CCL2 and Lactate from Chemotherapeutics-Treated Fibroblasts Drive Malignant Traits by Metabolic Rewiring in Low-Migrating Breast Cancer Cell Lines
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Culture, Cell Lines, and Chemicals
2.2. Preparation of Conditioned Media from Stromal Cells
2.3. Lactate Quantification
2.4. Mitochondrial ROS (mtROS) and Cytosolic ROS Levels
2.5. MTT Assay
2.6. Determination of Mitochondrial Membrane Potential (∆ψm)
2.7. Evaluation of Metabolism in Real-Time
2.8. Determination of Sub-G1 Population
2.9. Cell Motility Assay
2.10. Quantitative PCR
2.11. Western Blot and Antibodies
2.12. Generation of THP-1 Macrophages with M1 Profile
2.13. Statistics
3. Results
3.1. Drugs Affecting the Structure and Function of DNA Impact the Mitochondrial Bioenergetics in Mammary Stromal Cells
3.2. Drugs Affecting the Structure and Function of DNA Induce Glucose Reprogramming in Mammary Stromal Cells
3.3. Conditioned Media from Stromal Cells Exposed to DNA-Damaging Drugs Increases the Migration in Epithelial Breast Cancer Cells
3.4. Conditioned Media from Stromal Cells Exposed to DNA-Damaging Drugs Increases the Metabolic Plasticity of Epithelial Breast Cancer Cells
3.5. CCL2 and Lactate from Conditioned Media by DNA-Damaging Drugs Are Essential for Inducing an Increased Migratory Capacity of MCF-7 Cancer Cells
3.6. Mitochondrial Pyruvate Transport and Glutaminolysis Are Required for Maintaining the Viability and Migration of Epithelial Breast Cancer Cells Exposed to CM from DNA-Damaging Drugs
3.7. Soluble Factors Generated by Stromal Cells Exposed to Drugs Enhance THP-1 Recruitment in a mtROS and CCL2 Production-Dependent Manner
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Feng, B.; Wu, J.; Shen, B.; Jiang, F.; Feng, J. Cancer-associated fibroblasts and resistance to anticancer therapies: Status, mechanisms, and countermeasures. Cancer Cell Int. 2022, 22, 166. [Google Scholar] [CrossRef]
- Bantug, G.R.; Hess, C. The immunometabolic ecosystem in cancer. Nat. Immunol. 2023, 24, 2008–2020. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.; Yue, X.; Chen, Z.; Liu, C.; Wu, W.; Zhang, N.; Liu, Z.; Yang, L.; Jiang, Q.; Cheng, Q.; et al. Define cancer-associated fibroblasts (CAFs) in the tumor microenvironment: New opportunities in cancer immunotherapy and advances in clinical trials. Mol. Cancer 2023, 22, 159. [Google Scholar] [CrossRef]
- Yang, D.; Liu, J.; Qian, H.; Zhuang, Q. Cancer-associated fibroblasts: From basic science to anticancer therapy. Exp. Mol. Med. 2023, 55, 1322–1332. [Google Scholar] [CrossRef] [PubMed]
- Li, Z.; Sun, C.; Qin, Z. Metabolic reprogramming of cancer-associated fibroblasts and its effect on cancer cell reprogramming. Theranostics 2021, 11, 8322–8336. [Google Scholar] [CrossRef] [PubMed]
- Martinez, J.; Smith, P.C. The Dynamic Interaction between Extracellular Matrix Remodeling and Breast Tumor Progression. Cells 2021, 10, 1046. [Google Scholar] [CrossRef] [PubMed]
- Zheng, J.; Hao, H. The importance of cancer-associated fibroblasts in targeted therapies and drug resistance in breast cancer. Front. Oncol. 2023, 13, 1333839. [Google Scholar] [CrossRef] [PubMed]
