Exploring the Therapeutic Potential of Cannabidiol in U87MG Cells: Effects on Autophagy and NRF2 Pathway
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cell Culture and Treatment
2.2. Cell Viability Assay
2.3. JC-1 Staining Assay
2.4. Western Blotting Analysis
2.5. Real-Time PCR
2.6. Cell Transfection and Luciferase Assay
2.7. Dapi Staining Assay
2.8. Statistical Analysis
3. Results
3.1. Effects of CBD on U87MG Glioma Cell Viability
3.2. Effects of CBD on Mitochondrial Functionality and Biogenesis
3.3. Effects of CBD on Apoptosis Pathway
3.4. CBD Regulates the Expression of NRF2 and Its Target Genes
3.5. Effects of CBD on NRF2 Stability
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Ekiner, S.A.; Gęgotek, A.; Skrzydlewska, E. The molecular activity of cannabidiol in the regulation of Nrf2 system interacting with NF-κB pathway under oxidative stress. Redox Biol. 2022, 57, 102489. [Google Scholar] [CrossRef]
- Pisanti, S.; Picardi, P.; D’Alessandro, A.; Laezza, C.; Bifulco, M. The endocannabinoid signaling system in cancer. Trends Pharmacol. Sci. 2013, 34, 273–282. [Google Scholar] [CrossRef] [PubMed]
- Solinas, M.; Massi, P.; Cinquina, V.; Valenti, M.; Bolognini, D.; Gariboldi, M.; Monti, E.; Rubino, T.; Parolaro, D. Cannabidiol, a non-psychoactive cannabinoid compound, inhibits proliferation and invasion in U87-MG and T98G glioma cells through a multitarget effect. PLoS ONE 2013, 8, e76918. [Google Scholar] [CrossRef] [PubMed]
- Velasco, G.; Sánchez, C.; Guzmán, M. Towards the use of cannabinoids as antitumour agents. Nat. Rev. Cancer 2012, 12, 436–444. [Google Scholar] [CrossRef]
- Ciaglia, E.; Torelli, G.; Pisanti, S.; Picardi, P.; D’Alessandro, A.; Laezza, C.; Malfitano, A.M.; Fiore, D.; Pagano Zottola, A.C.; Proto, M.C.; et al. Cannabinoid receptor CB1 regulates STAT3 activity and its expression dictates the responsiveness to SR141716 treatment in human glioma patients’ cells. Oncotarget 2015, 6, 15464–15481. [Google Scholar] [CrossRef]
- Rybarczyk, A.; Majchrzak-Celińska, A.; Krajka-Kuźniak, V. Targeting Nrf2 Signaling Pathway in Cancer Prevention and Treatment: The Role of Cannabis Compounds. Antioxidants 2023, 12, 2052. [Google Scholar] [CrossRef] [PubMed]
- Aghagolzadeh, P.; Radpour, R.; Bachtler, M.; van Goor, H.; Smith, E.R.; Lister, A.; Odermatt, A.; Feelisch, M.; Pasch, A. Hydrogen sulfide attenuates calcification of vascular smooth muscle cells via KEAP1/NRF2/NQO1 activation. Atherosclerosis 2017, 265, 78–86. [Google Scholar] [CrossRef] [PubMed]
- Bellezza, I.; Giambanco, I.; Minelli, A.; Donato, R. Nrf2-Keap1 signaling in oxidative and reductive stress. Biochim. Biophys. Acta Mol. Cell Res. 2018, 1865, 721–733. [Google Scholar] [CrossRef]
- Zhu, Y.; Zhang, Y.; Huang, X.; Xie, Y.; Qu, Y.; Long, H.; Gu, N.; Jiang, W. Z-Ligustilide protects vascular endothelial cells from oxidative stress and rescues high fat dietinduced atherosclerosis by activating multiple NRF2 downstream genes. Atherosclerosis 2019, 284, 110–120. [Google Scholar] [CrossRef]
- Giannotti, L.; Stanca, E.; Di Chiara Stanca, B.; Spedicato, F.; Massaro, M.; Quarta, S.; Del Rio, D.; Mena, P.; Siculella, L.; Damiano, F. Coffee Bioactive N-Methylpyridinium: Unveiling Its Antilipogenic Effects by Targeting De Novo Lipogenesis in Human Hepatocytes. Mol. Nutr. Food Res. 2024, 68, e2400338. [Google Scholar] [CrossRef] [PubMed]
