Poplar Bud (Populus) Extraction and Chinese Propolis Counteract Oxidative Stress in Caenorhabditis elegans via Insulin/IGF-1 Signaling Pathway
Abstract
1. Introduction
2. Materials and Methods
2.1. Materials and Chemicals
2.2. Sample Preparation and Phytochemical Profile Analysis by HPLC
2.3. Determination of Total Phenolic Acid and Flavonoid Contents
2.4. In Vitro Antioxidant Test
- (1)
- DPPH scavenging activity
- (2)
- ABTS scavenging activity
- (3)
- FRAP assay
2.5. C. elegans Strains and Culture Conditions
2.6. Toxicity Test
2.7. Body Length and Body Width Assay
2.8. Progeny Assay
2.9. Oxidative Stress Assay
2.10. Fluorescence Imaging
2.11. ROS Accumulation Assay
2.12. Determination of SOD, CAT, and MDA
2.13. Quantitative RT-PCR
2.14. Statistical Analysis
3. Results
3.1. Detection of Phytochemicals in PBE and CP
3.2. In Vitro Antioxidant Activity
3.3. Acute Toxicity in C. elegans
3.4. Effect of PBE and CP on Growth of C. elegans
3.5. Effect of PBE or CP on C. elegans Reproduction
3.6. PBE and CP Attenuates the Oxidative Stress Toxicity Induced by Juglone
3.7. PBE and CP Reduced ROS Levels
3.8. PBE and CP Enhanced Antioxidant Enzyme Activity
3.9. PBE and CP Extended the Stress Resistance Thought daf-16
3.10. Skn-1 Was Required for PBE and CP Mediated Oxidative Stress Resistance
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
References
- Bankova, V.; Bertelli, D.; Borba, R.; Conti, B.J.; da Silva Cunha, I.B.; Danert, C.; Eberlin, M.N.; I Falcão, S.; Isla, M.I.; Moreno, M.I.N. Standard methods for Apis mellifera propolis research. J. Apic. Res. 2019, 58, 1–49. [Google Scholar] [CrossRef]
- Bankova, V.; Popova, M.; Trusheva, B. The phytochemistry of the honeybee. Phytochemistry 2018, 155, 1–11. [Google Scholar] [CrossRef] [PubMed]
- Vieira, A.L.S.; Correia, V.T.D.V.; Ramos, A.L.C.C.; da Silva, N.H.A.; Jaymes, L.A.C.; Melo, J.O.F.; de Paula, A.C.C.F.F.; Garcia, M.A.V.T.; de Araújo, R.L.B. Evaluation of the Chemical Profile and Antioxidant Capacity of Green, Brown, and Dark Propolis. Plants 2023, 12, 3204. [Google Scholar] [CrossRef] [PubMed]
- Wang, K.; Zhang, J.; Ping, S.; Ma, Q.; Chen, X.; Xuan, H.; Shi, J.; Zhang, C.; Hu, F. Anti-inflammatory effects of ethanol extracts of Chinese propolis and buds from poplar (Populus × canadensis). J. Ethnopharmacol. 2014, 155, 300–311. [Google Scholar] [CrossRef] [PubMed]
- Campos, J.F.; Dos Santos, H.F.; Bonamigo, T.; de Campos Domingues, N.L.; de Picoli Souza, K.; Dos Santos, E.L. Stingless bee propolis: New insights for anticancer drugs. Oxidative Med. Cell. Longev. 2021, 2021, 2169017. [Google Scholar] [CrossRef] [PubMed]
- Dezmirean, D.S.; Paşca, C.; Moise, A.R.; Bobiş, O. Plant Sources Responsible for the Chemical Composition and Main Bioactive Properties of Poplar-Type Propolis. Plants 2021, 10, 22. [Google Scholar] [CrossRef] [PubMed]
- Kis, B.; Avram, S.; Pavel, I.Z.; Lombrea, A.; Buda, V.; Dehelean, C.A.; Soica, C.; Yerer, M.B.; Bojin, F.; Folescu, R. Recent advances regarding the phytochemical and therapeutic uses of Populus nigra L. buds. Plants 2020, 9, 1464. [Google Scholar] [CrossRef] [PubMed]
- Bobiş, O. Plants: Sources of Diversity in Propolis Properties. Plants 2022, 11, 2298. [Google Scholar] [CrossRef]
