three independent biological replicates, each containing six technical replicates, to ensure statistical robustness.

2.10. Hoechst Staining

To identify apoptotic cells, Hoechst 33342 staining was utilized. Cells from the control, ECG-treated, and UVB groups were fixed with 4% paraformaldehyde for 5 min at room temperature. After fixation, the cells were washed three times with PBS and then stained with Hoechst 33342 for 5 min. Apoptotic features were observed using a Zeiss Axioscope 5 microscope (Zeiss, Oberkochen, Germany).

2.11. RNA Extraction and Quantitative Real-Time PCR (RT-PCR)

RNA was isolated from HaCaT cells employing Trizol reagent (YFXM0013-50) (YIFEIXUE BioTech, Nanjing, China) as the extraction medium. The extracted RNA was reverse-transcribed into cDNA using HiScript II Q RT SuperMix (Vazyme, Nanjing, China), following the protocol given by the manufacturer. The relative expression of the genes was detected through real-time fluorescent quantitative PCR using the SYBR Green Pro Taq HS Premixed qPCR Kit (AG11718; Accurate Biology, Changsha, Hunan, China), and normalized to GAPDH expression. Specific primers were synthesized by Sangon Biotech (Shanghai, China), and the specific sequences used are in

Table 1. Oligonucleotide primers used for real-time RT-PCR.

mRNA	Gene Accession Number	Forward Sequence	Reverse Sequence
interleukin6 (IL6)	NM_000600. 5	ACTCACCTCTTCAGAACGAATTG	CCATCTTTGGAAGGTTCAGGTTG
tumor necrosis factor-α (TNF-α)	NM_000594. 4	CCTCTCTCTAATCAGCCCTCTG	GAGGACCTGGGAGTAGATGAG
Glyceraldehyde-3-phosphate dehydrogenase (GAPDH)	NM_002046. 8	GGAGCGAGATCCCTCCAAAAT	GGCTGTTGTCATACTTCTCATGG
Beclin1	NM_003766. 5	GCTGGAAGATGCTCCTGACC	CAGTTGTTCTGGGAGGACCA
sequestosome 1 (p62)	NM_003900. 5	GCACCCCAATGTGATCTGC	CGCTACACAAGTCGTAGTCTGG
Microtubule-associated protein light chain 3 (LC3)	NM_022818. 5	AGCAGCATCCAACCAAAATC	CTGTGTCCGTTCACCAACAG
matrix metalloproteinase-9 (MMP-9)	NM_004994. 3	TGTACCGCTATGGTTACACTCG	GGCAGGGACAGTTGCTTCT
Estrogen Receptor 1 (ESR1)	NM_000125. 4	CCTGGCGTTGATCATCGA	AGTGGTCCATGCCCTTCAC
Estrogen Receptor 2 (ESR2)	NM_001437. 3	TGGACATGATCTACGCCACC	GGATGAACTGCTGGGAAGGT
p38 Mitogen-Activated Protein Kinase (p38)	NM_001315. 3	TGGACAGTCCAGACGGTGAC	CTGCTCGGCTGTAACTGGAT

.

2.12. Western Blot Analysis

HaCaT keratinocytes cultured in 6-well plates (5 × 10⁵ cells/mL) were treated with ECG for 2 h, exposed or not exposed to UVB, and then incubated for 24 h. The protein concentrations in cell lysates were determined by the BCA protein concentration assay kit (P0010) (purchased from Beyotime). Samples were heated to 100 °C for 5 min. 25 μg protein was loaded per lane, and the gels were run at 80 V for 30 min and then 120 V for 30 min in electrophoresis liquid. Then, proteins were transferred onto polyvinylidene difluoride (PVDF) membrane in transfer buffer. Membranes were blocked with 5% albumin in TBST buffer for 2 h and incubated overnight at 4 °C with the primary antibodies. Then, membranes were incubated for 2 h with HRP-conjugated Goat anti-rabbit IgG (H&L) secondary antibody. The images were analyzed using ImageJ software (Tanon, Shanghai, China, Tanon 5200).