- Al-Mubarak, B.R.; Bell, K.F.S.; Chowdhry, S.; Meakin, P.J.; Baxter, P.S.; McKay, S.; Dando, O.; Ashford, M.L.J.; Gazaryan, I.; Hayes, J.D.; et al. Non-canonical Keap1-independent activation of Nrf2 in astrocytes by mild oxidative stress. Redox Biol. 2021, 47, 102158. [Google Scholar] [CrossRef]
- Sivinski, J.; Zhang, D.D.; Chapman, E. Targeting NRF2 to treat cancer. Semin. Cancer Biol. 2021, 76, 61–73. [Google Scholar] [CrossRef] [PubMed]
- Li, D.; Hong, X.; Zhao, F.; Ci, X.; Zhang, S. Targeting Nrf2 may reverse the drug resistance in ovarian cancer. Cancer Cell Int. 2021, 21, 1–10. [Google Scholar] [CrossRef] [PubMed]
- Kim, N.Y.; Gowda, S.G.S.; Lee, S.G.; Sethi, G.; Ahn, D.K. Cannabidiol induces ERK activation and ROS production to promote autophagy and ferroptosis in glioblastoma cells. Chem. Biol. Interact. 2024, 394, 110995. [Google Scholar] [CrossRef] [PubMed]
- Jastrząb, A.; Gęgotek, A.; Skrzydlewska, E. Cannabidiol regulates the expression of keratinocyte proteins involved in the inflammation process through transcriptional regulation. Cells 2019, 8, 827. [Google Scholar] [CrossRef]
- Bockmann, S.; Hinz, B. Cannabidiol promotes endothelial cell survival by heme oxygenase-1-mediated autophagy. Cells 2020, 9, 1703. [Google Scholar] [CrossRef]
- Damiano, F.; De Benedetto, G.E.; Longo, S.; Giannotti, L.; Fico, D.; Siculella, L.; Giudetti, A.M. Decanoic Acid and Not Octanoic Acid Stimulates Fatty Acid Synthesis in U87MG Glioblastoma Cells: A Metabolomics Study. Front. Neurosci. 2020, 14, 783–794. [Google Scholar] [CrossRef] [PubMed]
- Nabbi, A.; Riabowol, K. Rapid Isolation of Nuclei from Cells In Vitro. Cold Spring Harb. Protoc. 2015, 2015, 769–772. [Google Scholar] [CrossRef]
- Damiano, F.; Giannotti, L.; Gnoni, G.V.; Siculella, L.; Gnoni, A. Quercetin inhibition of SREBPs and ChREBP expression results in reduced cholesterol and fatty acid synthesis in C6 glioma cells. IJBCB 2019, 117, 105618. [Google Scholar] [CrossRef] [PubMed]
- Peeri, H.; Shalev, N.; Vinayaka, A.C.; Nizar, R.; Kazimirsky, G.; Namdar, D.; Anil, S.M.; Belausov, E.; Brodie, C.; Koltai, H. Specific Compositions of Cannabis sativa Compounds Have Cytotoxic Activity and Inhibit Motility and Colony Formation of Human Glioblastoma Cells In Vitro. Cancers 2021, 13, 1720. [Google Scholar] [CrossRef]
- Zhu, H.; Bögler, O.; Mónica, F.Z.; Kots, A.Y.; Murad, F.; Bian, K. Soluble Guanylate Cyclase β1 Subunit Represses Human Glioblastoma Growth. Cancers 2023, 15, 1567. [Google Scholar] [CrossRef]
- Giannotti, L.; Di Chiara Stanca, B.; Spedicato, F.; Stanca, E.; Damiano, F.; Quarta, S.; Massaro, M.; Siculella, L. Exploring the Neuroprotective Potential of N-Methylpyridinium against LPS-Induced Neuroinflammation: Insights from Molecular Mechanisms. Int. J. Mol. Sci. 2024, 25, 6000. [Google Scholar] [CrossRef] [PubMed]
- Bata, N.; Cosford, N.D.P. Cell Survival and Cell Death at the Intersection of Autophagy and Apoptosis: Implications for Current and Future Cancer Therapeutics. ACS Pharmacol. Transl. Sci. 2021, 4, 1728–1746. [Google Scholar] [CrossRef]
- Salbini, M.; Quarta, A.; Russo, F.; Giudetti, A.M.; Citti, C.; Cannazza, G.; Gigli, G.; Vergara, D.; Gaballo, A. Oxidative Stress and Multi-Organel Damage Induced by Two Novel Phytocannabinoids, CBDB and CBDP, in Breast Cancer Cells. Molecules 2021, 26, 5576. [Google Scholar] [CrossRef]
- Sun, S.; Hu, F.; Wu, J.; Zhang, S. Cannabidiol attenuates OGD/R-induced damage by enhancing mitochondrial bioenergetics and modulating glucose metabolism via pentose-phosphate pathway in hippocampal neurons. Redox Biol. 2017, 11, 577–585. [Google Scholar] [CrossRef] [PubMed]