- Erickson, E.; Junker, R.; Ali, J.G.; McCartney, N.; Patch, H.; Grozinger, C. Complex floral traits shape pollinator attraction to ornamental plants. Ann. Bot. 2022, 130, 561–577. [Google Scholar] [CrossRef]
- Vardar-Ünlü, G.; Silici, S.; Ünlü, M. Composition and in vitro antimicrobial activity of Populus buds and poplar-type propolis. World J. Microbiol. Biotechnol. 2008, 24, 1011–1017. [Google Scholar] [CrossRef]
- Stanciauskaite, M.; Marksa, M.; Liaudanskas, M.; Ivanauskas, L.; Ivaskiene, M.; Ramanauskiene, K. Extracts of poplar buds (Populus balsamifera L., Populus nigra L.) and Lithuanian Propolis: Comparison of their composition and biological activities. Plants 2021, 10, 828. [Google Scholar] [CrossRef] [PubMed]
- Zhang, C.P.; Zheng, H.Q.; Liu, G.; Hu, F.L. Development and validation of HPLC method for determination of salicin in poplar buds: Application for screening of counterfeit propolis. Food Chem. 2011, 127, 345–350. [Google Scholar] [CrossRef]
- Huang, S.; Zhang, C.P.; Li, G.Q.; Sun, Y.Y.; Wang, K.; Hu, F.L. Identification of catechol as a new marker for detecting propolis adulteration. Molecules 2014, 19, 10208–10217. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Cao, X.; Ping, S.; Wang, K.; Shi, J.; Zhang, C.; Zheng, H.; Hu, F. Comparisons of ethanol extracts of Chinese propolis (poplar type) and poplar gums based on the antioxidant activities and molecular mechanism. Evid.-Based Complement. Altern. Med. 2015, 2015, 307594. [Google Scholar] [CrossRef] [PubMed]
- Hu, H.; Wang, Y.; Zhu, H.; Dong, J.; Qiao, J.; Kong, L.; Zhang, H. Two novel markers to discriminate poplar-type propolis from poplar bud extracts: 9-oxo-ODE and 9-oxo-ODA. J. Food Compos. Anal. 2022, 105, 104196. [Google Scholar] [CrossRef]
- Jiang, X.; Tian, J.; Zheng, Y.; Zhang, Y.; Wu, Y.; Zhang, C.; Zheng, H.; Hu, F. A New Propolis Type from Changbai Mountains in North-east China: Chemical Composition, Botanical Origin and Biological Activity. Molecules 2019, 24, 1369. [Google Scholar] [CrossRef]
- Zhou, L.; Luo, S.; Li, J.; Zhou, Y.; Wang, X.; Kong, Q.; Chen, T.; Feng, S.; Yuan, M.; Ding, C. Optimization of the extraction of polysaccharides from the shells of Camellia oleifera and evaluation on the antioxidant potential in vitro and in vivo. J. Funct. Foods 2021, 86, 104678. [Google Scholar] [CrossRef]
- Duangjan, C.; Rangsinth, P.; Gu, X.; Wink, M.; Tencomnao, T. Lifespan extending and oxidative stress resistance properties of a leaf extracts from Anacardium occidentale L. in Caenorhabditis elegans. Oxidative Med. Cell. Longev. 2019, 2019, 9012396. [Google Scholar] [CrossRef]
- Qin, Y.; Chen, F.; Tang, Z.; Ren, H.; Wang, Q.; Shen, N.; Lin, W.; Xiao, Y.; Yuan, M.; Chen, H. Ligusticum chuanxiong Hort as a medicinal and edible plant foods: Antioxidant, anti-aging and neuroprotective properties in Caenorhabditis elegans. Front. Pharmacol. 2022, 13, 1049890. [Google Scholar] [CrossRef]
- Li, H.; Yu, X.; Meng, F.; Zhao, Z.; Guan, S.; Wang, L. Ferulic Acid Supplementation Increases Lifespan and Stress Resistance via Insulin/IGF-1 Signaling Pathway in C. elegans. Int. J. Mol. Sci. 2021, 22, 4279. [Google Scholar] [CrossRef]
