Pharmacological and Genetic Suppression of VDAC1 Alleviates the Development of Mitochondrial Dysfunction in Endothelial and Fibroblast Cell Cultures upon Hyperglycemic Conditions
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Culture Conditions
2.2. CRISPR/Cas9-Mediated Knockdown of VDAC1 Gene in Primary Human Fibroblasts
2.3. Hyperglycemia Induction
2.4. Measurement of Cell Viability
2.5. Measurements of the Mitochondrial Membrane Potential, ROS Production, and MPT Pore Opening in Cells
2.6. Electrophoresis and Immunoblotting
2.7. Quantitative Real-Time PCR
2.8. Statistical Data Processing
3. Results
3.1. Hyperglycemia Causes an Increase in VDAC1 Gene Expression in Primary Lung Endothelial Cells but a Decrease in Its Expression in Primary Fibroblasts
3.2. VBIT-4 Prevents the Development of Cell Death and Dysfunction of Mitochondria in Primary Lung Endothelial Cells upon Hyperglycemic Stress
3.3. Suppression of VDAC1 Expression in Human Skin Fibroblasts Normalizes Mitochondrial Function in Hyperglycemia
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- American Diabetes Association Professional Practice Committee. 2. Classification and Diagnosis of Diabetes: Standards of Medical Care in Diabetes—2022. Diabetes Care 2022, 45, S17–S38. [Google Scholar] [CrossRef] [PubMed]
- International Diabetes Federation. IDF Diabetes Atlas, 10th ed.; International Diabetes Federation: Brussels, Belgium, 2021. [Google Scholar]
- Rask-Madsen, C.; King, G.L. Vascular complications of diabetes: Mechanisms of injury and protective factors. Cell Metab. 2013, 17, 20–33. [Google Scholar] [CrossRef] [PubMed]
- Paul, S.; Ali, A.; Katare, R. Molecular complexities underlying the vascular complications of diabetes mellitus—A comprehensive review. J. Diabetes Complicat. 2020, 34, 107613. [Google Scholar] [CrossRef] [PubMed]
- Tan, Y.; Cheong, M.S.; Cheang, W.S. Roles of Reactive Oxygen Species in Vascular Complications of Diabetes: Therapeutic Properties of Medicinal Plants and Food. Oxygen 2022, 2, 246–268. [Google Scholar] [CrossRef]
- Yamagishi, S.; Nakamura, K.; Matsui, T.; Yoshida, Y.; Takenaka, K.; Jinnouchi, Y.; Imaizumi, T. Signal Transduction Therapy of Diabetic Vascular Complication. Curr. Signal Transduct. Ther. 2007, 2, 91–100. [Google Scholar] [CrossRef]
- Pandolfi, A.; De Filippis, E.A. Chronic hyperglicemia and nitric oxide bioavailability play a pivotal role in pro-atherogenic vascular modifications. Genes. Nutr. 2007, 2, 195–208. [Google Scholar] [CrossRef]
- Boden, G.; Vaidyula, V.R.; Homko, C.; Cheung, P.; Rao, A.K. Circulating tissue factor procoagulant activity and thrombin generation in patients with type 2 diabetes: Effects of insulin and glucose. J. Clin. Endocrinol. Metab. 2007, 92, 4352–4358. [Google Scholar] [CrossRef]
- Biswas, S.; Chakrabarti, S. Increased Extracellular Matrix Protein Production in Chronic Diabetic Complications: Implications of Non-Coding RNAs. Noncoding RNA 2019, 5, 30. [Google Scholar] [CrossRef]
- Hegazy, G.A.; Awan, Z.; Hashem, E.; Al-Ama, N.; Abunaji, A.B. Levels of soluble cell adhesion molecules in type 2 diabetes mellitus patients with macrovascular complications. J. Int. Med. Res. 2020, 48, 300060519893858. [Google Scholar] [CrossRef]
