Divergent Requirements for Glutathione Biosynthesis During Osteoclast Differentiation In Vitro and In Vivo
Abstract
1. Introduction
2. Materials and Methods
2.1. Mouse Strains
2.2. Micro-Computed Tomography (μCT)
2.3. Histology
2.4. Serum Analysis
2.5. Monocyte/Macrophage Isolation and Osteoclast Culture
2.6. CRISPR/Cas9-Mediated Gene KO
2.7. Virus Production
2.8. Analysis of GSH Using LC-MS/MS
2.9. RNA Isolation and qPCR
2.10. Western Blotting
2.11. Statistical Analysis
3. Results
3.1. GSH Biosynthesis Increases During Osteoclastogenesis
3.2. GSH Biosynthesis Limits Osteoclast Differentiation In Vivo
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Boyle, W.J.; Simonet, W.S.; Lacey, D.L. Osteoclast differentiation and activation. Nature 2003, 423, 337–342. [Google Scholar] [CrossRef]
- Kikuta, J.; Ishii, M. Osteoclast migration, differentiation and function: Novel therapeutic targets for rheumatic diseases. Rheumatology 2013, 52, 226–234. [Google Scholar] [CrossRef] [PubMed]
- Teitelbaum, S.L.; Ross, F.P. Genetic regulation of osteoclast development and function. Nat. Rev. Genet. 2003, 4, 638–649. [Google Scholar] [CrossRef] [PubMed]
- Grigoriadis, A.E.; Wang, Z.Q.; Cecchini, M.G.; Hofstetter, W.; Felix, R.; Fleisch, H.A.; Wagner, E.F. c-Fos: A key regulator of osteoclast-macrophage lineage determination and bone remodeling. Science 1994, 266, 443–448. [Google Scholar] [CrossRef] [PubMed]
- Takayanagi, H.; Kim, S.; Koga, T.; Nishina, H.; Isshiki, M.; Yoshida, H.; Saiura, A.; Isobe, M.; Yokochi, T.; Inoue, J.; et al. Induction and activation of the transcription factor NFATc1 (NFAT2) integrate RANKL signaling in terminal differentiation of osteoclasts. Dev. Cell 2002, 3, 889–901. [Google Scholar] [CrossRef] [PubMed]
- Wada, T.; Nakashima, T.; Hiroshi, N.; Penninger, J.M. RANKL-RANK signaling in osteoclastogenesis and bone disease. Trends Mol. Med. 2006, 12, 17–25. [Google Scholar] [CrossRef]
- Lee, S.K.; Lorenzo, J. Cytokines regulating osteoclast formation and function. Curr. Opin. Rheumatol. 2006, 18, 411–418. [Google Scholar] [CrossRef]
- Amarasekara, D.S.; Yun, H.; Kim, S.; Lee, N.; Kim, H.; Rho, J. Regulation of Osteoclast Differentiation by Cytokine Networks. Immune Netw. 2018, 18, e8. [Google Scholar] [CrossRef] [PubMed]
- Kim, N.; Takami, M.; Rho, J.; Josien, R.; Choi, Y. A novel member of the leukocyte receptor complex regulates osteoclast differentiation. J. Exp. Med. 2002, 195, 201–209. [Google Scholar] [CrossRef]
- Wang, Q.; Xie, Y.; Du, Q.S.; Wu, X.J.; Feng, X.; Mei, L.; McDonald, J.M.; Xiong, W.C. Regulation of the formation of osteoclastic actin rings by proline-rich tyrosine kinase 2 interacting with gelsolin. J. Cell Biol. 2003, 160, 565–575. [Google Scholar] [CrossRef]
- Teitelbaum, S.I. The osteoclast and osteoporosis. Mt. Sinai J. Med. 1996, 63, 399–402. [Google Scholar] [PubMed]
- Zaidi, M. Skeletal remodeling in health and disease. Nat. Med. 2007, 13, 791–801. [Google Scholar] [CrossRef] [PubMed]