- Calabrese, E.J.; Nascarella, M.; Pressman, P.; Hayes, A.W.; Dhawan, G.; Kapoor, R.; Calabrese, V.; Agathokleous, E. Hormesis determines lifespan. Ageing Res. Rev. 2024, 94, 102181. [Google Scholar] [CrossRef] [PubMed]
- Govindan, S.; Amirthalingam, M.; Duraisamy, K.; Govindhan, T.; Sundararaj, N.; Palanisamy, S. Phytochemicals-induced hormesis protects Caenorhabditis elegans against α-synuclein protein aggregation and stress through modulating HSF-1 and SKN-1/Nrf2 signaling pathways. Biomed. Pharmacother. 2018, 102, 812–822. [Google Scholar] [CrossRef] [PubMed]
- Lin, C.; Lin, Y.; Meng, T.; Lian, J.; Liang, Y.; Kuang, Y.; Cao, Y.; Chen, Y. Anti-fat effect and mechanism of polysaccharide-enriched extract from Cyclocarya paliurus (Batal.) Iljinskaja in Caenorhabditis elegans. Food Funct. 2020, 11, 5320–5332. [Google Scholar] [CrossRef] [PubMed]
- Tao, M.; Li, R.; Xu, T.; Zhang, Z.; Wu, T.; Pan, S.; Xu, X. Flavonoids from the mung bean coat promote longevity and fitness in Caenorhabditis elegans. Food Funct. 2021, 12, 8196–8207. [Google Scholar] [CrossRef]
- Navarro-Hortal, M.D.; Romero-Márquez, J.M.; Esteban-Muñoz, A.; Sánchez-González, C.; Rivas-García, L.; Llopis, J.; Cianciosi, D.; Giampieri, F.; Sumalla-Cano, S.; Battino, M. Strawberry (Fragaria × ananassa cv. Romina) methanolic extract attenuates Alzheimer’s beta amyloid production and oxidative stress by SKN-1/NRF and DAF-16/FOXO mediated mechanisms in C. elegans. Food Chem. 2022, 372, 131272. [Google Scholar] [CrossRef]
- Moliner, C.; Núñez, S.; Cásedas, G.; Valero, M.S.; Dias, M.I.; Barros, L.; López, V.; Gómez-Rincón, C. Flowers of Allium cepa L. as Nutraceuticals: Phenolic Composition and Anti-Obesity and Antioxidant Effects in Caenorhabditis elegans. Antioxidants 2023, 12, 720. [Google Scholar] [CrossRef]
- Wang, J.; Deng, N.; Wang, H.; Li, T.; Chen, L.; Zheng, B.; Liu, R.H. Effects of orange extracts on longevity, healthspan, and stress resistance in Caenorhabditis elegans. Molecules 2020, 25, 351. [Google Scholar] [CrossRef]
- Lin, Y.; Lin, C.; Cao, Y.; Chen, Y. Caenorhabditis elegans as an in vivo model for the identification of natural antioxidants with anti-aging actions. Biomed. Pharmacother. 2023, 167, 115594. [Google Scholar] [CrossRef] [PubMed]
- Wu, J.Q.; Kosten, T.R.; Zhang, X.Y. Free radicals, antioxidant defense systems, and schizophrenia. Prog. Neuro-Psychopharmacol. Biol. Psychiatry 2013, 46, 200–206. [Google Scholar] [CrossRef]
- Sun, M.L.; Chen, X.Y.; Cao, J.J.; Cui, X.H.; Wang, H.B. Polygonum multiflorum Thunb extract extended the lifespan and healthspan of Caenorhabditis elegans via DAF-16/SIR-2.1/SKN-1. Food Funct. 2021, 12, 8774–8786. [Google Scholar] [CrossRef]
- Davalli, P.; Mitic, T.; Caporali, A.; Lauriola, A.; D’Arca, D. ROS, cell senescence, and novel molecular mechanisms in aging and age-related diseases. Oxidative Med. Cell. Longev. 2016, 2016, 3565127. [Google Scholar] [CrossRef] [PubMed]
- Wood, Z.A.; Schröder, E.; Harris, J.R.; Poole, L.B. Structure, mechanism and regulation of peroxiredoxins. Trends Biochem. Sci. 2003, 28, 32–40. [Google Scholar] [CrossRef]