2.13. Cellular Senescent β-Galactosidase Staining

Cell samples were processed using a cellular senescence β-galactosidase staining kit, and SA-β-Gal activity in HaCaT cells was observed under an optical microscope to assess senescence status.

2.14. DPPH Radical Scavenging Activity and ABTS Radical Scavenging Activity

The free radical scavenging ability of ECG was evaluated using DPPH and ABTS assays, with Trolox as a positive control.

For the DPPH assay: Briefly, ECG or Trolox (0–150 µM) was dissolved in methanol. A volume of 100 µL of the sample solution was mixed with 100 µL of a freshly prepared DPPH working solution (100 µM in methanol) in a 96-well plate. The mixture was incubated in the dark at room temperature for 30 min. The absorbance was then measured at 517 nm. A control containing DPPH solution mixed with solvent only (without sample) and a blank containing solvent only (without DPPH) were prepared in parallel.

%DPPH scavenging activity = [Az − Aw/Az] × 100

whereby Az and Aw represent the absorbance recorded at 517 nm for the control and the test, respectively.

For the ABTS assay: The ABTS radical cation (ABTS•⁺) working solution was generated by reacting ABTS stock solution with potassium persulfate and diluting in PBS to an absorbance of approximately 0.70 (±0.02) at 734 nm. Subsequently, 10 µL of ECG or Trolox sample was mixed with 200 µL of the ABTS•⁺ working solution in a 96-well plate. After incubation in the dark for 6 min at room temperature, the absorbance was recorded at 734 nm. A control (ABTS•⁺ working solution mixed with solvent) and a blank (solvent only) were also included.

%ABTS scavenging activity = [Az − Aw/Az] × 100

whereby Az and Aw equal the absorbance recorded at 734 nm of the control and the test, respectively.

2.15. Immunofluorescence for ROS, MDC Detection

HaCaT cells (8 × 10⁴ cells/mL) were inoculated into black 24-well plates, treated with 10 μM DCFH-DA diacetate or MDC dye, and incubated at 37 °C for 40 min. Fluorescence intensity was measured from images captured by fluorescence microscopy in three randomly selected fields of view using ImageJ software (Thermo Scientific, Multiskan FC, Waltham, MA, USA).

2.16. Flow Cytometry for ROS

Cells were treated as above. Then the ROS level was detected by BD FACSymphony™ installed with BD Accuri C6 software and analyzed by FlowJo v14.0.

2.17. Biochemical Assays

The levels of biochemical markers, including total SOD activity detection kit, Catalase assay kit and GSH assay kits in HaCaT cells were determined using kits purchased from Beyotime (Shanghai, China), according to the manufacturer’s instructions.

2.18. Transmission Electron Microscopy

For transmission electron microscopy, samples were frozen using a high-pressure freezer (Leica EMPACT2, Vienna, Austria). Freeze substitution was performed with anhydrous acetone (containing 1% OsO₄ and 0.1% UA) using a Leica EM AFS2. The samples were maintained at −85 °C for 3 d, at −60 °C for 1 d, at −20 °C for 1 d, and at 0 °C for 1 d and then brought to room temperature. The samples were infiltrated and embedded in Spurr resin. Ultrathin sections were cut using a Leica EM UC6 (Leica, Vienna, Austria) and collected on 100 mesh copper grids. After staining with 5% uranyl acetate in 50% methanol for 10 min and 0.4% lead citrate for 4 min, sections were observed under a Philips CM 100 Transmission Electron Microscope at 100 KV.

2.19. Pharmacological Network Analysis

Search for keywords such as “skin aging”, “photoaging”, “skin oxidation” in the Genecards (https://www.genecards.org/; accessed on 10 October 2023) and Drugbank (https://go.drugbank.com/; accessed on 12 October 2023) databases to find targets related to photoaging. The targets of these two databases were intersected to obtain disease targets. ECG were then searched in the SwissTarget (http://swisstargetprediction.ch/; accessed on 15 October 2023) and TargetNet (https://targetnet.scbdd.com/home/index/; accessed on 15 October 2023) databases to find the intersection of targets in the two databases. Venny online tool (https://bioinfogp.cnb.csic.es/tools/venny/; accessed on 18 October 2023) was used to obtain the intersection targets of photoaging and ECG. Discovery Studio (version v24.1.0) is used to conduct molecular docking studies [11].