- Parfitt, A.M. The coupling of bone formation to bone resorption: A critical analysis of the concept and of its relevance to the pathogenesis of osteoporosis. Metab. Bone Dis. Relat. Res. 1982, 4, 1–6. [Google Scholar] [CrossRef] [PubMed]
- Martin, T.J.; Sims, N.A. Osteoclast-derived activity in the coupling of bone formation to resorption. Trends Mol. Med. 2005, 11, 76–81. [Google Scholar] [CrossRef] [PubMed]
- Choi, Y.; Arron, J.R.; Townsend, M.J. Promising bone-related therapeutic targets for rheumatoid arthritis. Nat. Rev. Rheumatol. 2009, 5, 543–548. [Google Scholar] [CrossRef] [PubMed]
- Sato, K.; Takayanagi, H. Osteoclasts, rheumatoid arthritis, and osteoimmunology. Curr. Opin. Rheumatol. 2006, 18, 419–426. [Google Scholar] [CrossRef] [PubMed]
- Teitelbaum, S.L. Osteoclasts; culprits in inflammatory osteolysis. Arthritis Res. Ther. 2006, 8, 201. [Google Scholar] [CrossRef] [PubMed]
- Shaker, J.L. Paget’s Disease of Bone: A Review of Epidemiology, Pathophysiology and Management. Ther. Adv. Musculoskelet. Dis. 2009, 1, 107–125. [Google Scholar] [CrossRef] [PubMed]
- Macedo, F.; Ladeira, K.; Pinho, F.; Saraiva, N.; Bonito, N.; Pinto, L.; Goncalves, F. Bone Metastases: An Overview. Oncol. Rev. 2017, 11, 321. [Google Scholar] [CrossRef] [PubMed]
- Garrett, I.R.; Boyce, B.F.; Oreffo, R.O.; Bonewald, L.; Poser, J.; Mundy, G.R. Oxygen-derived free radicals stimulate osteoclastic bone resorption in rodent bone in vitro and in vivo. J. Clin. Investig. 1990, 85, 632–639. [Google Scholar] [CrossRef]
- Bax, B.E.; Alam, A.S.; Banerji, B.; Bax, C.M.; Bevis, P.J.; Stevens, C.R.; Moonga, B.S.; Blake, D.R.; Zaidi, M. Stimulation of osteoclastic bone resorption by hydrogen peroxide. Biochem. Biophys. Res. Commun. 1992, 183, 1153–1158. [Google Scholar] [CrossRef] [PubMed]
- Kanzaki, H.; Shinohara, F.; Kajiya, M.; Kodama, T. The Keap1/Nrf2 protein axis plays a role in osteoclast differentiation by regulating intracellular reactive oxygen species signaling. J. Biol. Chem. 2013, 288, 23009–23020. [Google Scholar] [CrossRef]
- Lee, N.K.; Choi, Y.G.; Baik, J.Y.; Han, S.Y.; Jeong, D.W.; Bae, Y.S.; Kim, N.; Lee, S.Y. A crucial role for reactive oxygen species in RANKL-induced osteoclast differentiation. Blood 2005, 106, 852–859. [Google Scholar] [CrossRef] [PubMed]
- Bhatt, N.Y.; Kelley, T.W.; Khramtsov, V.V.; Wang, Y.; Lam, G.K.; Clanton, T.L.; Marsh, C.B. Macrophage-colony-stimulating factor-induced activation of extracellular-regulated kinase involves phosphatidylinositol 3-kinase and reactive oxygen species in human monocytes. J. Immunol. 2002, 169, 6427–6434. [Google Scholar] [CrossRef]
- Ha, H.; Kwak, H.B.; Lee, S.W.; Jin, H.M.; Kim, H.M.; Kim, H.H.; Lee, Z.H. Reactive oxygen species mediate RANK signaling in osteoclasts. Exp. Cell Res. 2004, 301, 119–127. [Google Scholar] [CrossRef]
- Kang, I.S.; Kim, C. NADPH oxidase gp91(phox) contributes to RANKL-induced osteoclast differentiation by upregulating NFATc1. Sci. Rep. 2016, 6, 38014. [Google Scholar] [CrossRef]