- Ogg, S.; Paradis, S.; Gottlieb, S.; Patterson, G.I.; Lee, L.; Tissenbaum, H.A.; Ruvkun, G. The Fork head transcription factor DAF-16 transduces insulin-like metabolic and longevity signals in C. elegans. Nature 1997, 389, 994–999. [Google Scholar] [CrossRef]
- Zečić, A.; Braeckman, B.P. DAF-16/FoxO in Caenorhabditis elegans and its role in metabolic remodeling. Cells 2020, 9, 109. [Google Scholar] [CrossRef]
- Xiong, L.; Deng, N.; Zheng, B.; Li, T.; Liu, R.H. HSF-1 and SIR-2.1 linked insulin-like signaling is involved in goji berry (Lycium spp.) extracts promoting lifespan extension of Caenorhabditis elegans. Food Funct. 2021, 12, 7851–7866. [Google Scholar] [CrossRef] [PubMed]
- Park, S.; Kim, B.-K.; Park, S.-K. Supplementation with phosphatidylethanolamine confers anti-oxidant and anti-aging effects via hormesis and reduced insulin/IGF-1-like signaling in C. elegans. Mech. Ageing Dev. 2021, 197, 111498. [Google Scholar] [CrossRef] [PubMed]
- Touzani, S.; Imtara, H.; Katekhaye, S.; Mechchate, H.; Ouassou, H.; Alqahtani, A.S.; Noman, O.M.; Nasr, F.A.; Fearnley, H.; Fearnley, J. Determination of phenolic compounds in various propolis samples collected from an African and an Asian region and their impact on antioxidant and antibacterial activities. Molecules 2021, 26, 4589. [Google Scholar] [CrossRef]
- Osés, S.M.; Marcos, P.; Azofra, P.; de Pablo, A.; Fernández-Muíño, M.Á.; Sancho, M.T. Phenolic profile, antioxidant capacities and enzymatic inhibitory activities of propolis from different geographical areas: Needs for analytical harmonization. Antioxidants 2020, 9, 75. [Google Scholar] [CrossRef] [PubMed]
- Ayuda-Durán, B.; González-Manzano, S.; Miranda-Vizuete, A.; Sánchez-Hernández, E.; Romero, M.R.; Dueñas, M.; Santos-Buelga, C.; González-Paramás, A.M. Exploring Target Genes Involved in the Effect of Quercetin on the Response to Oxidative Stress in Caenorhabditis elegans. Antioxidants 2019, 8, 585. [Google Scholar] [CrossRef]
- Andrade, J.K.S.; Denadai, M.; de Oliveira, C.S.; Nunes, M.L.; Narain, N. Evaluation of bioactive compounds potential and antioxidant activity of brown, green and red propolis from Brazilian northeast region. Food Res. Int. 2017, 101, 129–138. [Google Scholar] [CrossRef]
- Anaissi-Afonso, L.; Oramas-Royo, S.; Ayra-Plasencia, J.; Martín-Rodríguez, P.; García-Luis, J.; Lorenzo-Castrillejo, I.; Fernández-Pérez, L.; Estévez-Braun, A.; Machín, F. Lawsone, juglone, and β-lapachone derivatives with enhanced mitochondrial-based toxicity. ACS Chem. Biol. 2018, 13, 1950–1957. [Google Scholar] [CrossRef] [PubMed]
- Qin, X.; Wang, W.; Chu, W. Antioxidant and reducing lipid accumulation effects of rutin in Caenorhabditis elegans. BioFactors 2021, 47, 686–693. [Google Scholar] [CrossRef] [PubMed]
- Navarro-Hortal, M.D.; Romero-Márquez, J.M.; Muñoz-Ollero, P.; Jiménez-Trigo, V.; Esteban-Muñoz, A.; Tutusaus, K.; Giampieri, F.; Battino, M.; Sánchez-González, C.; Rivas-García, L. Amyloid β-but not Tau-induced neurotoxicity is suppressed by Manuka honey via skn-1 and SKN-1/Nrf2 pathways in an in vivo model of Alzheimer’s disease. Food Funct. 2022, 13, 11185–11199. [Google Scholar] [CrossRef] [PubMed]