2.20. Lentivirus Infection and Cell Transfection

When the confluence of cells reached 70%, the medium was placed with a mixture of complete culture medium, virus solution, and polybrene (8 μg/mL). After 48 h, the medium was refreshed by medium containing purromycin (Beyotime, Shanghai, China) at 1 μg/mL. After 3–4 days of puromycin treatment, wild-type HaCaT died, HaCaT with stable overexpression of p38α was obtained. The design, construction, packaging, and purification of p38α overexpression lentivirus (OE-p38α), and corresponding empty lentivirus vectors were conducted by Genepharma (Nanjing, China).

2.21. Statistical Analysis

Statistical analysis was performed using GraphPad Prism^® 6 through one-way ANOVA for different groups followed by Tukey’s multiple range test and values of p < 0.05 were accepted as statistically significant.

3. Results

3.1. UVB Irradiation Induces Photoaging in Mouse Skin and Reduces HaCaT Cell Viabilit

To establish a photoaging model, the dorsal skin of mice was exposed to UVB radiation. The UVB-treated group exhibited visible signs of skin damage, including erythema, scaling, and increased wrinkling compared to the control group (Figure 1A). The rate of body weight change was also significantly higher in the UVB-treated group (Figure 1B). Histological analysis via Masson’s trichrome staining revealed a marked reduction in dermal collagen fibers (stained blue) in UVB-exposed skin (Figure 1C). H&E staining showed structural disorganization and thickening of the epidermal layer in the model group, contrasting with the intact, stratified architecture of the control group (Figure 1D). To further confirm these findings, the expression of Lamin B1, a nuclear morphological marker, was assessed. Under UVB irradiation, Lamin B1 expression was abnormal, nuclear integrity was compromised, and cells displayed irregular shapes and increased volume (Figure 1E). Furthermore, UVB exposure increased the proportion of apoptotic HaCaT cells (Figure 1F) and significantly inhibited colony formation capacity (Figure 1G).

3.2. Determination of Non-Cytotoxic ECG Concentrations in UVB-Irradiated HaCaT Cells

Long-term exposure to ultraviolet radiation causes skin damage including increased melanin production and oxidative stress, which result in skin aging and reduced collagenase activity [12,13,14]. Therefore, we initially screened for the optimal modelling method. The optimal conditions were determined by using the irradiation intensity and the time after exposure Senescence of HaCaT cells was observed 24 h after irradiation with UVB irradiation intensity of 60 mJ/cm² (Figure 2A,B). Under this condition, cell viability was assessed following treatment with a range of ECG concentrations (0–128 µM). Concentrations between 0.5 and 2 µM ECG did not exhibit cytotoxicity and were associated with higher cell viability post-UVB (Figure 2C). Treatment with ECG also attenuated the UVB-induced decrease in viability in a concentration-dependent manner (Figure 2D). Based on these results, ECG concentrations of 0.5 and 2 µM were selected for subsequent experiments.

3.3. ECG Modulates Senescence-Associated Markers in UVB-Irradiated HaCaT Cells

We investigated the effects of ECG on UVB-induced cellular senescence. Cell cycle analysis revealed that UVB irradiation induced a significant arrest at the G2/M phase in HaCaT cells. This arrest was alleviated by treatment with ECG (Figure 3A,B).

At the transcriptional level, UVB irradiation upregulated the expression of senescence-associated genes, including p53, p16, p21, IL6, and TNF-α. Treatment with ECG, particularly at 2 µM, significantly downregulated their mRNA levels compared to the UVB-only group (Figure 3C). This downregulation was confirmed at the protein level for p53, p16, and p21 (Figure 3D,E). Immunofluorescence analysis of nuclear morphology showed that UVB exposure led to a loss of Lamin B1 signal and the appearance of irregular, enlarged nuclei. ECG treatment, especially at 2 µM, attenuated these morphological alterations (Figure 3F,I). Furthermore, UVB irradiation markedly increased the levels of the DNA damage marker γH2AX. ECG treatment reduced γH2AX fluorescence intensity (Figure 3F,I).

