Terminalia Chebula Extract Replacing Zinc Oxide Enhances Antioxidant and Anti-Inflammatory Capabilities, Improves Growth Performance, and Promotes Intestinal Health in Weaned Piglets
Abstract
:1. Introduction
2. Materials and Methods
2.1. Terminalia Chebula Extract
2.2. Experimental Animals, Design, and Diets
2.3. Sample Collection
2.4. Diarrhea Incidence
2.5. Serum and Jejunal Mucosal Antioxidant and Immune Indices
2.6. Intestinal Morphology
2.7. Cecal Microbiota Composition
2.8. RT-PCR
2.9. Statistical Analysis
3. Results
3.1. Effects of Replacing ZnO with TCE on Piglet Growth Performance, Diarrhea Rate, and Serum and Intestinal Mucosal Antioxidant Indices
3.2. Effects of Replacing ZnO with TCE on Piglet Immunity
3.3. Effects of Replacing ZnO with TCE on Piglet Intestinal Morphology
3.4. Effects of Replacing ZnO with TCE on Piglet Cecal Microbiota Composition
3.5. Effects of Different Doses of TCE on Piglet Growth Performance, Diarrhea Rate, and Serum and Intestinal Mucosal Antioxidant Indices
3.6. Effects of Different Doses of TCE on Piglet Immunity
3.7. Effects of Different Doses of TCE on Piglet Intestinal Morphology
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Hansen, L.H.B.; Nielsen, B.; Boll, E.; Skjøt-Rasmussen, L.; Wellejus, A.; Jørgensen, L.; Lauridsen, C.; Canibe, N.J. Functional in vitro screening of probiotic strains for inoculation of piglets as a prophylactic measure towards Enterotoxigenic Escherichia coli infection. J. Microbiol. Methods 2021, 180, 106126. [Google Scholar] [CrossRef] [PubMed]
- Yin, J.; Wu, M.M.; Xiao, H.; Ren, W.K.; Duan, J.L.; Yang, G.; Li, T.J.; Yin, Y.L. Development of an antioxidant system after early weaning in piglets. J. Anim. Sci. 2014, 92, 612. [Google Scholar] [CrossRef] [PubMed]
- Zhou, X.; Zhang, Y.; Wu, X.; Wan, D.; Yin, Y. Effects of Dietary Serine Supplementation on Intestinal Integrity, Inflammation and Oxidative Status in Early-Weaned Piglets. Cell. Physiol. Biochem. 2018, 48, 993–1002. [Google Scholar] [CrossRef] [PubMed]
- Hill, G.; Cromwell, G.; Crenshaw, T.; Dove, C.; Ewan, R.; Knabe, D.; Lewis, A.; Libal, G.; Mahan, D.; Shurson, G. Growth promotion effects and plasma changes from feeding high dietary concentrations of zinc and copper to weanling pigs (regional study). J. Anim. Sci. 2000, 78, 1010–1016. [Google Scholar] [CrossRef]
- Bednorz, C.; Oelgeschläger, K.; Kinnemann, B.; Hartmann, S.; Neumann, K.; Pieper, R.; Bethe, A.; Semmler, T.; Tedin, K.; Schierack, P. The broader context of antibiotic resistance: Zinc feed supplementation of piglets increases the proportion of multi-resistant Escherichia coli in vivo. Int. J. Med. Microbiol. 2013, 303, 396–403. [Google Scholar] [CrossRef]
- Li, Y.; Bao, X.; Yang, F.; Tian, J.; Su, W.; Yin, J.; Yao, K.; Li, T.; Yin, Y. Ornithine α-Ketoglutarate Alleviates Inflammation via Regulating Ileal Mucosa Microbiota and Metabolites in Enterotoxigenic Escherichia coli-Infected Pigs. Front. Nutr. 2022, 9, 862498. [Google Scholar] [CrossRef]
- Wang, J.; Xiao, Y.; Li, J.; Qi, M.; Tan, B. Serum biochemical parameters and amino acids metabolism are altered in piglets by early-weaning and proline and putrescine supplementations. Anim. Nutr. 2021, 7, 334–345. [Google Scholar] [CrossRef]