- Feng, S.; Zhang, C.; Chen, T.; Zhou, L.; Huang, Y.; Yuan, M.; Li, T.; Ding, C. Oleuropein Enhances Stress Resistance and Extends Lifespan via Insulin/IGF-1 and SKN-1/Nrf2 Signaling Pathway in Caenorhabditis elegans. Antioxidants 2021, 10, 1697. [Google Scholar] [CrossRef] [PubMed]
- Blackwell, T.K.; Steinbaugh, M.J.; Hourihan, J.M.; Ewald, C.Y.; Isik, M. SKN-1/Nrf, stress responses, and aging in Caenorhabditis elegans. Free Radic. Biol. Med. 2015, 88, 290–301. [Google Scholar] [CrossRef]
Gene | Primer (5′-3′) |
---|---|
act-1 | F: CTGTCCTCTCCCTCTACGCTTCC R: CAGTAAGATCACGTCCAGCCAAGTC |
daf-16 | F: CCACCACCATCATACCACGAGTTG R: CATTGGCTTGAAGTTAGTGCTTGGC |
sod-3 | F: ATCACTATTGCGGTTCAAGGCTCTG R: TTGCACAGGTGGCGATCTTCAAG |
skn-1 | F: GGTCTCCGTTGGCGTGATGATC R: CTGGTGGATGCTCGGTGAGTATTG |
gst-4 | F: ATGCTCGTGCTCTTGCTGAG R: GACTGACCGAATTGTTCTCCAT |
hsp-16.2 | F: AAGCGCCAAAGAAAGAAGCG R: TTCAAGTTTATTGCAGCGAACA |
Sample | Total Flavonoid (mg rutin/g) | Total Phenolic (mg gallic acid/g) | DPPH IC50 (µg/mL) | ABTS IC50 (µg/mL) | FRAP OD 700 nm |
---|---|---|---|---|---|
VC | / | / | 23.29 ± 0.09 b | 17.61 ± 0.66 c | 0.38 ± 0.005 |
PBE | 143.14 ± 0.23 b | 234.18 ± 0.95 b | 93.04 ± 0.77 a | 41.75 ± 1.13 a | 0.40 ± 0.002 |
CP | 225.18 ± 0.65 a | 265.77 ± 2.16 a | 93.10 ± 0.35 a | 38.49 ± 0.58 b | 0.39 ± 0.003 |
Compounds | Contents (mg/g of Extract) | |
---|---|---|
PBE | CP | |
Caffeic acid | 0.56 ± 0.20 | 0.62 ± 0.15 |
p-Coumaric acid | 1.27 ± 0.45 | 1.25 ± 0.29 |
Ferulic acid | 0.62 ± 0.22 | 0.49 ± 0.14 |
Isoferulic acid | 0.51 ± 0.18 b | 1.26 ± 0.29 a |
3,4-Dimethoxycinnamate | 1.34 ± 0.46 | 2.27 ± 0.57 |
Pinobanksin | 3.08 ± 1.07 b | 5.97 ± 1.38 a |
Naringenin | 3.79 ± 1.32 | 7.48 ± 1.72 |
Quercetin | 0.10 ± 0.04 | 0.06 ± 0.04 |
Kaempferol | 1.11 ± 0.44 b | 2.56 ± 0.57 a |
Apigenin | 0.90 ± 0.33 b | 1.63 ± 0.27 a |
Pinocembrin | 7.27 ± 2.66 | 13.27 ± 2.94 |
Benzyl caffeate | 6.11 ± 2.46 | 7.65 ± 1.95 |
Chrysin | 7.92 ± 2.90 | 10.67 ± 2.40 |
Caffeic acid phenethylester | 2.71 ± 1.15 | 4.64 ± 1.01 |
Galangin | 38.72 ± 11.43 | 36.12 ± 7.12 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, S.; Yang, C.; Luo, Y.; Chen, Q.; Xu, M.; Ji, Y.; Jiang, X.; Qu, C. Poplar Bud (Populus) Extraction and Chinese Propolis Counteract Oxidative Stress in Caenorhabditis elegans via Insulin/IGF-1 Signaling Pathway. Antioxidants 2024, 13, 860. https://doi.org/10.3390/antiox13070860
Wang S, Yang C, Luo Y, Chen Q, Xu M, Ji Y, Jiang X, Qu C. Poplar Bud (Populus) Extraction and Chinese Propolis Counteract Oxidative Stress in Caenorhabditis elegans via Insulin/IGF-1 Signaling Pathway. Antioxidants. 2024; 13(7):860. https://doi.org/10.3390/antiox13070860
Chicago/Turabian StyleWang, Shuo, Chengchao Yang, Yaling Luo, Qingyi Chen, Mengyang Xu, Yuntao Ji, Xiasen Jiang, and Changqing Qu. 2024. "Poplar Bud (Populus) Extraction and Chinese Propolis Counteract Oxidative Stress in Caenorhabditis elegans via Insulin/IGF-1 Signaling Pathway" Antioxidants 13, no. 7: 860. https://doi.org/10.3390/antiox13070860
APA StyleWang, S., Yang, C., Luo, Y., Chen, Q., Xu, M., Ji, Y., Jiang, X., & Qu, C. (2024). Poplar Bud (Populus) Extraction and Chinese Propolis Counteract Oxidative Stress in Caenorhabditis elegans via Insulin/IGF-1 Signaling Pathway. Antioxidants, 13(7), 860. https://doi.org/10.3390/antiox13070860