The proportion of senescent cells, as assessed by SA-β-gal activity, was significantly higher in UVB-irradiated cells. ECG treatment effectively reduced the percentage of SA-β-gal-positive cells (Figure 3G,H).

3.4. ECG Attenuates UVB-Induced Oxidative Stress in HaCaT Cells

DPPH and ABTS are two types of free radicals commonly used to evaluate the antioxidant properties of natural crude drugs [15]. The antioxidant capacity of ECG was first evaluated in cell-free systems. ECG scavenged DPPH and ABTS radicals with IC₅₀ values of 6.47 µM and 3.90 µM, respectively (Figure 4A,B). In HaCaT cells, UVB irradiation markedly increased intracellular ROS levels, as detected by the DCFH-DA probe [16]. This increase was significantly suppressed by co-treatment with ECG, particularly at the higher dose (2 µM) (Figure 4C,D). Additionally, under oxidative stress conditions, intracellular oxygen free radicals are produced in large quantities, and these oxygen free radicals interact with the mitochondrial electron transport chain, leading to a decrease in mitochondrial membrane potential. Therefore, we employed immunofluorescence to detect the changes in mitochondrial membrane potential [17]. As shown in Figure 4E, ECG significantly preserved mitochondrial membrane potential compared to the UVB group. The status of the endogenous antioxidant system was quantitatively assessed by SOD, CAT and GSH-PX [15]. UVB-irradiated cells exhibited significantly reduced SOD and CAT activity and GSH-PX levels compared to the controls; however, SOD, CAT and GSH-PX significantly increased following ECG treatment (Figure 4F–H). These results suggest that ECG effectively inhibits UVB-induced oxidative stress in HaCaT cells.

3.5. ECG Promotes Autophagic Activity in UVB-Irradiated HaCaT Cells

Autophagy plays an important role in the skin aging process, and its activation can delay UVB-induced skin photoaging process [18]. Staining with monodansylcadaverine (MDC) revealed that UVB irradiation reduced the number and fluorescence intensity of autophagic vacuoles in HaCaT cells. ECG treatment, especially at 2 µM, increased MDC fluorescence intensity by 41.0% compared to the UVB-only group (Figure 5A). Western blot analysis showed that ECG treatment decreased the protein level of SQSTM1/p62 while increasing the LC3B/LC3Aratio and the expression of Beclin1 (Figure 5B). Consistent with these findings, RT-qPCR analysis indicated that ECG upregulated the mRNA expression of BECN1 and MAP1LC3B and downregulated SQSTM1/p62 (Figure 5C) [19,20,21]. Additionally, transmission electron microscopy (TEM) further confirmed that UVB irradiation caused mitochondrial swelling and cristae loss, whereas ECG treatment promoted the formation of autophagosome-like structures in HaCaT cells (Figure 5D). To determine whether these changes reflected an increase in autophagic flux rather than a blockade in the later stages, we treated cells with bafilomycin A1 (BafA1), a vacuolar H⁺-ATPase inhibitor that prevents autophagosome-lysosome fusion. Co-treatment with ECG and BafA1 resulted in a more pronounced accumulation of LC3B and a greater reduction in p62 compared to BafA1 treatment alone (Figure 5E), indicating that ECG promotes autophagic flux.

