Limosilactobacillus reuteri ZY15 Alleviates Intestinal Inflammation and Barrier Dysfunction via AKT/mTOR/HIF-1α/RORγt/IL-17 Signaling and the Gut Microbiota in ETEC K88-Challenged Mice
Abstract
1. Introduction
2. Materials and Methods
2.1. Mice and Bacteria
2.2. Sample Collection
2.3. Morphology and Histology Analysis
2.4. Lactobacillus and E. coli Load Detection in Colonic Chyme and Visceral Organs
2.5. Real-Time Quantitative PCR
2.6. Enzyme-Linked Immunosorbent Assay
2.7. Transcriptomics
2.8. 16S rRNA Gut Microbiota Analysis
2.9. Statistical Analysis
3. Results
3.1. L. reuteri ZY15 Effects on Mouse Body Weight, Serum Indices, and Fecal Bacterial Composition After ETEC K88 Challenge
3.2. L. reuteri ZY15 Effects on Intestinal Pathology and Morphology After ETEC K88 Challenge
3.3. L. reuteri ZY15 Effects on the Ileal Transcriptome After ETEC K88 Challenge
3.4. L. reuteri ZY15 Effects on Ileal Inflammation and Barrier Function Integrity After ETEC K88 Challenge
3.5. L. reuteri ZY15 Effects on the AKT/mTOR/HIF-1α/RORγt/IL-17 Pathway in Ileum Tissue After ETEC K88 Challenge
3.6. L. reuteri ZY15 Effects on Bacterial Composition in Cecal Digesta After ETEC K88 Challenge
3.7. L. reuteri ZY15 Correlations Between the Gut Microbiota and Cytokine Levels After ETEC K88 Challenge
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Gresse, R.; Chaucheyras-Durand, F.; Fleury, M.A.; Van De Wiele, T.; Forano, E.; Blanquet-Diot, S. Gut Microbiota Dysbiosis in Postweaning Piglets: Understanding the Keys to Health. Trends Microbiol. 2017, 25, 851–873. [Google Scholar] [CrossRef] [PubMed]
- Larcombe, S.; Hutton, M.L.; Lyras, D. Involvement of Bacteria Other Than Clostridium difficile in Antibiotic-Associated Diarrhoea. Trends Microbiol. 2016, 24, 463–476. [Google Scholar] [CrossRef] [PubMed]
- Schokker, D.; Zhang, J.; Vastenhouw, S.A.; Heilig, H.G.H.J.; Smidt, H.; Rebel, J.M.J.; Smits, M.A. Long-Lasting Effects of Early-Life Antibiotic Treatment and Routine Animal Handling on Gut Microbiota Composition and Immune System in Pigs. PLoS ONE 2015, 10, e0116523. [Google Scholar] [CrossRef]
- Duy, P.T.; Thi Nguyen, T.N.; Duong, V.T.; Chung The, H.; Alcock, F.; Boinett, C.; Ho Ngoc Dan, T.; Ha Thanh, T.; Thwaites, G.E.; Rabaa, M.A.; et al. Commensal E. coli Are a Reservoir for the Transfer of XDR Plasmids into Epidemic Fluoroquinolone-Resistant Shigella Sonnei. Nat. Microbiol. 2020, 5, 256–264. [Google Scholar] [CrossRef]
- Tang, X.; Xiong, K.; Fang, R.; Li, M. Weaning Stress and Intestinal Health of Piglets: A Review. Front. Immunol. 2022, 13, 1042778. [Google Scholar] [CrossRef]
- Camilleri, M.; Madsen, K.; Spiller, R.; Van Meerveld, B.G.; Verne, G.N. Intestinal Barrier Function in Health and Gastrointestinal Disease. Neurogastroenterol. Motil. 2012, 24, 503–512. [Google Scholar] [CrossRef]
- Chen, Y.; Cui, W.; Li, X.; Yang, H. Interaction Between Commensal Bacteria, Immune Response and the Intestinal Barrier in Inflammatory Bowel Disease. Front. Immunol. 2021, 12, 761981. [Google Scholar] [CrossRef]