- Tian, J.; Jiang, Q.; Bao, X.; Yang, F.; Li, Y.; Sun, H.; Yao, K.; Yin, Y. Plant-derived squalene supplementation improves growth performance and alleviates acute oxidative stress-induced growth retardation and intestinal damage in piglets. Anim. Nutr. 2023, 15, 386–398. [Google Scholar] [CrossRef]
- Long, S.; Liu, S.; Wang, J.; Mahfuz, S.; Piao, X. Natural capsicum extract replacing chlortetracycline enhances performance via improving digestive enzyme activities, antioxidant capacity, anti-inflammatory function, and gut health in weaned pigs. Anim. Nutr. 2021, 7, 305–314. [Google Scholar] [CrossRef]
- Pingali, U.; Sukumaran, D.; Nutalapati, C. Effect of an aqueous extract of Terminalia chebula on endothelial dysfunction, systemic inflammation, and lipid profile in type 2 diabetes mellitus: A randomized double-blind, placebo-controlled clinical study. Phytother. Res. 2020, 34, 3226–3235. [Google Scholar] [CrossRef]
- Nigam, M.; Mishra, A.P.; Adhikari-Devkota, A.; Dirar, A.I.; Hassan, M.M.; Adhikari, A.; Belwal, T.; Devkota, H.P. Fruits of Terminalia chebula Retz.: A review on traditional uses, bioactive chemical constituents and pharmacological activities. Phytother. Res. 2020, 34, 2518–2533. [Google Scholar] [CrossRef] [PubMed]
- Jeong, H.K.; Lee, D.; Kim, H.P.; Baek, S.-H. Structure analysis and antioxidant activities of an amylopectin-type polysaccharide isolated from dried fruits of Terminalia chebula. Carbohydr. Polym. 2019, 211, 100–108. [Google Scholar] [CrossRef]
- Bostami, A.R.; Khan, M.R.I.; Rabbi, A.Z.; Siddiqui, M.N.; Islam, M.T. Boosting animal performance, immune index and antioxidant status in post-weaned bull calves through dietary augmentation of selective traditional medicinal plants. Vereinary Anim. Sci. 2021, 14, 100197. [Google Scholar] [CrossRef]
- Cheng, Y.; Liu, S.; Wang, F.; Wang, T.; Yin, L.; Chen, J.; Fu, C. Effects of Dietary Terminalia chebula Extract on Growth Performance, Immune Function, Antioxidant Capacity, and Intestinal Health of Broilers. Animals 2024, 14, 746. [Google Scholar] [CrossRef] [PubMed]
- Song, Y.; Luo, Y.; Yu, B.; He, J.; Zheng, P.; Mao, X.; Huang, Z.; Luo, J.; Luo, Y.; Yan, H.; et al. Tannic acid extracted from gallnut prevents post-weaning diarrhea and improves intestinal health of weaned piglets. Anim. Nutr. 2021, 7, 1078–1086. [Google Scholar] [CrossRef]
- Wang, F.; Yin, Y.; Yang, M.; Chen, J.; Fu, C.; Huang, K. Effects of Combined Supplementation of Macleaya cordata Extract and Benzoic Acid on the Growth Performance, Immune Responses, Antioxidant Capacity, Intestinal Morphology, and Microbial Composition in Weaned Piglets. Front. Vet. Sci. 2021, 8, 708597. [Google Scholar] [CrossRef] [PubMed]
- He, L.; Huang, N.; Li, H.; Tian, J.; Zhou, X.; Li, T.; Yao, K.; Wu, G.; Yin, Y. AMPK/α-ketoglutarate axis regulates intestinal water and ion homeostasis in young pigs. J. Agric. Food Chem. 2017, 65, 2287–2298. [Google Scholar] [CrossRef]