- Tobar, N.; Porras, O.; Smith, P.C.; Barros, L.F.; Martínez, J. Modulation of Mammary Stromal Cell Lactate Dynamics by Ambient Glucose and Epithelial Factors. J. Cell. Physiol. 2017, 232, 136–144. [Google Scholar] [CrossRef] [PubMed]
- Bonuccelli, G.; Tsirigos, A.; Whitaker-Menezes, D.; Pavlides, S.; Pestell, R.G.; Chiavarina, B.; Frank, P.G.; Flomenberg, N.; Howell, A.; Martinez-Outschoorn, U.E.; et al. Ketones and lactate “fuel” tumor growth and metastasis: Evidence that epithelial cancer cells use oxidative mitochondrial metabolism. Cell Cycle 2010, 9, 3506–3514. [Google Scholar] [CrossRef]
- Ippolito, L.; Morandi, A.; Taddei, M.L.; Parri, M.; Comito, G.; Iscaro, A.; Raspollini, M.R.; Magherini, F.; Rapizzi, E.; Masquelier, J.; et al. Cancer-associated fibroblasts promote prostate cancer malignancy via metabolic rewiring and mitochondrial transfer. Oncogene 2019, 38, 5339–5355. [Google Scholar] [CrossRef]
- Rong, G.; Kang, H.; Wang, Y.; Hai, T.; Sun, H. Candidate markers that associate with chemotherapy resistance in breast cancer through the study on Taxotere-induced damage to tumor microenvironment and gene expression profiling of carcinoma-associated fibroblasts (CAFs). PLoS ONE 2013, 8, e70960. [Google Scholar] [CrossRef]
- Tavares-Valente, D.; Baltazar, F.; Moreira, R.; Queirós, O. Cancer cell bioenergetics and pH regulation influence breast cancer cell resistance to paclitaxel and doxorubicin. J. Bioenerg. Biomembr. 2013, 45, 467–475. [Google Scholar] [CrossRef]
- Reuvers, T.G.A.; Kanaar, R.; Nonnekens, J. DNA Damage-Inducing Anticancer Therapies: From Global to Precision Damage. Cancers 2020, 12, 2098. [Google Scholar] [CrossRef]
- Rouse, J.; Jackson, S.P. Interfaces between the detection, signaling, and repair of DNA damage. Science 2002, 297, 547–551. [Google Scholar] [CrossRef]
- Maréchal, A.; Zou, L. DNA damage sensing by the ATM and ATR kinases. Cold Spring Harb. Perspect. Biol. 2013, 5, a012716. [Google Scholar] [CrossRef]
- Di Micco, R.; Krizhanovsky, V.; Baker, D.; di Fagagna, A. Cellular senescence in ageing: From mechanisms to therapeutic opportunities. Nat. Rev. Mol. Cell Biol. 2021, 22, 75–95. [Google Scholar] [CrossRef]
- Sun, K.; Tang, S.; Hou, Y.; Xi, L.; Chen, Y.; Yin, J.; Peng, M.; Zhao, M.; Cui, X.; Liu, M. Oxidized ATM-mediated glycolysis enhancement in breast cancer-associated fibroblasts contributes to tumor invasion through lactate as metabolic coupling. EBioMedicine 2019, 41, 370–383. [Google Scholar] [CrossRef]
- Acevedo, D.S.; Fang, W.B.; Rao, V.; Penmetcha, V.; Leyva, H.; Acosta, G.; Cote, P.; Brodine, R.; Swerdlow, R.; Tan, L.; et al. Regulation of growth, invasion and metabolism of breast ductal carcinoma through CCL2/CCR2 signaling interactions with MET receptor tyrosine kinases. Neoplasia 2022, 28, 100791. [Google Scholar] [CrossRef]
- Shou, Q.; Fu, H.; Huang, X.; Yang, Y. PARP-1 controls NK cell recruitment to the site of viral infection. JCI Insight 2019, 4, e121291. [Google Scholar] [CrossRef]
- Pascolo, E.; Wenz, C.; Lingner, J.; Hauel, N.; Priepke, H.; Kauffmann, I.; Garin-Chesa, P.; Rettig, W.J.; Damm, K.; Schnapp, A. Mechanism of human telomerase inhibition by BIBR1532, a synthetic, non-nucleosidic drug candidate. J. Biol. Chem. 2002, 277, 15566–15572. [Google Scholar] [CrossRef]