- Ishii, K.A.; Fumoto, T.; Iwai, K.; Takeshita, S.; Ito, M.; Shimohata, N.; Aburatani, H.; Taketani, S.; Lelliott, C.J.; Vidal-Puig, A.; et al. Coordination of PGC-1beta and iron uptake in mitochondrial biogenesis and osteoclast activation. Nat. Med. 2009, 15, 259–266. [Google Scholar] [CrossRef] [PubMed]
- Lean, J.M.; Davies, J.T.; Fuller, K.; Jagger, C.J.; Kirstein, B.; Partington, G.A.; Urry, Z.L.; Chambers, T.J. A crucial role for thiol antioxidants in estrogen-deficiency bone loss. J. Clin. Investig. 2003, 112, 915–923. [Google Scholar] [CrossRef] [PubMed]
- Bartell, S.M.; Kim, H.N.; Ambrogini, E.; Han, L.; Iyer, S.; Serra Ucer, S.; Rabinovitch, P.; Jilka, R.L.; Weinstein, R.S.; Zhao, H.; et al. FoxO proteins restrain osteoclastogenesis and bone resorption by attenuating H2O2 accumulation. Nat. Commun. 2014, 5, 3773. [Google Scholar] [CrossRef]
- Han, B.; Geng, H.; Liu, L.; Wu, Z.; Wang, Y. GSH attenuates RANKL-induced osteoclast formation in vitro and LPS-induced bone loss in vivo. Biomed. Pharmacother. 2020, 128, 110305. [Google Scholar] [CrossRef] [PubMed]
- Rana, T.; Schultz, M.A.; Freeman, M.L.; Biswas, S. Loss of Nrf2 accelerates ionizing radiation-induced bone loss by upregulating RANKL. Free Radic. Biol. Med. 2012, 53, 2298–2307. [Google Scholar] [CrossRef]
- Park, C.K.; Lee, Y.; Kim, K.H.; Lee, Z.H.; Joo, M.; Kim, H.H. Nrf2 is a novel regulator of bone acquisition. Bone 2014, 63, 36–46. [Google Scholar] [CrossRef] [PubMed]
- Pellegrini, G.G.; Cregor, M.; McAndrews, K.; Morales, C.C.; McCabe, L.D.; McCabe, G.P.; Peacock, M.; Burr, D.; Weaver, C.; Bellido, T. Nrf2 regulates mass accrual and the antioxidant endogenous response in bone differently depending on the sex and age. PLoS ONE 2017, 12, e0171161. [Google Scholar] [CrossRef]
- Hyeon, S.; Lee, H.; Yang, Y.; Jeong, W. Nrf2 deficiency induces oxidative stress and promotes RANKL-induced osteoclast differentiation. Free Radic. Biol. Med. 2013, 65, 789–799. [Google Scholar] [CrossRef]
- Goettsch, C.; Babelova, A.; Trummer, O.; Erben, R.G.; Rauner, M.; Rammelt, S.; Weissmann, N.; Weinberger, V.; Benkhoff, S.; Kampschulte, M.; et al. NADPH oxidase 4 limits bone mass by promoting osteoclastogenesis. J. Clin. Investig. 2013, 123, 4731–4738. [Google Scholar] [CrossRef] [PubMed]
- Brigelius-Flohe, R. Glutathione peroxidases and redox-regulated transcription factors. Biol. Chem. 2006, 387, 1329–1335. [Google Scholar] [CrossRef] [PubMed]
- Deneke, S.M.; Fanburg, B.L. Regulation of cellular glutathione. Am. J. Physiol. 1989, 257, L163–L173. [Google Scholar] [CrossRef]
- Kosower, N.S.; Kosower, E.M. The glutathione status of cells. Int. Rev. Cytol. 1978, 54, 109–160. [Google Scholar] [CrossRef]
- Forman, H.J.; Zhang, H.; Rinna, A. Glutathione: Overview of its protective roles, measurement, and biosynthesis. Mol. Asp. Med. 2009, 30, 1–12. [Google Scholar] [CrossRef] [PubMed]
- Lu, S.C. Regulation of glutathione synthesis. Mol. Asp. Med. 2009, 30, 42–59. [Google Scholar] [CrossRef] [PubMed]