- Yu, J.; Song, Y.; Yu, B.; He, J.; Zheng, P.; Mao, X.; Huang, Z.; Luo, Y.; Luo, J.; Yan, H.; et al. Tannic acid prevents post-weaning diarrhea by improving intestinal barrier integrity and function in weaned piglets. J. Anim. Sci. Biotechnol. 2020, 11, 87. [Google Scholar] [CrossRef]
- Gao, Y.; Meng, Q.; Qin, J.; Zhao, Q.; Shi, B. Biotechnology. Resveratrol alleviates oxidative stress induced by oxidized soybean oil and improves gut function via changing gut microbiota in weaned piglets. J. Anim. Sci. Biotechnol. 2023, 14, 54. [Google Scholar] [CrossRef]
- Ma, J.; Duan, Y.; Li, R.; Liang, X.; Li, T.; Huang, X.; Yin, Y.; Yin, J. Gut microbial profiles and the role in lipid metabolism in Shaziling pigs. Anim. Nutr. 2022, 9, 345–356. [Google Scholar] [CrossRef]
- Mohammadi, T.; Soltani, L. Effects of hydroethanolic extracts of Terminalia chebula and Thymbra spicata on ram fresh semen under normal and oxidative stress conditions. Vet. Med. Sci. 2021, 7, 1778–1785. [Google Scholar] [CrossRef]
- Zhao, L.; Duan, Z.; Wang, Y.; Wang, M.; Liu, Y.; Wang, X.; Li, H. Protective effect of Terminalia chebula Retz. extract against Aβ aggregation and Aβ-induced toxicity in Caenorhabditis elegans. J. Ethnopharmacol. 2021, 268, 113640. [Google Scholar] [CrossRef] [PubMed]
- Rustia, H.M.A.; Decena, K.S.; Iranzo, M.F.M.; Sulabo, R.C. Effect of a plant extract mixture as an alternative to ractopamine hydrochloride on growth performance and carcass characteristics of finishing pigs. Philipp. J. Vet. Anim. Sci. 2020, 46, 31–39. [Google Scholar]
- Nam, Y.J.; Hwang, Y.S. Antibacterial and antioxidant effect of ethanol extracts of Terminalia chebula on Streptococcus mutans. Clin. Exp. Dent. Res. 2021, 7, 987–994. [Google Scholar] [CrossRef] [PubMed]
- Khan, I.; Ullah, Z.; Shad, A.A.; Fahim, M.; Öztürk, M. In vitro antioxidant, anticholinesterase inhibitory, and antimicrobial activity studies of Terminalia chebula (Retz) and Terminalia arjuna (Roxb). S. Afr. J. Bot. 2022, 146, 395–400. [Google Scholar] [CrossRef]
- Dong, W.-R.; Li, Y.-Y.; Liu, T.-T.; Zhou, G.; Chen, Y.-X. Ethyl acetate extract of Terminalia chebula alleviates DSS-induced ulcerative colitis in C57BL/6 mice. Front. Pharmacol. 2023, 14, 1229772. [Google Scholar] [CrossRef]
- Xu, T.; Ma, X.; Zhou, X.; Qian, M.; Yang, Z.; Cao, P.; Han, X. Coated tannin supplementation improves growth performance, nutrients digestibility, and intestinal function in weaned piglets. J. Anim. Sci. 2022, 100, skac088. [Google Scholar] [CrossRef]
- Srivastava, P.; Raut, H.N.; Wagh, R.S.; Puntambekar, H.M.; Kulkarni, M.J. Purification and characterization of an antioxidant protein (∼16 kDa) from Terminalia chebula fruit. Food Chem. 2012, 131, 141–148. [Google Scholar] [CrossRef]
- Liang, X.; Fei, W.; He, M.; Li, X. Enhanced antioxidant capacities in vivo caused by the change in key constituent of Terminalia chebula Retz. treated with Tibet traditional process. Wuhan Univ. J. Nat. Sci. 2016, 21, 544–548. [Google Scholar] [CrossRef]
- Lee, H.S.; Won, N.H.; Kim, K.H.; Lee, H.; Jun, W.; Lee, K.W. Antioxidant effects of aqueous extract of Terminalia chebula in vivo and in vitro. Biol. Pharm. Bull. 2005, 28, 1639–1644. [Google Scholar] [CrossRef]
