Contribution of Elevated Glucose and Oxidized LDL to Macrophage Inflammation: A Role for PRAS40/Akt-Dependent Shedding of Soluble CD14
Abstract
1. Introduction
2. Materials and Methods
2.1. Reagents
2.2. Primary Cells from Healthy Donors and Cell Lines
2.3. Human Samples from Subjects with and without Diabetes
2.4. Quantification of Foam Cell Formation
2.5. DiI-oxLDL Uptake
2.6. Measurement of mRNA Levels by Real-Time PCR (RT-PCR)
2.7. Western Blot Analysis of Cell Lysates and Culture Supernatants
2.8. Silencing of CD36 Expression
2.9. Measurement of Cytokine Secretion
2.10. Flow Cytometry Analysis of Polarization Markers
2.11. Immunophenotyping
2.12. sCD14 ELISA
2.13. Phospho-Proteome Array
2.14. Statistical Analysis
3. Results
3.1. High Glucose Potentiates Macrophage oxLDL Uptake and Foam Cell Formation through CD36 Upregulation
3.2. Macrophage Inflammatory Responses to High Glucose Are Potentiated by oxLDL
3.3. High Glucose and oxLDL Moderately Influenced Macrophage Polarization
3.4. Effects of OxLDL and High Glucose on TLR4 and CD14 mRNA and Protein Expression
3.5. High Glucose + oxLDL-Mediated Induction of CD14 and Inflammatory Responses Are PRAS40/Akt-Dependent
3.6. TLR4 Is Elevated in a Subset of Non-Classical Monocytes from Subjects with T2D and Atherosclerosis
3.7. sCD14 Is Elevated in T2D Subjects with Hypercholesterolemia or Atherosclerosis
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Ross, R. Atherosclerosis an Inflammatory Disease. N. Engl. J. Med. 1999, 340, 115–126. [Google Scholar] [CrossRef] [PubMed]
- Sheedy, F.J.; Grebe, A.; Rayner, K.J.; Kalantari, P.; Ramkhelawon, B.; Carpenter, S.B.; Becker, C.E.; Ediriweera, H.N.; Mullick, A.E.; Golenbock, D.T.; et al. CD36 coordinates NLRP3 inflammasome activation by facilitating intracellular nucleation of soluble ligands into particulate ligands in sterile inflammation. Nat. Immunol. 2013, 14, 812–820. [Google Scholar] [CrossRef] [PubMed]
- Forbes, J.M.; Cooper, M.E. Mechanisms of Diabetic Complications. Physiol. Rev. 2013, 93, 137–188. [Google Scholar] [CrossRef] [PubMed]
- Ruderman, N.B.; Haudenschild, C. Diabetes as an atherogenic factor. Prog. Cardiovasc. Dis. 1984, 26, 373–412. [Google Scholar] [CrossRef] [PubMed]
- Purushothaman, K.-R.; Purushothaman, M.; Muntner, P.; A Lento, P.; O’Connor, W.N.; Sharma, S.K.; Fuster, V.; Moreno, P.R. Inflammation, neovascularization and intra-plaque hemorrhage are associated with increased reparative collagen content: Implication for plaque progression in diabetic atherosclerosis. Vasc. Med. 2011, 16, 103–108. [Google Scholar] [CrossRef]
- Burke, A.P.; Kolodgie, F.D.; Zieske, A.; Fowler, D.R.; Weber, D.K.; Varghese, P.J.; Farb, A.; Virmani, R. Morphologic Findings of Coronary Atherosclerotic Plaques in Diabetics. Arter. Thromb. Vasc. Biol. 2004, 24, 1266–1271. [Google Scholar] [CrossRef]
- Moreno, P.R.; Murcia, A.M.; Palacios, I.F.; Leon, M.N.; Bernardi, V.H.; Fuster, V.; Fallon, J. Coronary Composition and Macrophage Infiltration in Atherectomy Specimens from Patients With Diabetes Mellitus. Circulation 2000, 102, 2180–2184. [Google Scholar] [CrossRef]
- Silverstein, R.L. Inflammation, atherosclerosis, and arterial thrombosis: Role of the scavenger receptor CD36. Clevel. Clin. J. Med. 2009, 76, S27–S30. [Google Scholar] [CrossRef]