- Meister, A. Metabolism and function of glutathione: An overview. Biochem. Soc. Trans 1982, 10, 78–79. [Google Scholar] [CrossRef] [PubMed]
- Franklin, C.C.; Backos, D.S.; Mohar, I.; White, C.C.; Forman, H.J.; Kavanagh, T.J. Structure, function, and post-translational regulation of the catalytic and modifier subunits of glutamate cysteine ligase. Mol. Asp. Med. 2009, 30, 86–98. [Google Scholar] [CrossRef]
- Chen, Y.; Shertzer, H.G.; Schneider, S.N.; Nebert, D.W.; Dalton, T.P. Glutamate cysteine ligase catalysis: Dependence on ATP and modifier subunit for regulation of tissue glutathione levels. J. Biol. Chem. 2005, 280, 33766–33774. [Google Scholar] [CrossRef]
- Rohatgi, N.; Zou, W.; Li, Y.; Cho, K.; Collins, P.L.; Tycksen, E.; Pandey, G.; DeSelm, C.J.; Patti, G.J.; Dey, A.; et al. BAP1 promotes osteoclast function by metabolic reprogramming. Nat. Commun. 2023, 14, 5923. [Google Scholar] [CrossRef] [PubMed]
- Huh, Y.J.; Kim, J.M.; Kim, H.; Song, H.; So, H.; Lee, S.Y.; Kwon, S.B.; Kim, H.J.; Kim, H.H.; Lee, S.H.; et al. Regulation of osteoclast differentiation by the redox-dependent modulation of nuclear import of transcription factors. Cell Death Differ. 2006, 13, 1138–1146. [Google Scholar] [CrossRef] [PubMed]
- Hu, G.; Yu, Y.; Sharma, D.; Pruett-Miller, S.M.; Ren, Y.; Zhang, G.F.; Karner, C.M. Glutathione limits RUNX2 oxidation and degradation to regulate bone formation. JCI Insight 2023, 8, e166888. [Google Scholar] [CrossRef] [PubMed]
- Sanjana, N.E.; Shalem, O.; Zhang, F. Improved vectors and genome-wide libraries for CRISPR screening. Nat. Methods 2014, 11, 783–784. [Google Scholar] [CrossRef]
- Hu, G.; Yu, Y.; Ren, Y.; Tower, R.J.; Zhang, G.F.; Karner, C.M. Glutaminolysis provides nucleotides and amino acids to regulate osteoclast differentiation in mice. EMBO Rep. 2024, 25, 4515–4541. [Google Scholar] [CrossRef] [PubMed]
- Herrmann, M.; Widmann, T.; Colaianni, G.; Colucci, S.; Zallone, A.; Herrmann, W. Increased osteoclast activity in the presence of increased homocysteine concentrations. Clin. Chem. 2005, 51, 2348–2353. [Google Scholar] [CrossRef]
- Cao, J.J.; Picklo, M.J. N-acetylcysteine supplementation decreases osteoclast differentiation and increases bone mass in mice fed a high-fat diet. J. Nutr. 2014, 144, 289–296. [Google Scholar] [CrossRef]
- Kim, H.; Kim, I.Y.; Lee, S.Y.; Jeong, D. Bimodal actions of reactive oxygen species in the differentiation and bone-resorbing functions of osteoclasts. FEBS Lett. 2006, 580, 5661–5665. [Google Scholar] [CrossRef]
- Fujita, H.; Ochi, M.; Ono, M.; Aoyama, E.; Ogino, T.; Kondo, Y.; Ohuchi, H. Glutathione accelerates osteoclast differentiation and inflammatory bone destruction. Free Radic. Res. 2019, 53, 226–236. [Google Scholar] [CrossRef]
- Xiao, L.; Zhong, M.; Huang, Y.; Zhu, J.; Tang, W.; Li, D.; Shi, J.; Lu, A.; Yang, H.; Geng, D.; et al. Puerarin alleviates osteoporosis in the ovariectomy-induced mice by suppressing osteoclastogenesis via inhibition of TRAF6/ROS-dependent MAPK/NF-kappaB signaling pathways. Aging 2020, 12, 21706–21729. [Google Scholar] [CrossRef]