- Kim, M.-S.; Lee, D.Y.; Lee, J.; Kim, H.W.; Sung, S.H.; Han, J.-S.; Jeon, W.K. Terminalia chebula extract prevents scopolamine-induced amnesia via cholinergic modulation and anti-oxidative effects in mice. BMC Complement. Altern. Med. 2018, 18, 136. [Google Scholar] [CrossRef] [PubMed]
- Feng, X.-H.; Xu, H.-Y.; Wang, J.-Y.; Duan, S.; Wang, Y.-C.; Ma, C.-M. In vivo hepatoprotective activity and the underlying mechanism of chebulinic acid from Terminalia chebula fruit. Phytomedicine 2021, 83, 153479. [Google Scholar] [CrossRef]
- Zhong, X.; Shi, Y.; Chen, J.; Xu, J.; Wang, L.; Beier, R.C.; Hou, X.; Liu, F. Polyphenol extracts from Punica granatum and Terminalia chebula are anti-inflammatory and increase the survival rate of chickens challenged with Escherichia coli. Biol. Pharm. Bull. 2014, 37, 1575–1582. [Google Scholar] [CrossRef]
- Kong, Q.; Shang, Z.; Liu, Y.; Fakhar-e-Alam Kulyar, M.; Suo-lang, S.; Xu, Y.; Tan, Z.; Li, J.; Liu, S. Preventive effect of Terminalia bellirica (Gaertn.) Roxb. extract on mice infected with Salmonella Typhimurium. Front. Cell. Infect. Microbiol. 2023, 12, 1054205. [Google Scholar] [CrossRef]
- BenSaad, L.A.; Kim, K.H.; Quah, C.C.; Kim, W.R.; Shahimi, M. Anti-inflammatory potential of ellagic acid, gallic acid and punicalagin A&B isolated from Punica granatum. BMC Complement. Altern. Med. 2017, 17, 47. [Google Scholar] [CrossRef]
- Ekambaram, S.P.; Perumal, S.S.; Erusappan, T.; Srinivasan, A. Hydrolysable tannin-rich fraction from Terminalia chebula Retz. fruits ameliorates collagen-induced arthritis in BALB/c mice. Inflammopharmacology 2020, 28, 275–287. [Google Scholar] [CrossRef] [PubMed]
- Patel, N.C.; Hertel, P.M.; Estes, M.K.; De La Morena, M.; Petru, A.M.; Noroski, L.M.; Revell, P.A.; Hanson, I.C.; Paul, M.E.; Rosenblatt, H.M. Vaccine-acquired rotavirus in infants with severe combined immunodeficiency. N. Engl. J. Med. 2010, 362, 314–319. [Google Scholar] [CrossRef] [PubMed]
- Sabat, R. IL-10 family of cytokines. Cytokine Growth Factor Rev. 2010, 21, 315–324. [Google Scholar] [CrossRef]
- Zhang, S.Y.; Boisson-Dupuis, S.; Chapgier, A.; Yang, K.; Bustamante, J.; Puel, A.; Picard, C.; Abel, L.; Jouanguy, E.; Casanova, J.L. Inborn errors of interferon (IFN)-mediated immunity in humans: Insights into the respective roles of IFN-α/β, IFN-γ, and IFN-λ in host defense. Immunol. Rev. 2008, 226, 29–40. [Google Scholar] [CrossRef]
- Ma, L.; Ni, Y.; Wang, Z.; Tu, W.; Ni, L.; Zhuge, F.; Zheng, A.; Hu, L.; Zhao, Y.; Zheng, L. Spermidine improves gut barrier integrity and gut microbiota function in diet-induced obese mice. Gut Microbes 2020, 12, 1832857. [Google Scholar] [CrossRef]
- Yin, J.; Li, Y.; Han, H.; Liu, Z.; Zeng, X.; Li, T.; Yin, Y. Long-term effects of lysine concentration on growth performance, intestinal microbiome, and metabolic profiles in a pig model. Food Funct. 2018, 9, 4153–4163. [Google Scholar] [CrossRef] [PubMed]
- Yin, J.; Li, Y.; Han, H.; Chen, S.; Gao, J.; Liu, G.; Wu, X.; Deng, J.; Yu, Q.; Huang, X.; et al. Melatonin reprogramming of gut microbiota improves lipid dysmetabolism in high-fat diet-fed mice. J. Pineal Res. 2018, 65, e12524. [Google Scholar] [CrossRef] [PubMed]