- Kuperwasser, C.; Chavarria, T.; Wu, M.; Magrane, G.; Gray, J.W.; Carey, L.; Richardson, A.; Weinberg, R.A. Reconstruction of functionally normal and malignant human breast tissues in mice. Proc. Natl. Acad. Sci. USA 2004, 101, 4966–4971. [Google Scholar] [CrossRef]
- Urra, F.A.; Muñoz, F.; Córdova-Delgado, M.; Ramírez, M.P.; Peña-Ahumada, B.; Rios, M.; Cruz, P.; Ahumada-Castro, U.; Bustos, G.; Silva-Pavez, E.; et al. FR58P1a; a new uncoupler of OXPHOS that inhibits migration in triple-negative breast cancer cells via Sirt1/AMPK/β1-integrin pathway. Sci. Rep. 2018, 8, 13190. [Google Scholar] [CrossRef] [PubMed]
- Monroy-Cárdenas, M.; Andrades, V.; Almarza, C.; Vera, M.J.; Martínez, J.; Pulgar, R.; Amalraj, J.; Araya-Maturana, R.; Urra, F.A. A New Quinone-Based Inhibitor of Mitochondrial Complex I in D-Conformation, Producing Invasion Reduction and Sensitization to Venetoclax in Breast Cancer Cells. Antioxidants 2023, 12, 1597. [Google Scholar] [CrossRef] [PubMed]
- Schmeda-Hirschmann, G.; Burgos-Edwards, A.; de Arias, A.R.; López-Torres, C.; Palominos, C.; Fuentes-Retamal, S.; Herrera, Y.; Dubois-Camacho, K.; Urra, F.A. A paraguayan toad Rhinella schneideri preparation based on Mbya tradition increases mitochondrial bioenergetics with migrastatic effects dependent on AMPK in breast cancer cells. J. Ethnopharmacol. 2022, 294, 115344. [Google Scholar] [CrossRef] [PubMed]
- Córdova-Delgado, M.; Fuentes-Retamal, S.; Palominos, C.; López-Torres, C.; Guzmán-Rivera, D.; Ramírez-Rodríguez, O.; Araya-Maturana, R.; Urra, F.A. FRI-1 Is an Anti-Cancer Isoquinolinequinone That Inhibits the Mitochondrial Bioenergetics and Blocks Metabolic Shifts by Redox Disruption in Breast Cancer Cells. Antioxidants 2021, 10, 1618. [Google Scholar] [CrossRef] [PubMed]
- Proleón, A.; Torrejón, D.; Urra, F.A.; Lazo, F.; López-Torres, C.; Fuentes-Retamal, S.; Quispe, E.; Bautista, L.; Agurto, A.; Gavilan, R.G.; et al. Vivas-Ruiz, Functional, immunological characterization, and anticancer activity of BaMtx: A new Lys49- PLA(2) homologue isolated from the venom of Peruvian Bothrops atrox snake (Serpentes: Viperidae). Int. J. Biol. Macromol. 2022, 206, 990–1002. [Google Scholar] [CrossRef] [PubMed]
- Olivares-Morales, M.J.; De La Fuente, M.K.; Dubois-Camacho, K.; Parada, D.; Diaz-Jiménez, D.; Torres-Riquelme, A.; Xu, X.; Chamorro-Veloso, N.; Naves, R.; Gonzalez, M.J.; et al. Glucocorticoids Impair Phagocytosis and Inflammatory Response Against Crohn’s Disease-Associated Adherent-Invasive Escherichia coli. Front. Immunol. 2018, 9, 1026. [Google Scholar] [CrossRef] [PubMed]
- Dasari, S.; Tchounwou, P.B. Cisplatin in cancer therapy: Molecular mechanisms of action. Eur. J. Pharmacol. 2014, 740, 364–378. [Google Scholar] [CrossRef] [PubMed]
- Taymaz-Nikerel, H.; Karabekmez, M.E.; Eraslan, S.; Kırdar, B. Doxorubicin induces an extensive transcriptional and metabolic rewiring in yeast cells. Sci. Rep. 2018, 8, 13672. [Google Scholar] [CrossRef]