- Zhang, C.; Li, H.; Li, J.; Hu, J.; Yang, K.; Tao, L. Oxidative stress: A common pathological state in a high-risk population for osteoporosis. Biomed. Pharmacother. 2023, 163, 114834. [Google Scholar] [CrossRef]
- Marques-Carvalho, A.; Kim, H.N.; Almeida, M. The role of reactive oxygen species in bone cell physiology and pathophysiology. Bone Rep. 2023, 19, 101664. [Google Scholar] [CrossRef]
- Spencer, J.A.; Ferraro, F.; Roussakis, E.; Klein, A.; Wu, J.; Runnels, J.M.; Zaher, W.; Mortensen, L.J.; Alt, C.; Turcotte, R.; et al. Direct measurement of local oxygen concentration in the bone marrow of live animals. Nature 2014, 508, 269–273. [Google Scholar] [CrossRef] [PubMed]
- Shooter, R.A.; Gey, G.O. Studies of the mineral requirements of mammalian cells. Br. J. Exp. Pathol. 1952, 33, 98–103. [Google Scholar]
- Boveris, A.; Chance, B. The mitochondrial generation of hydrogen peroxide. General properties and effect of hyperbaric oxygen. Biochem. J. 1973, 134, 707–716. [Google Scholar] [CrossRef] [PubMed]
- Turrens, J.F.; Freeman, B.A.; Crapo, J.D. Hyperoxia increases H2O2 release by lung mitochondria and microsomes. Arch. Biochem. Biophys. 1982, 217, 411–421. [Google Scholar] [CrossRef]
- Hoffman, D.L.; Salter, J.D.; Brookes, P.S. Response of mitochondrial reactive oxygen species generation to steady-state oxygen tension: Implications for hypoxic cell signaling. Am. J. Physiol. Heart Circ. Physiol. 2007, 292, H101–H108. [Google Scholar] [CrossRef]
- Hoffman, D.L.; Brookes, P.S. Oxygen sensitivity of mitochondrial reactive oxygen species generation depends on metabolic conditions. J. Biol. Chem. 2009, 284, 16236–16245. [Google Scholar] [CrossRef] [PubMed]
- Li, B.; Lee, W.C.; Song, C.; Ye, L.; Abel, E.D.; Long, F. Both aerobic glycolysis and mitochondrial respiration are required for osteoclast differentiation. FASEB J. 2020, 34, 11058–11067. [Google Scholar] [CrossRef] [PubMed]
- Kushwaha, P.; Alekos, N.S.; Kim, S.P.; Li, Z.; Wolfgang, M.J.; Riddle, R.C. Mitochondrial fatty acid beta-oxidation is important for normal osteoclast formation in growing female mice. Front. Physiol. 2022, 13, 997358. [Google Scholar] [CrossRef] [PubMed]
- Song, C.; Valeri, A.; Song, F.; Ji, X.; Liao, X.; Marmo, T.; Seeley, R.; Rutter, J.; Long, F. Sexual dimorphism of osteoclast reliance on mitochondrial oxidation of energy substrates in the mouse. JCI Insight 2023, 8, e174293. [Google Scholar] [CrossRef]
- Stegen, S.; Moermans, K.; Stockmans, I.; Thienpont, B.; Carmeliet, G. The serine synthesis pathway drives osteoclast differentiation through epigenetic regulation of NFATc1 expression. Nat. Metab. 2024, 6, 141–152. [Google Scholar] [CrossRef]
- Go, M.; Shin, E.; Jang, S.Y.; Nam, M.; Hwang, G.S.; Lee, S.Y. BCAT1 promotes osteoclast maturation by regulating branched-chain amino acid metabolism. Exp. Mol. Med. 2022, 54, 825–833. [Google Scholar] [CrossRef]