3.6. ECG Can Downregulate the Expression of p38α in HaCaT Cells

To further dissect the underlying mechanism of ECG inhibition of photoaging, targets were screened through a database. In this work, we searched for keywords such as “skin photoaging”, “skin aging”, “skin oxidation”, and “sunburn” based on the Genecards and the Drugbank databases, and obtained a total of 117 active targets. Targets for ECG were searched in the SwissTarget and TargetNet databases, and a total of 54 potential targets were obtained after intersection. After deleting and integrating false-positive targets and duplicate targets, six potential ECG targets for photoaging were obtained, namely p38α, MMP−9, PTGS1, ESR1, ESR2 and PARP1 (Figure 6A). The results showed that ECG had good binding activity to p38α (PDBID:1OUK), MMP−9 (PDBID:1ITV), ESR1 (PDBID:1R5K) and ESR2 (PDBID:2GIU). Figure 6B–E illustrates the 3D binding and hydrogen bonding diagram, describing the docking of each target gene with the ECG. In this particular sequence, ECG and p38α docking fractions yielded the best. Experimental validation revealed that mRNA expression of MMP-9 was significantly upregulated in the UVB-induced model group, whereas transcript levels of ESR1 and ESR2 remained largely unaltered (Figure 6F). Although neither the mRNA nor total protein expression of p38 showed significant changes, its phosphorylated form (p-p38) was markedly activated in the model group. ECG treatment effectively reversed UVB-induced elevation of p-p38 expression (Figure 6G,H). These findings indicate that the anti-photoaging activity of ECG is not mediated through modulation of estrogen receptor expression, but rather through specific suppression of the aberrant activation of the p38 MAPK signaling pathway. This inhibition subsequently downregulates the expression of its downstream effector MMP-9, ultimately mitigating photoaging damage. Thus, the phosphorylation-dependent activation of p38 represents the key regulatory target of ECG in this study.

3.7. ECG Protected HaCaT Cells from UVB-Induced ROS Redox by Inhibiting p38α-Mediated Autophagy

To gain a deeper understanding of how ECG prevents photoaging by inhibiting p38, we treated HaCaT cells with adezmapimod (AP), a selective p38 inhibitor, to investigate the antioxidant effects of ECG in relation to autophagy. Combined treatment with ECG and AP more effectively modulated the expression of autophagy-related proteins (Beclin1, p62, LC3B) than either agent alone (Figure 7A). RT-qPCR results for BECN1, SQSTM1/p62, and MAP1LC3B mRNA were consistent with the protein data (Figure 7B). The combination treatment also led to a greater increase in MDC-stained autophagic vesicles (Figure 7D) and a more pronounced reduction in intracellular ROS levels (Figure 7C) compared to single treatments. Furthermore, the combination of ECG and AP resulted in the lowest proportion of SA-β-gal-positive senescent cells (Figure 7E).

3.8. ECG Can Reverse Autophagy Inhibition and Oxidative Stress Caused by p38α Overexpression

HaCaT cells were transduced with a lentiviral vector to overexpress p38α (Figure 8A), which was confirmed at both mRNA and protein levels (Figure 8B). Overexpression of p38α inhibited autophagy, as evidenced by decreased levels of Beclin1 and LC3Band increased p62 (Figure 8C–F). It also reduced the activities of antioxidant enzymes SOD, CAT, and GSH-Px (Figure 8G–I) and elevated intracellular ROS (Figure 8J). p38α overexpression increased DNA damage (γH2AX foci) and nuclear abnormalities (Lamin B1 staining) (Figure 8K,M), inhibited cell proliferation (PI assay) (Figure 8L,N), and increased the number of SA-β-gal-positive cells (Figure 8O,P). Treatment with ECG significantly reversed all these effects induced by p38α overexpression. Collectively, these results suggest that ECG mitigates HaCaT cell aging by inhibiting p38α activity.

4. Discussion

Skin aging is a complex, multifactorial process characterized by a decline in physiological and structural integrity. Among extrinsic factors, UV radiation, particularly UVB, is the most significant contributor to photoaging, leading to oxidative stress, collagen degradation, and increased risk of proliferative lesions and malignancies [1,22]. Tea polyphenols, including ECG, have demonstrated potential in mitigating UVB-induced damage through antioxidant mechanisms [23]. While prior studies indicate that ECG can modulate autophagy-related pathways such as PI3K and Beclin1 [24], its specific role and mechanism in counteracting UVB-induced skin photoaging remain insufficiently elucidated. This study aimed to investigate the protective effects of ECG against UVB-induced damage, focusing on its antioxidant capacity and modulation of autophagy via the p38α MAPK pathway.