- Kunjathoor, V.V.; Febbraio, M.; Podrez, E.A.; Moore, K.J.; Andersson, L.; Koehn, S.; Rhee, J.S.; Silverstein, R.; Hoff, H.F.; Freeman, M.W. Scavenger Receptors Class A-I/II and CD36 Are the Principal Receptors Responsible for the Uptake of Modified Low Density Lipoprotein Leading to Lipid Loading in Macrophages. J. Biol. Chem. 2002, 277, 49982–49988. [Google Scholar] [CrossRef]
- Lusis, A.J. Atherosclerosis. Nature 2000, 407, 233–241. [Google Scholar] [CrossRef]
- Nakhjavani, M.; Khalilzadeh, O.; Khajeali, L.; Esteghamati, A.; Morteza, A.; Jamali, A.; Dadkhahipour, S. Serum Oxidized-LDL Is Associated with Diabetes Duration Independent of Maintaining Optimized Levels of LDL-Cholesterol. Lipids 2010, 45, 321–327. [Google Scholar] [CrossRef] [PubMed]
- Gao, S.; Zhao, D.; Wang, M.; Zhao, F.; Han, X.; Qi, Y.; Liu, J. Association Between Circulating Oxidized LDL and Atherosclerotic Cardiovascular Disease: A Meta-analysis of Observational Studies. Can. J. Cardiol. 2017, 33, 1624–1632. [Google Scholar] [CrossRef] [PubMed]
- Gao, S.; Zhao, D.; Qi, Y.; Wang, W.; Wang, M.; Sun, J.; Liu, J.; Li, Y.; Liu, J. Circulating Oxidized Low-Density Lipoprotein Levels Independently Predict 10-Year Progression of Subclinical Carotid Atherosclerosis: A Community-Based Cohort Study. J. Atheroscler. Thromb. 2018, 25, 1032–1043. [Google Scholar] [CrossRef] [PubMed]
- Silverstein, R.L.; Febbraio, M. CD36 and atherosclerosis. Curr. Opin. Infect. Dis. 2000, 11, 483–491. [Google Scholar] [CrossRef] [PubMed]
- Rahaman, S.O.; Lennon, D.J.; Febbraio, M.; Podrez, E.A.; Hazen, S.L.; Silverstein, R.L. A CD36-dependent signaling cascade is necessary for macrophage foam cell formation. Cell Metab. 2006, 4, 211–221. [Google Scholar] [CrossRef]
- Di Gioia, M.; Zanoni, I. Toll-like receptor co-receptors as master regulators of the immune response. Mol. Immunol. 2015, 63, 143–152. [Google Scholar] [CrossRef]
- Stewart, C.R.; Stuart, L.M.; Wilkinson, K.; van Gils, J.M.; Deng, J.C.; Halle, A.; Rayner, K.J.; Boyer, L.; Zhong, R.; Frazier, W.A.; et al. CD36 ligands promote sterile inflammation through assembly of a Toll-like receptor 4 and 6 heterodimer. Nat. Immunol. 2010, 11, 155–161. [Google Scholar] [CrossRef]
- Devaraj, S.; Glaser, N.; Griffen, S.; Wang-Polagruto, J.; Miguelino, E.; Jialal, I. Increased Monocytic Activity and Biomarkers of Inflammation in Patients with Type 1 Diabetes. Diabetes 2006, 55, 774–779. [Google Scholar] [CrossRef]
- Giulietti, A.; van Etten, E.; Overbergh, L.; Stoffels, K.; Bouillon, R.; Mathieu, C. Monocytes from type 2 diabetic patients have a pro-inflammatory profile: 1,25-Dihydroxyvitamin D3 works as anti-inflammatory. Diabetes Res. Clin. Pract. 2007, 77, 47–57. [Google Scholar] [CrossRef]
- Torres-Castro, I.; Arroyo-Camarena, D.; Martínez-Reyes, C.P.; Gómez-Arauz, A.Y.; Dueñas-Andrade, Y.; Hernández-Ruiz, J.; Béjar, Y.L.; Zaga-Clavellina, V.; Morales-Montor, J.; Terrazas, L.I.; et al. Human monocytes and macrophages undergo M1-type inflammatory polarization in response to high levels of glucose. Immunol. Lett. 2016, 176, 81–89. [Google Scholar] [CrossRef]