- Eltzschig, H.K.; Carmeliet, P. Hypoxia and Inflammation. N. Engl. J. Med. 2011, 364, 656–665. [Google Scholar] [CrossRef]
- Kathiria, A.S.; Butcher, L.D.; Feagins, L.A.; Souza, R.F.; Boland, C.R.; Theiss, A.L. Prohibitin 1 Modulates Mitochondrial Stress-Related Autophagy in Human Colonic Epithelial Cells. PLoS ONE 2012, 7, e31231. [Google Scholar] [CrossRef]
- Yasuda, K.; Takeuchi, Y.; Hirota, K. The Pathogenicity of Th17 Cells in Autoimmune Diseases. Semin. Immunopathol. 2019, 41, 283–297. [Google Scholar] [CrossRef]
- Sun, L.; Girnary, M.; Wang, L.; Jiao, Y.; Zeng, E.; Mercer, K.; Zhang, J.; Marchesan, J.T.; Yu, N.; Moss, K.; et al. IL-10 Dampens an IL-17–Mediated Periodontitis-Associated Inflammatory Network. J. Immunol. 2020, 204, 2177–2191. [Google Scholar] [CrossRef] [PubMed]
- Moutsopoulos, N.M.; Chalmers, N.I.; Barb, J.J.; Abusleme, L.; Greenwell-Wild, T.; Dutzan, N.; Paster, B.J.; Munson, P.J.; Fine, D.H.; Uzel, G.; et al. Subgingival Microbial Communities in Leukocyte Adhesion Deficiency and Their Relationship with Local Immunopathology. PLoS Pathog. 2015, 11, e1004698. [Google Scholar] [CrossRef] [PubMed]
- Malard, F.; Dore, J.; Gaugler, B.; Mohty, M. Introduction to Host Microbiome Symbiosis in Health and Disease. Mucosal. Immunol. 2021, 14, 547–554. [Google Scholar] [CrossRef] [PubMed]
- Agus, A.; Planchais, J.; Sokol, H. Gut Microbiota Regulation of Tryptophan Metabolism in Health and Disease. Cell Host Microbe 2018, 23, 716–724. [Google Scholar] [CrossRef] [PubMed]
- Wu, J.; Zhao, Y.; Wang, X.; Kong, L.; Johnston, L.J.; Lu, L.; Ma, X. Dietary Nutrients Shape Gut Microbes and Intestinal Mucosa via Epigenetic Modifications. Crit. Rev. Food Sci. Nutr. 2022, 62, 783–797. [Google Scholar] [CrossRef]
- Wu, H.; Xie, S.; Miao, J.; Li, Y.; Wang, Z.; Wang, M.; Yu, Q. Lactobacillus reuteri Maintains Intestinal Epithelial Regeneration and Repairs Damaged Intestinal Mucosa. Gut Microbes 2020, 11, 997–1014. [Google Scholar] [CrossRef]
- Tao, S.; Fan, J.; Li, J.; Wu, Z.; Yao, Y.; Wang, Z.; Wu, Y.; Liu, X.; Xiao, Y.; Wei, H. Extracellular Vesicles Derived from Lactobacillus Johnsonii Promote Gut Barrier Homeostasis by Enhancing M2 Macrophage Polarization. J. Adv. Res. 2024; in press. [Google Scholar] [CrossRef]
- Schieber, A.M.P.; Lee, Y.M.; Chang, M.W.; Leblanc, M.; Collins, B.; Downes, M.; Evans, R.M.; Ayres, J.S. Disease Tolerance Mediated by Microbiome E. coli Involves Inflammasome and IGF-1 Signaling. Science 2015, 350, 558–563. [Google Scholar] [CrossRef]
- Mu, Q.; Tavella, V.J.; Luo, X.M. Role of Lactobacillus Reuteri in Human Health and Diseases. Front. Microbiol. 2018, 9, 757. [Google Scholar] [CrossRef]
- Yi, H.; Wang, L.; Xiong, Y.; Wang, Z.; Qiu, Y.; Wen, X.; Jiang, Z.; Yang, X.; Ma, X. Lactobacillus reuteri LR1 Improved Expression of Genes of Tight Junction Proteins via the MLCK Pathway in IPEC-1 Cells during Infection with Enterotoxigenic Escherichia coli K88. Mediat. Inflamm. 2018, 2018, 6434910. [Google Scholar] [CrossRef]