- Li, Y.; Liu, Y.; Liu, S.; Gao, M.; Wang, W.; Chen, K.; Huang, L.; Liu, Y. Diabetic vascular diseases: Molecular mechanisms and therapeutic strategies. Signal Transduct. Target. Ther. 2023, 8, 152. [Google Scholar] [CrossRef]
- Belosludtsev, K.N.; Belosludtseva, N.V.; Dubinin, M.V. Diabetes Mellitus, Mitochondrial Dysfunction and Ca2+-Dependent Permeability Transition Pore. Int. J. Mol. Sci. 2020, 21, 6559. [Google Scholar] [CrossRef] [PubMed]
- Yaribeygi, H.; Sathyapalan, T.; Atkin, S.L.; Sahebkar, A. Molecular mechanisms linking oxidative stress and diabetes mellitus. Oxid. Med. Cell Longev. 2020, 2020, 8609213. [Google Scholar] [CrossRef] [PubMed]
- Prasun, P. Mitochondrial dysfunction in metabolic syndrome. Biochim. Biophys. Acta Mol. Basis Dis. 2020, 1866, 165838. [Google Scholar] [CrossRef]
- Montgomery, M.K.; Turner, N. Mitochondrial dysfunction and insulin resistance: An update. Endocr. Connect. 2015, 4, R1–R15. [Google Scholar] [CrossRef]
- Dai, W.; Lu, H.; Chen, Y.; Yang, D.; Sun, L.; He, L. The loss of mitochondrial quality control in diabetic kidney disease. Front. Cell Dev. Biol. 2021, 9, 706832. [Google Scholar] [CrossRef] [PubMed]
- Lemasters, J.J.; Holmuhamedov, E. Voltage-dependent anion channel (VDAC) as mitochondrial governator–thinking outside the box. Biochim. Biophys. Acta 2006, 1762, 181–190. [Google Scholar] [CrossRef]
- Maldonado, E.N.; Lemasters, J.J. Warburg revisited: Regulation of mitochondrial metabolism by voltage-dependent anion channels in cancer cells. J. Pharmacol. Exp. Ther. 2012, 342, 637–641. [Google Scholar] [CrossRef]
- Magrì, A.; Reina, S.; De Pinto, V. VDAC1 as Pharmacological Target in Cancer and Neurodegeneration: Focus on Its Role in Apoptosis. Front. Chem. 2018, 6, 108. [Google Scholar] [CrossRef]
- Varughese, J.T.; Buchanan, S.K.; Pitt, A.S. The Role of Voltage-Dependent Anion Channel in Mitochondrial Dysfunction and Human Disease. Cells 2021, 10, 1737. [Google Scholar] [CrossRef]
- De Pinto, V. Renaissance of VDAC: New Insights on a Protein Family at the Interface between Mitochondria and Cytosol. Biomolecules 2021, 11, 107. [Google Scholar] [CrossRef]
- Zinghirino, F.; Pappalardo, X.G.; Messina, A.; Nicosia, G.; De Pinto, V.; Guarino, F. VDAC Genes Expression and Regulation in Mammals. Front. Physiol. 2021, 12, 708695. [Google Scholar] [CrossRef]
- Zhang, E.; Mohammed Al-Amily, I.; Mohammed, S.; Luan, C.; Asplund, O.; Ahmed, M.; Ye, Y.; Ben-Hail, D.; Soni, A.; Vishnu, N.; et al. Preserving insulin secretion in diabetes by inhibiting VDAC1 overexpression and surface translocation in β cells. Cell Metab. 2019, 29, 64–77. [Google Scholar] [CrossRef] [PubMed]
- Sasaki, K.; Donthamsetty, R.; Heldak, M.; Cho, Y.E.; Scott, B.T.; Makino, A. VDAC: Old protein with new roles in diabetes. Am. J. Physiol. Cell Physiol. 2012, 303, C1055–C1060. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Guo, Y.; Ge, W.; Zhou, X.; Pan, M. High glucose induces the apoptosis of HUVECs in mitochondria dependent manner by enhancing VDAC1 expression. Pharmazie 2018, 73, 725–728. [Google Scholar] [CrossRef] [PubMed]