- Dimmer, K.S.; Friedrich, B.; Lang, F.; Deitmer, J.W.; Bröer, S. The low-affinity monocarboxylate transporter MCT4 is adapted to the export of lactate in highly glycolytic cells. Biochem. J. 2000, 350 Pt 1, 219–227. [Google Scholar] [CrossRef]
- Hill, B.G.; Benavides, G.A.; Lancaster, J.R.; Ballinger, S.; Dell’Italia, L.; Zhang, J.; Darley-Usmar, V.M. Integration of cellular bioenergetics with mitochondrial quality control and autophagy. Biol. Chem. 2012, 393, 1485–1512. [Google Scholar] [CrossRef]
- Lee, Y.-K.; Lim, J.J.; Jeoun, U.-W.; Min, S.; Lee, E.-B.; Kwon, S.M.; Lee, C.; Yoon, G. Lactate-mediated mitoribosomal defects impair mitochondrial oxidative phosphorylation and promote hepatoma cell invasiveness. J. Biol. Chem. 2017, 292, 20208–20217. [Google Scholar] [CrossRef]
- Hu, H.; Li, M. Mitochondria-targeted antioxidant mitotempo protects mitochondrial function against amyloid beta toxicity in primary cultured mouse neurons. Biochem. Biophys. Res. Commun. 2016, 478, 174–180. [Google Scholar] [CrossRef]
- Quanz, M.; Bender, E.; Kopitz, C.; Grünewald, S.; Schlicker, A.; Schwede, W.; Eheim, A.; Toschi, L.; Neuhaus, R.; Richter, C.; et al. Preclinical Efficacy of the Novel Monocarboxylate Transporter 1 Inhibitor BAY-8002 and Associated Markers of Resistance. Mol. Cancer Ther. 2018, 17, 2285–2296. [Google Scholar] [CrossRef] [PubMed]
- Zhou, Y.; Lv, H.; Li, H.; Li, J.; Yan, Y.; Liu, F.; Hao, W.; Zhou, Z.; Wang, P.; Zhou, S. Nitroreductase Increases Menadione-Mediated Oxidative Stress in Aspergillus nidulans. Appl. Environ. Microbiol. 2021, 87, e0175821. [Google Scholar] [CrossRef] [PubMed]
- Loor, G.; Kondapalli, J.; Schriewer, J.M.; Chandel, N.S.; Hoek, T.L.V.; Schumacker, P.T. Menadione triggers cell death through ROS-dependent mechanisms involving PARP activation without requiring apoptosis. Free Radic. Biol. Med. 2010, 49, 1925–1936. [Google Scholar] [CrossRef] [PubMed]
- Nosoh, Y.; Kajioka, J.; Itoh, M. Effect of menadione on the electron transport pathway of yeast mitochondria. Arch. Biochem. Biophys. 1968, 127, 1–6. [Google Scholar] [CrossRef]
- Tauffenberger, A.; Fiumelli, H.; Almustafa, S.; Magistretti, P.J. Lactate and pyruvate promote oxidative stress resistance through hormetic ROS signaling. Cell Death Dis. 2019, 10, 653. [Google Scholar] [CrossRef]
- de la Cruz-López, K.G.; Castro-Muñoz, L.J.; Reyes-Hernández, D.O.; García-Carrancá, A.; Manzo-Merino, J. Lactate in the Regulation of Tumor Microenvironment and Therapeutic Approaches. Front. Oncol. 2019, 9, 1143. [Google Scholar] [CrossRef]
- Pérez-Escuredo, J.; Dadhich, R.K.; Dhup, S.; Cacace, A.; Van Hée, V.F.; De Saedeleer, C.J.; Sboarina, M.; Rodriguez, F.; Fontenille, M.J.; Brisson, L.; et al. Lactate promotes glutamine uptake and metabolism in oxidative cancer cells. Cell Cycle 2016, 15, 72–83. [Google Scholar] [CrossRef]
- Mantovani, A.; Allavena, P.; Sica, A.; Balkwill, F. Cancer-related inflammation. Nature 2008, 454, 436–444. [Google Scholar] [CrossRef] [PubMed]
- Ammarah, U.; Pereira-Nunes, A.; Delfini, M.; Mazzone, M. From monocyte-derived macrophages to resident macrophages—How metabolism leads their way in cancer. Mol. Oncol. 2024; online ahead of print. [Google Scholar] [CrossRef] [PubMed]