- Atalay, S.; Dobrzynska, I.; Gęgotek, A.; Skrzydlewska, E. Cannabidiol protects keratinocyte cell membranes following exposure to UVB and hydrogen peroxide. Redox Biol. 2020, 36, 101613. [Google Scholar] [CrossRef]
- Wu, H.Y.; Huang, C.H.; Lin, Y.H.; Wang, C.C.; Jan, T.R. Cannabidiol induced apoptosis in human monocytes through mitochondrial permeability transition pore-mediated ROS production. Free. Radic. Biol. Med. 2018, 124, 311–318. [Google Scholar] [CrossRef]
- Jeong, S.; Kim, B.G.; Kim, D.Y.; Kim, B.R.; Kim, J.L.; Park, S.H.; Na, Y.J.; Jo, M.J.; Yun, H.K.; Jeong, Y.A.; et al. Cannabidiol overcomes oxaliplatin resistance by enhancing NOS3- and SOD2- induced autophagy in human colorectal cancer cells. Cancers 2019, 11, 781. [Google Scholar] [CrossRef]
- Yeisley, D.J.; Arabiyat, A.S.; Hahn, M.S. Cannabidiol-driven alterations to inflammatory protein landscape of lipopolysaccharide-activated macrophages in vitro may be mediated by autophagy and oxidative stress. Cannabis Cannabinoid Res. 2021, 6, 253–263. [Google Scholar] [CrossRef]
- Zhang, X.; Qin, Y.; Pan, Z.; Li, M.; Liu, X.; Chen, X.; Qu, G.; Zhou, L.; Xu, M.; Zheng, Q.; et al. Cannabidiol induces cell cycle arrest and cell apoptosis in human gastric cancer SGC-7901 cells. Biomolecules 2019, 9, 302. [Google Scholar] [CrossRef] [PubMed]
- Yang, Y.; Xing, D.; Zhou, F.; Chen, Q. Mitochondrial autophagy protects against heat shock-induced apoptosis through reducing cytosolic cytochrome c release and downstream caspase-3 activation. Biochem. Biophys. Res. Commun. 2010, 395, 190–195. [Google Scholar] [CrossRef]
- Gureev, A.P.; Shaforostova, E.A.; Popov, V.N. Regulation of Mitochondrial Biogenesis as a Way for Active Longevity: Interaction Between the Nrf2 and PGC-1α Signaling Pathways. Front. Genet. 2019, 10, 435. [Google Scholar] [CrossRef]
- Wang, S.; Zhao, X.; Chen, W.; Bo, N.; Wang, X.; Chi, Z.; Wu, W. Sirtuin 1 activation enhances the PGC-1α/mitochondrial antioxidant system pathway in status epilepticus. Mol. Med. Rep. 2015, 11, 521–526. [Google Scholar] [CrossRef]
- Klionsky, D.J.; Abdelmohsen, K.; Abe, A.; Abedin, M.J.; Abeliovich, H.; Acevedo Arozena, A.; Adamopoulos, I.E. Guidelines for the Use and Interpretation of Assays for Monitoring Autophagy, 3rd ed.; Autophagy; Taylor & Francis: Abingdon, UK, 2016; Volume 12, pp. 1–222. [Google Scholar]
- Zhou, F.; Yang, Y.; Xing, D. Bcl-2 and Bcl-xL play important roles in the crosstalk between autophagy and apoptosis. FEBS J. 2011, 278, 403–413. [Google Scholar] [CrossRef]
- Eisenberg-Lerner, A.; Bialik, S.; Simon, H.U.; Kimchi, A. Life and death partners: Apoptosis, autophagy and the cross-talk between them. Cell Death Differ. 2009, 16, 966–975. [Google Scholar] [CrossRef] [PubMed]
- Xiang, J.; Chao, D.T.; Korsmeyer, S.J. BAX-induced cell death may not require interleukin 1 beta-converting enzyme-like proteases. Proc. Natl. Acad. Sci. USA 1996, 93, 14559–14563. [Google Scholar] [CrossRef]
- Tait, S.; Green, D. Caspase-independent cell death: Leaving the set without the final cut. Oncogene 2008, 27, 6452–6461. [Google Scholar] [CrossRef]
- Chevrollier, A.; Loiseau, D.; Reynier, P.; Stepien, G. Adenine nucleotide translocase 2 is a key mitochondrial protein in cancer metabolism. Biochim. Biophys. Acta (BBA) 2011, 1807, 562–567. [Google Scholar] [CrossRef]