- Atlante, A.; Valenti, D.; Latina, V.; Amadoro, G. Dysfunction of Mitochondria in Alzheimer’s Disease: ANT and VDAC Interact with Toxic Proteins and Aid to Determine the Fate of Brain Cells. Int. J. Mol. Sci. 2022, 23, 7722. [Google Scholar] [CrossRef]
- Pittala, S.; Levy, I.; De, S.; Kumar Pandey, S.; Melnikov, N.; Hyman, T.; Shoshan-Barmatz, V. The VDAC1-based R-Tf-D-LP4 Peptide as a Potential Treatment for Diabetes Mellitus. Cells 2020, 9, 481. [Google Scholar] [CrossRef]
- Starinets, V.S.; Serov, D.A.; Penkov, N.V.; Belosludtseva, N.V.; Dubinin, M.V.; Belosludtsev, K.N. Alisporivir Normalizes Mitochondrial Function of Primary Mouse Lung Endothelial Cells Under Conditions of Hyperglycemia. Biochemistry 2022, 87, 605–616. [Google Scholar] [CrossRef]
- Sobczak, M.; Dargatz, J.; Chrzanowska-Wodnicka, M. Isolation and culture of pulmonary endothelial cells from neonatal mice. J. Vis. Exp. 2010, 46, e2316. [Google Scholar] [CrossRef]
- Karagyaur, M.N.; Rubtsov, Y.P.; Vasiliev, P.A.; Tkachuk, V.A. Practical Recommendations for Improving Efficiency and Accuracy of the CRISPR/Cas9 Genome Editing System. Biochemistry 2018, 83, 629–642. [Google Scholar] [CrossRef]
- Cong, L.; Ran, F.A.; Cox, D.; Lin, S.; Barretto, R.; Habib, N.; Hsu, P.D.; Wu, X.; Jiang, W.; Marraffini, L.A.; et al. Multiplex genome engineering using CRISPR/Cas systems. Science 2013, 339, 819–823. [Google Scholar] [CrossRef]
- Cradick, T.J.; Qiu, P.; Lee, C.M.; Fine, E.J.; Bao, G. COSMID: A Web-based Tool for Identifying and Validating CRISPR/Cas Off-target Sites. Mol. Ther. Nucleic Acids. 2014, 3, e214. [Google Scholar] [CrossRef] [PubMed]
- Longo, P.A.; Kavran, J.M.; Kim, M.-S.; Leahy, D.J. Transient mammalian cell transfection with polyethylenimine (PEI). Methods Enzymol. 2013, 529, 227–240. [Google Scholar] [CrossRef] [PubMed]
- Tyurin-Kuzmin, P.A.; Karagyaur, M.N.; Kulebyakin, K.Y.; Dyikanov, D.T.; Chechekhin, V.I.; Ivanova, A.M.; Skryabina, M.N.; Arbatskiy, M.S.; Sysoeva, V.Y.; Kalinina, N.I.; et al. Functional Heterogeneity of Protein Kinase A Activation in Multipotent Stromal Cells. Int. J. Mol. Sci. 2020, 21, 4442. [Google Scholar] [CrossRef] [PubMed]
- Brinkman, E.K.; Chen, T.; Amendola, M.; van Steensel, B. Easy quantitative assessment of genome editing by sequence trace decomposition. Nucleic Acids Res. 2014, 42, e168. [Google Scholar] [CrossRef]
- Ye, J.; Coulouris, G.; Zaretskaya, I.; Cutcutache, I.; Rozen, S.; Madden, I. Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction. BMC Bioinform. 2012, 13, 134. [Google Scholar] [CrossRef]
- Schmittgen, T.D.; Livak, K.J. Analyzing real-time PCR data by the comparative C(T) method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef]
- Ben-Hail, D.; Begas-Shvartz, R.; Shalev, M.; Shteinfer-Kuzmine, A.; Gruzman, A.; Reina, S.; De Pinto, V.; Shoshan-Barmatz, V. Novel Compounds Targeting the Mitochondrial Protein VDAC1 Inhibit Apoptosis and Protect against Mitochondrial Dysfunction. J. Biol. Chem. 2016, 291, 24986–25003. [Google Scholar] [CrossRef]
- Belosludtsev, K.N.; Dubinin, M.V.; Belosludtseva, N.V.; Mironova, G.D. Mitochondrial Ca2+ transport: Mechanisms, molecular structures, and role in cells. Biochemistry 2019, 84, 593–607. [Google Scholar] [CrossRef]