- Pavlova, N.N.; Thompson, C.B. The Emerging Hallmarks of Cancer Metabolism. Cell Metab. 2016, 23, 27–47. [Google Scholar] [CrossRef] [PubMed]
- Martinez-Outschoorn, U.E.; Lisanti, M.P. Tumor microenvironment: Introduction. Semin. Oncol. 2014, 41, 145. [Google Scholar] [CrossRef] [PubMed]
- Cantor, J.R.; Sabatini, D.M. Cancer cell metabolism: One hallmark, many faces. Cancer Discov. 2012, 2, 881–898. [Google Scholar] [CrossRef]
- Roos, W.P.; Thomas, A.D.; Kaina, B. DNA damage and the balance between survival and death in cancer biology. Nat. Rev. Cancer 2016, 16, 20–33. [Google Scholar] [CrossRef] [PubMed]
- Pezone, A.; Olivieri, F.; Napoli, M.V.; Procopio, A.; Avvedimento, E.V.; Gabrielli, A. Inflammation and DNA damage: Cause, effect or both. Nat. Rev. Rheumatol. 2023, 19, 200–211. [Google Scholar] [CrossRef] [PubMed]
- Sharma, D.; Singh, M.; Rani, R. Role of LDH in tumor glycolysis: Regulation of LDHA by small molecules for cancer therapeutics. Semin. Cancer Biol. 2022, 87, 184–195. [Google Scholar] [CrossRef] [PubMed]
- Jiang, J.; Huang, D.; Jiang, Y.; Hou, J.; Tian, M.; Li, J.; Sun, L.; Zhang, Y.; Zhang, T.; Li, Z.; et al. Lactate Modulates Cellular Metabolism Through Histone Lactylation-Mediated Gene Expression in Non-Small Cell Lung Cancer. Front. Oncol. 2021, 11, 647559. [Google Scholar] [CrossRef]
- Kumar, R.; Mishra, A.; Gautam, P.; Feroz, Z.; Vijayaraghavalu, S.; Likos, E.M.; Shukla, G.C.; Kumar, M. Metabolic Pathways, Enzymes, and Metabolites: Opportunities in Cancer Therapy. Cancers 2022, 14, 5268. [Google Scholar] [CrossRef]
- Deng, J.; Liao, X. Lysine lactylation (Kla) might be a novel therapeutic target for breast cancer. BMC Med. Genom. 2023, 16, 283. [Google Scholar] [CrossRef] [PubMed]
- Claps, G.; Faouzi, S.; Quidville, V.; Chehade, F.; Shen, S.; Vagner, S.; Robert, C. The multiple roles of LDH in cancer. Nat. Rev. Clin. Oncol. 2022, 19, 749–762. [Google Scholar] [CrossRef] [PubMed]
- To, T.-L.; McCoy, J.G.; Ostriker, N.K.; Sandler, L.S.; Mannella, C.A.; Mootha, V.K. PMF-seq: A highly scalable screening strategy for linking genetics to mitochondrial bioenergetics. Nat. Metab. 2024, 6, 687–696. [Google Scholar] [CrossRef] [PubMed]
- Stine, Z.E.; Schug, Z.T.; Salvino, J.M.; Dang, C.V. Targeting cancer metabolism in the era of precision oncology. Nat. Rev. Drug Discov. 2022, 21, 141–162. [Google Scholar] [CrossRef] [PubMed]
- Payen, V.L.; Mina, E.; Van Hée, V.F.; Porporato, P.E.; Sonveaux, P. Monocarboxylate transporters in cancer. Mol. Metab. 2020, 33, 48–66. [Google Scholar] [CrossRef] [PubMed]
- Wu, P.; Zhou, Y.; Guo, Y.; Zhang, S.-L.; Tam, K.Y. Recent developments of human monocarboxylate transporter (hMCT) inhibitors as anticancer agents. Drug Discov. Today 2021, 26, 836–844. [Google Scholar] [CrossRef] [PubMed]
- Zhu, S.; Liu, M.; Bennett, S.; Wang, Z.; Pfleger, K.D.G.; Xu, J. The molecular structure and role of CCL2 (MCP-1) and C-C chemokine receptor CCR2 in skeletal biology and diseases. J. Cell. Physiol. 2021, 236, 7211–7222. [Google Scholar] [CrossRef]