- Ji, C.; Fan, Y.; Zhao, L. Review on Biological Degradation of Mycotoxins. Anim. Nutr. 2016, 2, 127–133. [Google Scholar] [CrossRef] [PubMed]
- Hu, J.; Ma, L.; Nie, Y.; Chen, J.; Zheng, W.; Wang, X.; Xie, C.; Zheng, Z.; Wang, Z.; Yang, T.; et al. A Microbiota-Derived Bacteriocin Targets the Host to Confer Diarrhea Resistance in Early-Weaned Piglets. Cell Host Microbe 2018, 24, 817–832.e8. [Google Scholar] [CrossRef] [PubMed]
- Wu, J.; Lin, Z.; Wang, X.; Zhao, Y.; Zhao, J.; Liu, H.; Johnston, L.J.; Lu, L.; Ma, X. Limosilactobacillus reuteri SLZX19-12 Protects the Colon from Infection by Enhancing Stability of the Gut Microbiota and Barrier Integrity and Reducing Inflammation. Microbiol. Spectr. 2022, 10, e02124-21. [Google Scholar] [CrossRef] [PubMed]
- Li, N.; Zuo, B.; Huang, S.; Zeng, B.; Han, D.; Li, T.; Liu, T.; Wu, Z.; Wei, H.; Zhao, J.; et al. Spatial Heterogeneity of Bacterial Colonization across Different Gut Segments Following Inter-Species Microbiota Transplantation. Microbiome 2020, 8, 161. [Google Scholar] [CrossRef]
- Fachi, J.L.; de Souza Felipe, J.; Pral, L.P.; da Silva, B.K.; Corrêa, R.O.; de Andrade, M.C.P.; da Fonseca, D.M.; Basso, P.J.; Câmara, N.O.S.; de Sales e Souza, É.L.; et al. Butyrate Protects Mice from Clostridium difficile-Induced Colitis through an HIF-1-Dependent Mechanism. Cell Rep. 2019, 27, 750–761.e7. [Google Scholar] [CrossRef]
- Gao, Y.; Han, F.; Huang, X.; Rong, Y.; Yi, H.; Wang, Y. Changes in Gut Microbial Populations, Intestinal Morphology, Expression of Tight Junction Proteins, and Cytokine Production between Two Pig Breeds after Challenge with Escherichia coli K88: A Comparative Study1. J. Anim. Sci. 2013, 91, 5614–5625. [Google Scholar] [CrossRef]
- Zhou, Y.; Ni, X.; Duan, L.; Niu, L.; Liu, Q.; Zeng, Y.; Wang, Q.; Wang, J.; Khalique, A.; Pan, K.; et al. Lactobacillus plantarum BSGP201683 Improves the Intestinal Barrier of Giant Panda Microbiota-Associated Mouse Infected by Enterotoxigenic Escherichia coli K88. Probiotics Antimicro. Prot. 2021, 13, 664–676. [Google Scholar] [CrossRef]
- Fedorak, R.N. Understanding Why Probiotic Therapies Can Be Effective in Treating IBD. J. Clin. Gastroenterol. 2008, 42 Pt 1 (Suppl. 3), S111–S115. [Google Scholar] [CrossRef]
- Lee, J.W.; Patterson, R.; Woyengo, T.A. Porcine in Vitro Degradation and Fermentation Characteristics of Canola Co-Products without or with Fiber-Degrading Enzymes. Anim. Feed. Sci. Technol. 2018, 241, 133–140. [Google Scholar] [CrossRef]
- Yao, D.; Dai, W.; Dong, M.; Dai, C.; Wu, S. MUC2 and Related Bacterial Factors: Therapeutic Targets for Ulcerative Colitis. EBioMedicine 2021, 74, 103751. [Google Scholar] [CrossRef]