- Mirza, R.; Koh, T.J. Dysregulation of monocyte/macrophage phenotype in wounds of diabetic mice. Cytokine 2011, 56, 256–264. [Google Scholar] [CrossRef] [PubMed]
- Pickup, J.C. Inflammation and Activated Innate Immunity in the Pathogenesis of Type 2 Diabetes. Diabetes Care 2004, 27, 813–823. [Google Scholar] [CrossRef] [PubMed]
- Tanaka, M.; Masuda, S.; Matsuo, Y.; Sasaki, Y.; Yamakage, H.; Muranaka, K.; Wada, H.; Hasegawa, K.; Tsukahara, T.; Shimatsu, A.; et al. Hyperglycemia and Inflammatory Property of Circulating Monocytes are Associated with Inflammatory Property of Carotid Plaques in Patients Undergoing Carotid Endarterectomy. J. Atheroscler. Thromb. 2016, 23, 1212–1221. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Dasu, M.R.; Devaraj, S.; Zhao, L.; Hwang, D.H.; Jialal, I. High Glucose Induces Toll-like Receptor Expression in Human Monocytes Mechanism of Activation. Diabetes 2008, 57, 3090–3098. [Google Scholar] [CrossRef]
- Fukuhara-Takaki, K.; Sakai, M.; Sakamoto, Y.-I.; Takeya, M.; Horiuchi, S. Expression of Class A Scavenger Receptor Is Enhanced by High Glucose in Vitro and under Diabetic Conditions in Vivo: One Mechanism for an Increased Rate of Atherosclerosis in Diabetes. J. Biol. Chem. 2005, 280, 3355–3364. [Google Scholar] [CrossRef] [PubMed]
- Kovacina, K.S.; Park, G.Y.; Bae, S.S.; Guzzetta, A.W.; Schaefer, E.; Birnbaum, M.J.; Roth, R.A. Identification of a Proline-rich Akt Substrate as a 14-3-3 Binding Partner. J. Biol. Chem. 2003, 278, 10189–10194. [Google Scholar] [CrossRef] [PubMed]
- Sancak, Y.; Thoreen, C.C.; Peterson, T.R.; Lindquist, R.A.; Kang, S.A.; Spooner, E.; Carr, S.A.; Sabatini, D.M. PRAS40 Is an Insulin-Regulated Inhibitor of the mTORC1 Protein Kinase. Mol. Cell 2007, 25, 903–915. [Google Scholar] [CrossRef] [PubMed]
- Vander Haar, E.; Lee, S.-I.; Bandhakavi, S.; Griffin, T.J.; Kim, D.-H. Insulin signalling to mTOR mediated by the Akt/PKB substrate PRAS40. Nat. Cell Biol. 2007, 9, 316–323. [Google Scholar] [CrossRef] [PubMed]
- Zhang, K.S.; Schecker, J.; Krull, A.; Riechert, E.; Jürgensen, L.; Kamuf-Schenk, V.; Burghaus, J.; Kiper, L.; Ho, T.C.; Wöltje, K.; et al. PRAS40 suppresses atherogenesis through inhibition of mTORC1-dependent pro-inflammatory signaling in endothelial cells. Sci. Rep. 2019, 9, 1–13. [Google Scholar] [CrossRef]
- Sanjurjo, L.; Amézaga, N.; Aran, G.; Naranjo-Gómez, M.; Arias, L.; Armengol, C.; Borràs, F.E.; Sarrias, M.-R. The human CD5L/AIM-CD36 axis: A novel autophagy inducer in macrophages that modulates inflammatory responses. Autophagy 2015, 11, 487–502. [Google Scholar] [CrossRef]
- Amézaga, N.; Sanjurjo, L.; Julve, J.; Aran, G.; Pérez-Cabezas, B.; Bastos-Amador, P.; Armengol, C.; Vilella, R.; Escolà-Gil, J.C.; Blanco-Vaca, F.; et al. Human scavenger protein AIM increases foam cell formation and CD36-mediated oxLDL uptake. J. Leukoc. Biol. 2013, 95, 509–520. [Google Scholar] [CrossRef] [PubMed]
- Alonso, N.; Traveset, A.; Rubinat, E.; Ortega, E.; Alcubierre, N.; Sanahuja, J.; Hernández, M.; Betriu, A.; Jurjo, C.; Fernández, E.; et al. Type 2 diabetes-associated carotid plaque burden is increased in patients with retinopathy compared to those without retinopathy. Cardiovasc. Diabetol. 2015, 14, 1–9. [Google Scholar] [CrossRef] [PubMed]