- Taddeo, E.P.; Laker, R.C.; Breen, D.S.; Akhtar, Y.N.; Kenwood, B.M.; Liao, J.A.; Zhang, M.; Fazakerley, D.J.; Tomsig, J.L.; Harris, T.E.; et al. Opening of the mitochondrial permeability transition pore links mitochondrial dysfunction to insulin resistance in skeletal muscle. Mol. Metab. 2013, 3, 124–134. [Google Scholar] [CrossRef]
- Belosludtsev, K.N.; Starinets, V.S.; Talanov, E.Y.; Mikheeva, I.B.; Dubinin, M.V.; Belosludtseva, N.V. Alisporivir Treatment Alleviates Mitochondrial Dysfunction in the Skeletal Muscles of C57BL/6NCrl Mice with High-Fat Diet/Streptozotocin-Induced Diabetes Mellitus. Int. J. Mol. Sci. 2021, 22, 9524. [Google Scholar] [CrossRef]
- Benton, C.R.; Holloway, G.P.; Han, X.X.; Yoshida, Y.; Snook, L.A.; Lally, J.; Glatz, J.F.; Luiken, J.J.; Chabowski, A.; Bonen, A. Increased levels of peroxisome proliferator-activated receptor gamma, coactivator 1 alpha (PGC-1alpha) improve lipid utilisation, insulin signalling and glucose transport in skeletal muscle of lean and insulin-resistant obese Zucker rats. Diabetologia 2010, 53, 2008–2019. [Google Scholar] [CrossRef]
- Belosludtseva, N.V.; Starinets, V.S.; Mikheeva, I.B.; Belosludtsev, M.N.; Dubinin, M.V.; Mironova, G.D.; Belosludtsev, K.N. Effect of Chronic Treatment with Uridine on Cardiac Mitochondrial Dysfunction in the C57BL/6 Mouse Model of High-Fat Diet-Streptozotocin-Induced Diabetes. Int. J. Mol. Sci. 2022, 23, 10633. [Google Scholar] [CrossRef] [PubMed]
- Ahmed, M.; Muhammed, S.J.; Kessler, B.; Salehi, A. Mitochondrial proteome analysis reveals altered expression of voltage dependent anion channels in pancreatic β-cells exposed to high glucose. Islets 2010, 2, 283–292. [Google Scholar] [CrossRef] [PubMed]
- Gong, D.; Chen, X.; Middleditch, M.; Huang, L.; Vazhoor Amarsingh, G.; Reddy, S.; Lu, J.; Zhang, S.; Ruggiero, K.; Phillips, A.R.; et al. Quantitative proteomic profiling identifies new renal targets of copper(II)-selective chelation in the reversal of diabetic nephropathy in rats. Proteomics 2009, 9, 4309–4320. [Google Scholar] [CrossRef] [PubMed]
- Hu, Y.; Suarez, J.; Fricovsky, E.; Wang, H.; Scott, B.T.; Trauger, S.A.; Han, W.; Hu, Y.; Oyeleye, M.O.; Dillmann, W.H. Increased enzymatic O-GlcNAcylation of mitochondrial proteins impairs mitochondrial function in cardiac myocytes exposed to high glucose. J. Biol. Chem. 2009, 284, 547–555. [Google Scholar] [CrossRef]
- Lumini-Oliveira, J.; Magalhães, J.; Pereira, C.V.; Moreira, A.C.; Oliveira, P.J.; Ascensão, A. Endurance training reverts heart mitochondrial dysfunction, permeability transition and apoptotic signaling in long-term severe hyperglycemia. Mitochondrion 2011, 11, 54–63. [Google Scholar] [CrossRef]
- Pinti, M.V.; Fink, G.K.; Hathaway, Q.A.; Durr, A.J.; Kunovac, A.; Hollander, J.M. Mitochondrial dysfunction in type 2 diabetes mellitus: An organ-based analysis. Am. J. Physiol. Endocrinol. Metab. 2019, 316, E268–E285. [Google Scholar] [CrossRef]
- Belosludtseva, N.V.; Starinets, V.S.; Mikheeva, I.B.; Serov, D.A.; Astashev, M.E.; Belosludtsev, M.N.; Dubinin, M.V.; Belosludtsev, K.N. Effect of the MPT Pore Inhibitor Alisporivir on the Development of Mitochondrial Dysfunction in the Heart Tissue of Diabetic Mice. Biology 2021, 10, 839. [Google Scholar] [CrossRef]