- Liu, Y.; Yu, X.; Zhao, J.; Zhang, H.; Zhai, Q.; Chen, W. The Role of MUC2 Mucin in Intestinal Homeostasis and the Impact of Dietary Components on MUC2 Expression. Int. J. Biol. Macromol. 2020, 164, 884–891. [Google Scholar] [CrossRef] [PubMed]
- Peterson, L.W.; Artis, D. Intestinal Epithelial Cells: Regulators of Barrier Function and Immune Homeostasis. Nat. Rev. Immunol. 2014, 14, 141–153. [Google Scholar] [CrossRef] [PubMed]
- Chen, F.; Chu, C.; Wang, X.; Yang, C.; Deng, Y.; Duan, Z.; Wang, K.; Liu, B.; Ji, W.; Ding, W. Hesperetin Attenuates Sepsis-Induced Intestinal Barrier Injury by Regulating Neutrophil Extracellular Trap Formation via the ROS/Autophagy Signaling Pathway. Food Funct. 2023, 14, 4213–4227. [Google Scholar] [CrossRef]
- Lin, Q.; Fu, Q.; Li, X.; Luo, Y.; Luo, J.; Chen, D.; Mao, X.; Yu, B.; Zheng, P.; Huang, Z.; et al. Human β-Defensin 118 Attenuates Escherichia coli K88–Induced Inflammation and Intestinal Injury in Mice. Probiotics Antimicro. Prot. 2021, 13, 586–597. [Google Scholar] [CrossRef]
- Bischoff, S.C.; Barbara, G.; Buurman, W.; Ockhuizen, T.; Schulzke, J.-D.; Serino, M.; Tilg, H.; Watson, A.; Wells, J.M. Intestinal Permeability—A New Target for Disease Prevention and Therapy. BMC Gastroenterol. 2014, 14, 189. [Google Scholar] [CrossRef]
- Xiao, Y.-T.; Yan, W.-H.; Cao, Y.; Yan, J.-K.; Cai, W. Neutralization of IL-6 and TNF-α Ameliorates Intestinal Permeability in DSS-Induced Colitis. Cytokine 2016, 83, 189–192. [Google Scholar] [CrossRef]
- Stephens, M.; von der Weid, P.-Y. Lipopolysaccharides Modulate Intestinal Epithelial Permeability and Inflammation in a Species-Specific Manner. Gut Microbes 2020, 11, 421–432. [Google Scholar] [CrossRef]
- Karimi, S.; Jonsson, H.; Lundh, T.; Roos, S. Lactobacillus reuteri Strains Protect Epithelial Barrier Integrity of IPEC-J2 Monolayers from the Detrimental Effect of Enterotoxigenic Escherichia Coli. Physiol. Rep. 2018, 6, e13514. [Google Scholar] [CrossRef]
- Hou, C.; Liu, H.; Zhang, J.; Zhang, S.; Yang, F.; Zeng, X.; Thacker, P.A.; Zhang, G.; Qiao, S. Intestinal Microbiota Succession and Immunomodulatory Consequences after Introduction of Lactobacillus reuteri I5007 in Neonatal Piglets. PLoS ONE 2015, 10, e0119505. [Google Scholar] [CrossRef]
- Zhang, J.; Zhang, C.; Yu, L.; Tian, F.; Chen, W.; Zhai, Q. Analysis of the Key Genes of Lactobacillus reuteri Strains Involved in the Protection against Alcohol-Induced Intestinal Barrier Damage. Food Funct. 2024, 15, 6629–6641. [Google Scholar] [CrossRef]
- Zeng, B.; Shi, S.; Ashworth, G.; Dong, C.; Liu, J.; Xing, F. ILC3 Function as a Double-Edged Sword in Inflammatory Bowel Diseases. Cell Death Dis. 2019, 10, 315. [Google Scholar] [CrossRef] [PubMed]
- Lissner, D.; Schumann, M.; Batra, A.; Kredel, L.-I.; Kühl, A.A.; Erben, U.; May, C.; Schulzke, J.-D.; Siegmund, B. Monocyte and M1 Macrophage-Induced Barrier Defect Contributes to Chronic Intestinal Inflammation in IBD. Inflamm. Bowel Dis. 2015, 21, 1297–1305. [Google Scholar] [CrossRef] [PubMed]