- Pinto, S.; Benincà, E.; Galazzo, G.; Jonkers, D.; Penders, J.; Bogaards, J.A. Heterogeneous associations of gut microbiota with Crohn’s disease activity. Gut Microbes 2024, 16, 2292239. [Google Scholar] [CrossRef]
- Jennings, A.; Kühn, T.; Bondonno, N.P.; Waniek, S.; Bang, C.; Franke, A.; Kassubek, J.; Müller, H.-P.; Both, M.; Weber, K.S. The gut microbiome modulates associations between adherence to a Mediterranean-style diet, abdominal adiposity, and C-reactive protein in population-level analysis. Am. J. Clin. Nutr. 2024, 119, 136–144. [Google Scholar] [CrossRef]
- Wang, J.; Tang, L.; Zhou, H.; Zhou, J.; Glenn, T.C.; Shen, C.-L.; Wang, J.-S. Long-term treatment with green tea polyphenols modifies the gut microbiome of female sprague-dawley rats. J. Nutr. Biochem. 2018, 56, 55–64. [Google Scholar] [CrossRef] [PubMed]
- Teng, Y.; Ren, Y.; Sayed, M.; Hu, X.; Lei, C.; Kumar, A.; Hutchins, E.; Mu, J.; Deng, Z.; Luo, C.; et al. Plant-derived exosomal microRNAs shape the gut microbiota. Cell Host Microbe 2018, 24, 637–652. e638. [Google Scholar] [CrossRef]
- Shukla, V.; Bhathena, Z. Sustained release of a purified tannin component of Terminalia chebula from a titanium implant surface prevents biofilm formation by Staphylococcus aureus. Appl. Biochem. Biotechnol. 2015, 175, 3542–3556. [Google Scholar] [CrossRef]
Ingredients | CON | ZnO | LTCE | MTCE | HTCE |
---|---|---|---|---|---|
Corn (crude protein, 7.8%) | 55.00 | 54.60 | 54.75 | 54.60 | 54.20 |
Full-fat soybean powder (crude protein, 35%) | 10.00 | 10.00 | 10.00 | 10.00 | 10.00 |
Soybean meal (crude protein, 43%) | 19.00 | 19.10 | 19.10 | 19.10 | 19.20 |
Whey powder | 6.15 | 6.15 | 6.15 | 6.15 | 6.15 |
Fish meal (crude protein, 65%) | 5.00 | 5.00 | 5.00 | 5.00 | 5.00 |
Soybean oil | 1.50 | 1.60 | 1.55 | 1.60 | 1.70 |
L-Lysine·HCl (lysine, 78%) | 0.48 | 0.48 | 0.48 | 0.48 | 0.48 |
DL-Methionine (methionine, 98%) | 0.10 | 0.10 | 0.10 | 0.10 | 0.10 |
L-Threonine (threonine, 98%) | 0.05 | 0.05 | 0.05 | 0.05 | 0.05 |
L-Tryptophan (tryptophan, 98%) | 0.02 | 0.02 | 0.02 | 0.02 | 0.02 |
Dicalcium phosphate | 0.90 | 0.90 | 0.90 | 0.90 | 0.90 |
Limestone | 0.50 | 0.50 | 0.50 | 0.50 | 0.50 |
Sodium chloride | 0.30 | 0.30 | 0.30 | 0.30 | 0.30 |
Compound vitamin and mineral Premix 1 | 1.00 | 1.00 | 1.00 | 1.00 | 1.00 |
Zinc oxide | 0.2 | ||||
TCE | 0.1 | 0.2 | 0.4 | ||
Total | 100 | 100 | 100 | 100 | 100 |
Nutrient level 2 | |||||
Dry matter | 86.78 | 86.82 | 86.80 | 86.82 | 86.86 |
Digestible energy (MJ/kg) | 14.29 | 14.29 | 14.29 | 14.29 | 14.28 |
Crude protein | 20.09 | 20.10 | 20.11 | 20.10 | 20.11 |
Lysine | 1.49 | 1.49 | 1.49 | 1.49 | 1.49 |
Methionine | 0.45 | 0.45 | 0.45 | 0.45 | 0.45 |
Methionine + cysteine | 0.78 | 0.78 | 0.78 | 0.78 | 0.78 |
Threonine | 0.82 | 0.82 | 0.82 | 0.82 | 0.82 |
Tryptophan | 0.25 | 0.25 | 0.25 | 0.25 | 0.25 |
Calcium | 0.74 | 0.74 | 0.74 | 0.74 | 0.74 |
Total phosphorus | 0.64 | 0.64 | 0.64 | 0.64 | 0.64 |
Gene | Primers Sequences | Size (bp) | Accession No. |
---|---|---|---|
TNF-α | F: CCACGCTCTTCTGCCTACTGC | 132 | NM_214022.1 |
R: CGACGGGCTTATCTGAGGTTTG | |||