- Ling, H.H.; Pan, Y.P.; Fan, C.W.; Tseng, W.K.; Huang, J.S.; Wu, T.H.; Chou, W.C.; Wang, C.H.; Yeh, K.Y.; Chang, P.H. Clinical Significance of Serum Glutamine Level in Patients with Colorectal Cancer. Nutrients 2019, 11, 898. [Google Scholar] [CrossRef] [PubMed]
- Babu, G.N.; Bawari, M.; Mathur, V.N.; Kalita, J.; Misra, U.K. Blood glutamate levels in patients with motor neuron disease. Clin. Chim. Acta 1998, 273, 195–200. [Google Scholar] [CrossRef]
- Tu, B.P.; Weissman, J.S. Oxidative protein folding in eukaryotes: Mechanisms and consequences. J. Cell Biol. 2004, 164, 341–346. [Google Scholar] [CrossRef]
- Shimizu, Y.; Hendershot, L.M. Oxidative folding: Cellular strategies for dealing with the resultant equimolar production of reactive oxygen species. Antioxid. Redox Signal. 2009, 11, 2317–2331. [Google Scholar] [CrossRef]
- Murphy, M.P. How mitochondria produce reactive oxygen species. Biochem. J. 2009, 417, 1–13. [Google Scholar] [CrossRef] [PubMed]
Name | gRNA Sequence |
---|---|
SP742.GCLC.g4 | TACATGATCGAAGGAACGCCNGG |
SP742.GCLC.g19 | TCAGACATCGTTCCTCCGTANGG |
SP743.GCLC.g7 | TGCTTGTTTATGGCTTCATCNGG |
SP744.GCLC.g3 | TAGTGGCCAGCTGATCATAANGG |
SP744.GCLC.g4 | TCTTGCCTCAGATATGCTGCNGG |
SP498.mCherry.g17 | CAAGTAGTCGGGGATGTCGGNGG |
SP498.mCherry.g19 | AGTAGTCGGGGATGTCGGCGNGG |
SP499.LUC.g3 | CAATTCTTTATGCCGGTGTTNGG |
SP499.LUC.g4 | GTGTTGGGCGCGTTATTTATNGG |
Gene Symbol | Forward | Reverse |
---|---|---|
Nfatc1 | GGAGCGGAGAAACTTTGCG | GTGACACTAGGGGACACATAACT |
c-Fos | CGGGTTTCAACGCCGACTA | TTGGCACTAGAGACGGACAGA |
Acp5 | CACTCCCACCCTGAGATTTGT | CATCGTCTGCACGGTTCTG |
Dc-stamp | TACGTGGAGAGAAGCAAGGAA | ACACTGAGACGTGGTTTAGGAAT |
Itgb3 | CCACACGAGGCGTGAACTC | CTTCAGGTTACATCGGGGTGA |
Atp6v0d2 | CAGAGCTGTACTTCAATGTGGAC | AGGTCTCACACTGCACTAGGT |
Ctsk | GAAGAAGACTCACCAGAAGCAG | TCCAGGTTATGGGCAGAGATT |
β-actin | AGATGTGGATCAGCAAGCAG | GCGCAAGTTAGGTTTTGTCA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hu, G.; Whitaker, A.L.; Zhang, G.-F.; Karner, C.M. Divergent Requirements for Glutathione Biosynthesis During Osteoclast Differentiation In Vitro and In Vivo. Antioxidants 2025, 14, 197. https://doi.org/10.3390/antiox14020197
Hu G, Whitaker AL, Zhang G-F, Karner CM. Divergent Requirements for Glutathione Biosynthesis During Osteoclast Differentiation In Vitro and In Vivo. Antioxidants. 2025; 14(2):197. https://doi.org/10.3390/antiox14020197
Chicago/Turabian StyleHu, Guoli, Amy L. Whitaker, Guo-Fang Zhang, and Courtney M. Karner. 2025. "Divergent Requirements for Glutathione Biosynthesis During Osteoclast Differentiation In Vitro and In Vivo" Antioxidants 14, no. 2: 197. https://doi.org/10.3390/antiox14020197
APA StyleHu, G., Whitaker, A. L., Zhang, G.-F., & Karner, C. M. (2025). Divergent Requirements for Glutathione Biosynthesis During Osteoclast Differentiation In Vitro and In Vivo. Antioxidants, 14(2), 197. https://doi.org/10.3390/antiox14020197