- Kumar, R.; Theiss, A.L.; Venuprasad, K. RORγt Protein Modifications and IL-17-Mediated Inflammation. Trends Immunol. 2021, 42, 1037–1050. [Google Scholar] [CrossRef] [PubMed]
- Ivanov, I.I.; McKenzie, B.S.; Zhou, L.; Tadokoro, C.E.; Lepelley, A.; Lafaille, J.J.; Cua, D.J.; Littman, D.R. The Orphan Nuclear Receptor RORγt Directs the Differentiation Program of Proinflammatory IL-17+ T Helper Cells. Cell 2006, 126, 1121–1133. [Google Scholar] [CrossRef] [PubMed]
- Yang, X.O.; Pappu, B.P.; Nurieva, R.; Akimzhanov, A.; Kang, H.S.; Chung, Y.; Ma, L.; Shah, B.; Panopoulos, A.D.; Schluns, K.S.; et al. T Helper 17 Lineage Differentiation Is Programmed by Orphan Nuclear Receptors RORα and RORγ. Immunity 2008, 28, 29–39. [Google Scholar] [CrossRef]
- Di Luccia, B.; Gilfillan, S.; Cella, M.; Colonna, M.; Huang, S.C.-C. ILC3s Integrate Glycolysis and Mitochondrial Production of Reactive Oxygen Species to Fulfill Activation Demands. J. Exp. Med. 2019, 216, 2231–2241. [Google Scholar] [CrossRef]
- Masoud, G.N.; Li, W. HIF-1α Pathway: Role, Regulation and Intervention for Cancer Therapy. Acta Pharm. Sin. B 2015, 5, 378–389. [Google Scholar] [CrossRef]
- Lee, P.; Chandel, N.S.; Simon, M.C. Cellular Adaptation to Hypoxia through Hypoxia Inducible Factors and Beyond. Nat. Rev. Mol. Cell. Biol. 2020, 21, 268–283. [Google Scholar] [CrossRef]
- Han, J.X.; Tao, Z.H.; Wang, J.L.; Zhang, L.; Yu, C.Y.; Kang, Z.R.; Xie, Y.; Li, J.; Lu, S.; Cui, Y.; et al. Microbiota-Derived Tryptophan Catabolites Mediate the Chemopreventive Effects of Statins on Colorectal Cancer. Nat. Microbiol. 2023, 8, 919–933. [Google Scholar] [CrossRef]
- Yu, Z.; Chen, J.; Liu, Y.; Meng, Q.; Liu, H.; Yao, Q.; Song, W.; Ren, X.; Chen, X. The role of potential probiotic strains Lactobacillus reuteri in various intestinal diseases: New roles for an old player. Front. Microbiol. 2023, 14, 1095555. [Google Scholar] [CrossRef]
- Jiang, Z.; Jiang, P.; Ji, S.; Su, D.; Xu, G.; Zhang, M. Research progress on Limosilactibacilus reuteri in diseases. Microbiol. Res. 2023, 276, 127482. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Chen, W.-D.; Wang, Y.-D. The Relationship Between Gut Microbiota and Inflammatory Diseases: The Role of Macrophages. Front. Microbiol. 2020, 11, 1065. [Google Scholar] [CrossRef] [PubMed]
- Al Bander, Z.; Nitert, M.D.; Mousa, A.; Naderpoor, N. The Gut Microbiota and Inflammation: An Overview. Int. J. Environ. Res. Public Health 2020, 17, 7618. [Google Scholar] [CrossRef] [PubMed]
- Yang, Y.; Chen, G.; Yang, Q.; Ye, J.; Cai, X.; Tsering, P.; Cheng, X.; Hu, C.; Zhang, S.; Cao, P. Gut Microbiota Drives the Attenuation of Dextran Sulphate Sodium-Induced Colitis by Huangqin Decoction. Oncotarget 2017, 8, 48863–48874. [Google Scholar] [CrossRef] [PubMed]
- Hardy, H.; Harris, J.; Lyon, E.; Beal, J.; Foey, A.D. Probiotics, Prebiotics and Immunomodulation of Gut Mucosal Defences: Homeostasis and Immunopathology. Nutrients 2013, 5, 1869–1912. [Google Scholar] [CrossRef]