IFN-γ | F: CCATTCAAAGGAGCATGGAT | 146 | NM_213948.1 |
R: GAGTTCACTGATGGCTTTGC | |||
IFN-α1 | F: GACTCCATCCTGGCTGTG | 103 | M28623 |
R: TGACTTCTGCCCTGACGA | |||
IFN-β1 | F: CAACAAAGGAGCAGCAAT | 111 | S41178 |
R: CCTCAGGGACCTCAAAGT | |||
IL-1β | F: ATGCTGAAGGCTCTCCACCTC | 89 | NM_214055.1 |
R: TTGTTGCTATCATCTCCTTGCAC | |||
IL-4 | F: CAACCCTGGTCTGCTTACTG | 173 | NM_214123.1 |
R: CTTCTCCGTCGTGTTCTCTG | |||
IL-6 | F: CTTCAGTCCAGTCGCCTTCTCC | 96 | NM_001252429.1 |
R: GCATCACCTTTGGCATCTTCTT | |||
IL-10 | F: GGGCTATTTGTCCTGACTGC | 105 | NM_214041.1 |
R: GGATTCTTCATCGGCTTCT |
Items | CON | ZnO | TCE | p-Value |
---|---|---|---|---|
Initial weight, kg | 7.49 ± 0.34 | 7.39 ± 0.20 | 7.42 ± 0.22 | 0.962 |
Final weight, kg | 18.60 ± 0.52 | 19.67 ± 0.57 | 19.81 ± 0.42 | 0.213 |
ADG, g/day | 395.24 ± 9.29 b | 438.69 ± 12.22 a | 442.41 ± 10.96 a | 0.014 |
ADFI, g/day | 747.03 ± 5.06 | 772.05 ± 4.42 | 769.71 ± 15.17 | 0.159 |
F:G (feed/gain, g/g) | 1.85 ± 0.03 | 1.77 ± 0.04 | 1.74 ± 0.03 | 0.097 |
Diarrhea rate, % | 5.50 ± 0.42 a | 2.08 ± 0.75 b | 3.32 ± 0.42 b | 0.002 |
Items | CON | LTCE | MTCE | HTCE | p-Value |
---|---|---|---|---|---|
Initial weight, kg | 7.49 ± 0.34 | 7.38 ± 0.6 | 7.42 ± 0.22 | 7.39 ± 0.20 | 0.991 |
Final weight, kg | 18.60 ± 0.52 | 20.03 ± 0.60 | 19.81 ± 0.42 | 19.96 ± 0.49 | 0.192 |
ADG, g/day | 395.24 ± 9.29 b | 448.84 ± 10.31 a | 442.41 ± 10.96 a | 451.79 ± 11.69 a | 0.004 |
ADFI, g/day | 747.03 ± 5.06 | 769.71 ± 15.17 | 769.71 ± 15.17 | 763.57 ± 11.67 | 0.497 |
F:G (feed/gain, g/g) | 1.85 ± 0.03 a | 1.68 ± 0.02 b | 1.74 ± 0.03 ab | 1.70 ± 0.04 b | 0.005 |
Diarrhea rate, % | 5.50 ± 0.42 a | 3.42 ± 0.58 ab | 3.32 ± 0.42 b | 2.99 ± 0.69 b | 0.014 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, T.; Li, Y.; Yin, L.; Chen, J.; Shi, P.; Wang, F.; Wu, K.; Yao, K.; Yin, Y. Terminalia Chebula Extract Replacing Zinc Oxide Enhances Antioxidant and Anti-Inflammatory Capabilities, Improves Growth Performance, and Promotes Intestinal Health in Weaned Piglets. Antioxidants 2024, 13, 1087. https://doi.org/10.3390/antiox13091087
Wang T, Li Y, Yin L, Chen J, Shi P, Wang F, Wu K, Yao K, Yin Y. Terminalia Chebula Extract Replacing Zinc Oxide Enhances Antioxidant and Anti-Inflammatory Capabilities, Improves Growth Performance, and Promotes Intestinal Health in Weaned Piglets. Antioxidants. 2024; 13(9):1087. https://doi.org/10.3390/antiox13091087
Chicago/Turabian StyleWang, Tao, Yuying Li, Lichen Yin, Jiashun Chen, Pengjun Shi, Fang Wang, Kangle Wu, Kang Yao, and Yulong Yin. 2024. "Terminalia Chebula Extract Replacing Zinc Oxide Enhances Antioxidant and Anti-Inflammatory Capabilities, Improves Growth Performance, and Promotes Intestinal Health in Weaned Piglets" Antioxidants 13, no. 9: 1087. https://doi.org/10.3390/antiox13091087
APA StyleWang, T., Li, Y., Yin, L., Chen, J., Shi, P., Wang, F., Wu, K., Yao, K., & Yin, Y. (2024). Terminalia Chebula Extract Replacing Zinc Oxide Enhances Antioxidant and Anti-Inflammatory Capabilities, Improves Growth Performance, and Promotes Intestinal Health in Weaned Piglets. Antioxidants, 13(9), 1087. https://doi.org/10.3390/antiox13091087