- Wang, Y.F.; Yu, L.; Hu, Z.L.; Fang, Y.F.; Shen, Y.Y.; Song, M.F.; Chen, Y. Regulation of CCL2 by EZH2 affects tumor-associated macrophages polarization and infiltration in breast cancer. Cell Death Dis. 2022, 13, 748. [Google Scholar] [CrossRef]
- Vera, M.J.; Guajardo, F.; Urra, F.A.; Tobar, N.; Martínez, J. TNF-Alpha Promotes an Inflammatory Mammary Microenvironment That Favors Macrophage and Epithelial Migration in a CCL2- and Mitochondrial-ROS-Dependent Manner. Antioxidants 2023, 12, 813. [Google Scholar] [CrossRef]
- Silva, V.L.; Al-Jamal, W.T. Exploiting the cancer niche: Tumor-associated macrophages and hypoxia as promising synergistic targets for nano-based therapy. J. Control. Release 2017, 253, 82–96. [Google Scholar] [CrossRef]
- Balkwill, F.; Mantovani, A. Inflammation and cancer: Back to Virchow? Lancet 2001, 357, 539–545. [Google Scholar] [CrossRef] [PubMed]
- Akhter, N.; Wilson, A.; Thomas, R.; Al-Rashed, F.; Kochumon, S.; Al-Roub, A.; Arefanian, H.; Al-Madhoun, A.; Al-Mulla, F.; Ahmad, R.; et al. ROS/TNF-α Crosstalk Triggers the Expression of IL-8 and MCP-1 in Human Monocytic THP-1 Cells via the NF-κB and ERK1/2 Mediated Signaling. Int. J. Mol. Sci. 2021, 22, 10519. [Google Scholar] [CrossRef] [PubMed]
- Gascard, P.; Tlsty, T.D. Carcinoma-associated fibroblasts: Orchestrating the composition of malignancy. Genes Dev. 2016, 30, 1002–1019. [Google Scholar] [CrossRef] [PubMed]






| Accession Number | Target mRNA | Forward Primer (5′_3′) | Reverse Primer (5′_3′) |
|---|---|---|---|
| NM_002982.4 | CCL2 | TGTCCCAAAGAAGCTGTGATCT | GGAATCCTGAACCCACTTCTG |
| NM_006516.4 | Glut1 | CCAGCTGCCATTGCCGTT | GACGTAGGGACCACACAGTTGC |
| NM_047437037.1 | MCT4 | ATTGGCCTGGTGCTGCTGATG | CGAGTCTGCAGGAGGCTTGTG |
| NM_002046.7 | GAPDH | TTGCCATCAATGACCCCTTC | TGATGACAAGCTTCCCGTTC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Vera, M.J.; Ponce, I.; Almarza, C.; Ramirez, G.; Guajardo, F.; Dubois-Camacho, K.; Tobar, N.; Urra, F.A.; Martinez, J. CCL2 and Lactate from Chemotherapeutics-Treated Fibroblasts Drive Malignant Traits by Metabolic Rewiring in Low-Migrating Breast Cancer Cell Lines. Antioxidants 2024, 13, 801. https://doi.org/10.3390/antiox13070801
Vera MJ, Ponce I, Almarza C, Ramirez G, Guajardo F, Dubois-Camacho K, Tobar N, Urra FA, Martinez J. CCL2 and Lactate from Chemotherapeutics-Treated Fibroblasts Drive Malignant Traits by Metabolic Rewiring in Low-Migrating Breast Cancer Cell Lines. Antioxidants. 2024; 13(7):801. https://doi.org/10.3390/antiox13070801
Chicago/Turabian StyleVera, Maria Jesus, Iván Ponce, Cristopher Almarza, Gonzalo Ramirez, Francisco Guajardo, Karen Dubois-Camacho, Nicolás Tobar, Félix A. Urra, and Jorge Martinez. 2024. "CCL2 and Lactate from Chemotherapeutics-Treated Fibroblasts Drive Malignant Traits by Metabolic Rewiring in Low-Migrating Breast Cancer Cell Lines" Antioxidants 13, no. 7: 801. https://doi.org/10.3390/antiox13070801
APA StyleVera, M. J., Ponce, I., Almarza, C., Ramirez, G., Guajardo, F., Dubois-Camacho, K., Tobar, N., Urra, F. A., & Martinez, J. (2024). CCL2 and Lactate from Chemotherapeutics-Treated Fibroblasts Drive Malignant Traits by Metabolic Rewiring in Low-Migrating Breast Cancer Cell Lines. Antioxidants, 13(7), 801. https://doi.org/10.3390/antiox13070801