- Belosludtsev, K.N.; Starinets, V.S.; Belosludtsev, M.N.; Mikheeva, I.B.; Dubinin, M.V.; Belosludtseva, N.V. Chronic treatment with dapagliflozin protects against mitochondrial dysfunction in the liver of C57BL/6NCrl mice with high-fat diet/streptozotocin-induced diabetes mellitus. Mitochondrion 2021, 59, 246–254. [Google Scholar] [CrossRef]
- Baik, S.H.; Ramanujan, V.K.; Becker, C.; Fett, S.; Underhill, D.M.; Wolf, A.J. Hexokinase dissociation from mitochondria promotes oligomerization of VDAC that facilitates NLRP3 inflammasome assembly and activation. Sci. Immunol. 2023, 8, eade7652. [Google Scholar] [CrossRef]
Name | Sequence | Amplicon Length, bp | Tmelting, °C |
---|---|---|---|
VDAC1-gRNA1 | TTTTCTGTTCAGCTTGCACG | - | - |
VDAC1-gRNA2 | TGCCACTAGATTTAGTCACA | ||
VDAC1-gRNA3 | TTCTCTGATGTTGCAGGTGG | - | - |
VDAC1-gRNA4 | TTACCCAGTGTTAGGTGAGA | ||
VDAC1-test-f | AGGGTCTTGCCTCTTGCAGAAA | 725 | 59 |
VDAC1-test-r | AGCTCCTTGGCGGGTAACAA |
Gene | Forward (5′→3′) | Reverse (5′→3′) |
---|---|---|
Human gene-specific primer | ||
Pink1 | AGCCACCATGCCTACATTGC | TGGAGGAACCTGCCGAGATG |
Prkn | ACAGCAGGAAGGACTCACCA | TGCTGCACTGTACCCTGAGT |
Drp1 | CTTCGGAGCTATGCGGTGGT | GCAGGACGAGGACCAGTAGC |
Mfn2 | AAGTGGAGAGGCAGGTGTCG | TCCTCTATGTGGCGGTGCAG |
Ppargc1a | GCCTTCCAACTCCCTCATGG | CTCCGGAAGAAACCCTTGCAT |
Vdac1 | CGCCTGCTTCTCGGCTAAAG | CCAGCATTGACGTTCTTGCC |
Rplp2 | GACGACCGGCTCAACAAGGT | CCAATACCCTGGGCAATGACG |
Mouse gene-specific primer | ||
Vdac1 | AGTGACCCAGAGCAACTTCGCA | CAGGCGAGATTGACAGCAGTCT |
Rplp2 | CGGCTCAACAAGGTCATCAGTGA | AGCAGAAACAGCCACAGCCCCAC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Belosludtsev, K.N.; Serov, D.A.; Ilzorkina, A.I.; Starinets, V.S.; Dubinin, M.V.; Talanov, E.Y.; Karagyaur, M.N.; Primak, A.L.; Belosludtseva, N.V. Pharmacological and Genetic Suppression of VDAC1 Alleviates the Development of Mitochondrial Dysfunction in Endothelial and Fibroblast Cell Cultures upon Hyperglycemic Conditions. Antioxidants 2023, 12, 1459. https://doi.org/10.3390/antiox12071459
Belosludtsev KN, Serov DA, Ilzorkina AI, Starinets VS, Dubinin MV, Talanov EY, Karagyaur MN, Primak AL, Belosludtseva NV. Pharmacological and Genetic Suppression of VDAC1 Alleviates the Development of Mitochondrial Dysfunction in Endothelial and Fibroblast Cell Cultures upon Hyperglycemic Conditions. Antioxidants. 2023; 12(7):1459. https://doi.org/10.3390/antiox12071459
Chicago/Turabian StyleBelosludtsev, Konstantin N., Dmitriy A. Serov, Anna I. Ilzorkina, Vlada S. Starinets, Mikhail V. Dubinin, Eugeny Yu. Talanov, Maxim N. Karagyaur, Alexandra L. Primak, and Natalia V. Belosludtseva. 2023. "Pharmacological and Genetic Suppression of VDAC1 Alleviates the Development of Mitochondrial Dysfunction in Endothelial and Fibroblast Cell Cultures upon Hyperglycemic Conditions" Antioxidants 12, no. 7: 1459. https://doi.org/10.3390/antiox12071459
APA StyleBelosludtsev, K. N., Serov, D. A., Ilzorkina, A. I., Starinets, V. S., Dubinin, M. V., Talanov, E. Y., Karagyaur, M. N., Primak, A. L., & Belosludtseva, N. V. (2023). Pharmacological and Genetic Suppression of VDAC1 Alleviates the Development of Mitochondrial Dysfunction in Endothelial and Fibroblast Cell Cultures upon Hyperglycemic Conditions. Antioxidants, 12(7), 1459. https://doi.org/10.3390/antiox12071459