Our preliminary in vivo observations confirmed that chronic UVB exposure induced hallmark features of photoaging in mouse skin, including reduced collagen content and decreased levels of the aging-related protein Lamin B1. Subsequent optimization established a reproducible model and effective ECG treatment concentrations. We found that ECG treatment significantly inhibited the degradation of key dermal structural proteins, collagen and elastin, thereby helping preserve skin tissue integrity.

A key driver of UVB-induced photoaging is the excessive generation of reactive oxygen species (ROS). Our in vitro assays in HaCaT keratinocytes, using the DCFH-DA probe, demonstrated that ECG pretreatment effectively scavenged UVB-induced ROS. Furthermore, ECG enhanced the activity of critical antioxidant enzymes, including superoxide dismutase (SOD), catalase (CAT), and glutathione peroxidase (GSH-Px). These findings align with the free radical theory of aging and confirm that the anti-photoaging effects of ECG are, at least in part, attributable to its robust antioxidant properties [25,26]. Notably, while the antioxidant efficacy of ECG is consistent with other polyphenols like EGCG [23], our study delineates a more specific upstream regulatory node involving p38α.

Autophagy, a conserved cellular clearance mechanism, is crucial for maintaining homeostasis and is implicated in aging processes [27]. In our study, ECG treatment in UVB-exposed HaCaT cells upregulated the expression of autophagy markers Beclin1 and LC3B while downregulating SQSTM1/p62. This pattern indicates that ECG promotes autophagic flux. Given the established role of p62 as a substrate of autophagy [28], our results strongly suggest that the activation of autophagy is a key mechanism through which ECG exerts its protective effects.

The interplay between oxidative stress and autophagy often converges on signaling pathways like MAPK. Our data identify p38α MAPK as a critical link. Pharmacological inhibition and activation experiments confirmed that p38α activity is both necessary and sufficient to modulate the autophagy markers in our context. Importantly, we found that ECG’s ability to improve mitochondrial membrane potential and reduce ROS was mediated through the regulation of p38α-driven autophagy. This positions p38α not merely as a stress responder but as a central regulatory hub through which ECG coordinates antioxidant defense and cellular cleanup processes to alleviate UVB-induced mitochondrial dysfunction and cellular damage [29,30].

While our findings provide mechanistic insights, several limitations must be acknowledged. First, the primary in vitro model utilized was the HaCaT keratinocyte cell line. Although invaluable for mechanistic studies, this model does not fully recapitulate the complexity of the multicellular, three-dimensional human skin environment. Second, our in vivo assessments were primarily morphological and biochemical (e.g., protein expression); they lacked long-term functional endpoints or clinically relevant measures of skin barrier function and photoaging reversal. Third, while we compared ECG’s effects to baseline UVB damage, a direct comparative analysis with other well-established antioxidants or polyphenols within the same experimental framework would more precisely define its relative potency and unique mechanistic profile.

These limitations underscore the preclinical nature of our work. Future studies should employ more complex models, such as 3D skin equivalents or primary human keratinocyte/fibroblast co-cultures, and incorporate long-term in vivo studies with functional skin health metrics. Investigating the topical application efficacy and bioavailability of ECG will be crucial steps toward evaluating its translational potential as a candidate for cosmeceutical or dermatological interventions against photoaging.

5. Conclusions

UVB radiation is a key extrinsic factor that damages human skin, in part through the induction of oxidative stress and the impairment of autophagic flux. The present study provides evidence that, in preclinical models, ECG can mitigate UVB-induced damage by attenuating ROS accumulation and modulating the expression of autophagy-related proteins, an effect mediated, at least in part, through the inhibition of p38α MAPK signaling. Collectively, these findings identify ECG as a potential candidate for further development and highlight the modulation of the p38α/autophagy axis as a plausible mechanistic avenue for protecting skin against photodamage.