- Anwar, T.; Liu, X.; Suntio, T.; Marjamäki, A.; Biazik, J.; Chan, E.Y.W.; Varjosalo, M.; Eskelinen, E.-L. ER-Targeted Beclin 1 Supports Autophagosome Biogenesis in the Absence of ULK1 and ULK2 Kinases. Cells 2019, 8, 475. [Google Scholar] [CrossRef] [PubMed]
- Huang, T.; Xu, T.; Wang, Y.; Zhou, Y.; Yu, D.; Wang, Z.; He, L.; Chen, Z.; Zhang, Y.; Davidson, D.; et al. Cannabidiol inhibits human glioma by induction of lethal mitophagy through activating TRPV4. Autophagy 2021, 17, 3592–3606. [Google Scholar] [CrossRef]
- Mizushima, N.; Yoshimori, T. How to Interpret LC3 Immunoblotting. Autophagy 2007, 3, 542–545. [Google Scholar] [CrossRef]
- Rubinsztein, D.C.; Cuervo, A.M.; Ravikumar, B.; Sarkar, S.; Korolchuk, V.I.; Kaushik, S.; Klionsky, D.J. In search of an “autophagomometer”. Autophagy 2009, 5, 585–589. [Google Scholar] [CrossRef]
- Zhang, X.; Dai, M.; Li, S.; Li, M.; Cheng, B.; Ma, T.; Zhou, Z. The emerging potential role of p62 in cancer treatment by regulating metabolism. Trends Endocrinol. Metab. 2023, 34, 474–488. [Google Scholar] [CrossRef] [PubMed]
- Komatsu, M.; Waguri, S.; Koike, M.; Sou, Y.S.; Ueno, T.; Hara, T.; Mizushima, N.; Iwata, J.; Ezaki, J.; Murata, S.; et al. Homeostatic levels of p62 control cytoplasmic inclusion body formation in autophagy-deficient mice. Cell 2007, 131, 1149–1163. [Google Scholar] [CrossRef]
- Kang, T.C. Nuclear Factor-Erythroid 2-Related Factor 2 (Nrf2) and Mitochondrial Dynamics/Mitophagy in Neurological Diseases. Antioxidants 2020, 9, 617. [Google Scholar] [CrossRef]
Sequences (5′-3′) | Accession Number | |
---|---|---|
GAPDH | F: ATGGCCTTCCGTGTCCCCAC R: ACGCCTGCTTCACCACCTTC | NM_014364.5 |
NRF2 | F: GGAACAGCAGTGGCAAGATCTC R: GCAAGGCTGTAGTTGGTGCTCA | NM_003204 |
NQO1 | F: CCTGCCATTCTGAAAGGCTGGT R: GTGGTGATGGAAAGCACTGCCT | NM_000903 |
SOD1 | F: CTCACTCTCAGGAGACCATTGC R: CCACAAGCCAAACGACTTCCAG | NM_000454 |
CAT | F: GTGCGGAGATTCAACACTGCCA R: CGGCAATGTTCTCACACAGACG | NM_001752 |
PGC1-α | F: CCAAAGGATGCGCTCTCGTTCA R: CGGTGTCTGTAGTGGCTTGACT | NM_013261.5 |
TFAM | F: GTGGTTTTCATCTGTCTTGGCAAG R: TTCCCTCCAACGCTGGGCAATT | NM_003201.3 |
mtDNA | F: CACCCAAGAACAGGGTTTGT R: TGGGCCATGGGTATGTTGTTA | MG817368.1 |
18S | F: GTTGGTTTTCGGAACTGAGGC R: GTCGGCATCGTTTATGGTCG | 9C3H_S2 |
NCOA3 | F: CCTCTGGGCTTTTATTGCGAC R: CCCCTCAACACTGCTCTCCTTAC | NM_181659.3 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Giannotti, L.; Di Chiara Stanca, B.; Spedicato, F.; Vergara, D.; Stanca, E.; Damiano, F.; Siculella, L. Exploring the Therapeutic Potential of Cannabidiol in U87MG Cells: Effects on Autophagy and NRF2 Pathway. Antioxidants 2025, 14, 18. https://doi.org/10.3390/antiox14010018
Giannotti L, Di Chiara Stanca B, Spedicato F, Vergara D, Stanca E, Damiano F, Siculella L. Exploring the Therapeutic Potential of Cannabidiol in U87MG Cells: Effects on Autophagy and NRF2 Pathway. Antioxidants. 2025; 14(1):18. https://doi.org/10.3390/antiox14010018
Chicago/Turabian StyleGiannotti, Laura, Benedetta Di Chiara Stanca, Francesco Spedicato, Daniele Vergara, Eleonora Stanca, Fabrizio Damiano, and Luisa Siculella. 2025. "Exploring the Therapeutic Potential of Cannabidiol in U87MG Cells: Effects on Autophagy and NRF2 Pathway" Antioxidants 14, no. 1: 18. https://doi.org/10.3390/antiox14010018
APA StyleGiannotti, L., Di Chiara Stanca, B., Spedicato, F., Vergara, D., Stanca, E., Damiano, F., & Siculella, L. (2025). Exploring the Therapeutic Potential of Cannabidiol in U87MG Cells: Effects on Autophagy and NRF2 Pathway. Antioxidants, 14(1), 18. https://doi.org/10.3390/antiox14010018