- Cani, P.D.; Depommier, C.; Derrien, M.; Everard, A.; de Vos, W.M. Akkermansia muciniphila: Paradigm for next-generation beneficial microorganisms. Nat. Rev. Gastroenterol. Hepatol. 2022, 19, 625–637. [Google Scholar] [CrossRef]
- Grenda, A.; Iwan, E.; Chmielewska, I.; Krawczyk, P.; Giza, A.; Bomba, A.; Frąk, M.; Rolska, A.; Szczyrek, M.; Kieszko, R.; et al. Presence of Akkermansiaceae in Gut Microbiome and Immunotherapy Effectiveness in Patients with Advanced Non-Small Cell Lung Cancer. AMB Express 2022, 12, 86. [Google Scholar] [CrossRef]
- Liu, Y.; Zhou, M.; Yang, M.; Jin, C.; Song, Y.; Chen, J.; Gao, M.; Ai, Z.; Su, D. Pulsatilla Chinensis Saponins Ameliorate Inflammation and DSS-Induced Ulcerative Colitis in Rats by Regulating the Composition and Diversity of Intestinal Flora. Front. Cell. Infect. Microbiol. 2021, 11, 728929. [Google Scholar] [CrossRef]
Target | Primer Sequence (5′-3′) | Accession Number |
---|---|---|
GAPDH | F: GGGTCCCAGCTTAGGTTCAT R: CCCAATACGGCCAAATCCGT | NM_001289726.2 |
IL-1β | F: ATGCCACCTTTTGACAGTGATG R: TGTGCTGCTGCGAGATTTGA | NM_008361.4 |
IFN-γ | F: TAGCCTCACCGCCTATCACT R: CACCAACATGTGCGGTTTGT | NM_010511.3 |
Occludin | F: GCAATGACATGTATGGCGGAG R: TGTCCCAAGCAAGTGTGGAA | NM_001360537.1 |
ZO-1 | F: AGGTGAAACTCTGCTGAGCC R: GCAAAAGACCAACCGTCAGG | NM_001163574.1 |
Claudin-1 | F: GGCTTCTCTGGGATGGATCG R: TTTGCGAAACGCAGGACATC | NM_016674.4 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xu, X.; Zhang, H.; Meng, K.; Cai, H.; Liu, W.; Song, L.; Zhang, Z.; Zhu, Q.; Han, X.; Han, Y.; et al. Limosilactobacillus reuteri ZY15 Alleviates Intestinal Inflammation and Barrier Dysfunction via AKT/mTOR/HIF-1α/RORγt/IL-17 Signaling and the Gut Microbiota in ETEC K88-Challenged Mice. Antioxidants 2025, 14, 58. https://doi.org/10.3390/antiox14010058
Xu X, Zhang H, Meng K, Cai H, Liu W, Song L, Zhang Z, Zhu Q, Han X, Han Y, et al. Limosilactobacillus reuteri ZY15 Alleviates Intestinal Inflammation and Barrier Dysfunction via AKT/mTOR/HIF-1α/RORγt/IL-17 Signaling and the Gut Microbiota in ETEC K88-Challenged Mice. Antioxidants. 2025; 14(1):58. https://doi.org/10.3390/antiox14010058
Chicago/Turabian StyleXu, Xin, Hongwei Zhang, Kun Meng, Hongying Cai, Weiwei Liu, Liye Song, Zihan Zhang, Qijun Zhu, Xiling Han, Yunsheng Han, and et al. 2025. "Limosilactobacillus reuteri ZY15 Alleviates Intestinal Inflammation and Barrier Dysfunction via AKT/mTOR/HIF-1α/RORγt/IL-17 Signaling and the Gut Microbiota in ETEC K88-Challenged Mice" Antioxidants 14, no. 1: 58. https://doi.org/10.3390/antiox14010058
APA StyleXu, X., Zhang, H., Meng, K., Cai, H., Liu, W., Song, L., Zhang, Z., Zhu, Q., Han, X., Han, Y., & Yang, P. (2025). Limosilactobacillus reuteri ZY15 Alleviates Intestinal Inflammation and Barrier Dysfunction via AKT/mTOR/HIF-1α/RORγt/IL-17 Signaling and the Gut Microbiota in ETEC K88-Challenged Mice. Antioxidants, 14(1), 58. https://doi.org/10.3390/antiox14010058