- Vilanova, M.B.; Falguera, M.; Marsal, J.R.; Rubinat, E.; Alcubierre, N.; Castelblanco, E.; Granado-Casas, M.; Miró, N.; Molló, À.; Mata-Cases, M.; et al. Prevalence, clinical features and risk assessment of pre-diabetes in Spain: The prospective Mollerussa cohort study. BMJ Open 2017, 7, e015158. [Google Scholar] [CrossRef]
- Navas-Madroñal, M.; Castelblanco, E.; Camacho, M.; Consegal, M.; Ramirez-Morros, A.; Sarrias, M.R.; Perez, P.; Alonso, N.; Galán, M.; Mauricio, D. Role of the Scavenger Receptor CD36 in Accelerated Diabetic Atherosclerosis. Int. J. Mol. Sci. 2020, 21, 7360. [Google Scholar] [CrossRef] [PubMed]
- Sillesen, H.; Muntendam, P.; Adourian, A.; Entrekin, R.; Garcia, M.; Falk, E.; Fuster, V. Carotid Plaque Burden as a Measure of Subclinical Atherosclerosis: Comparison with Other Tests for Subclinical Arterial Disease in the High Risk Plaque BioImage Study. JACC Cardiovasc. Imaging 2012, 5, 681–689. [Google Scholar] [CrossRef] [PubMed]
- Touboul, P.-J.; Hennerici, M.G.; Meairs, S.; Adams, H.; Amarenco, P.; Bornstein, N.; Csiba, L.; Desvarieux, M.; Ebrahim, S.; Hernandez, R.H.; et al. Mannheim Carotid Intima-Media Thickness and Plaque Consensus (2004–2006–2011). Cerebrovasc. Dis. 2012, 34, 290–296. [Google Scholar] [CrossRef]
- Ruiz-Argüelles, A.; Pérez-Romano, B. Immunophenotypic Analysis of Peripheral Blood Lymphocytes. Curr. Protoc. Cytom. 2000, 11, 6.5.1–6.5.14. [Google Scholar] [CrossRef]
- Howell, K.W.; Meng, X.; Fullerton, D.A.; Jin, C.; Ao, L.; Reece, B.T.; Clevel, J.C. Toll-like receptor 4 mediates oxidized-LDL induced macrophage differentiation to foam cells. J. Am. Coll. Surg. 2010, 211, S140. [Google Scholar] [CrossRef]
- Pahwa, R.; Jialal, I. Hyperglycemia Induces Toll-Like Receptor Activity Through Increased Oxidative Stress. Metab. Syndr. Relat. Disord. 2016, 14, 239–241. [Google Scholar] [CrossRef]
- Lévêque, M.; Jeune, K.S.-L.; Jouneau, S.; Moulis, S.; Desrues, B.; Belleguic, C.; Brinchault, G.; Le Trionnaire, S.; Gangneux, J.-P.; Dimanche-Boitrel, M.-T.; et al. Soluble CD14 acts as a DAMP in human macrophages: Origin and involvement in inflammatory cytokine/chemokine production. FASEB J. 2017, 31, 1891–1902. [Google Scholar] [CrossRef]
- Wiza, C.; Nascimento, E.B.M.; Ouwens, D.M. Role of PRAS40 in Akt and mTOR signaling in health and disease. Am. J. Physiol. Metab. 2012, 302, E1453–E1460. [Google Scholar] [CrossRef] [PubMed]
- Holvoet, P.; Mertens, A.; Verhamme, P.; Bogaerts, K.; Beyens, G.; Verhaeghe, R.; Collen, D.; Muls, E.; Van de Werf, F. Circulating Oxidized LDL Is a Useful Marker for Identifying Patients with Coronary Artery Disease. Arter. Thromb. Vasc. Biol. 2001, 21, 844–848. [Google Scholar] [CrossRef] [PubMed]
- Idzkowska, E.; Eljaszewicz, A.; Miklasz, P.; Musial, W.J.; Tycinska, A.M.; Moniuszko, M. The Role of Different Monocyte Subsets in the Pathogenesis of Atherosclerosis and Acute Coronary Syndromes. Scand. J. Immunol. 2015, 82, 163–173. [Google Scholar] [CrossRef] [PubMed]
- Shanmugam, N.; Reddy, M.A.; Guha, M.; Natarajan, R. High Glucose-Induced Expression of Proinflammatory Cytokine and Chemokine Genes in Monocytic Cells. Diabetes 2003, 52, 1256–1264. [Google Scholar] [CrossRef] [PubMed]
- Lin, P.; Ji, H.-H.; Li, Y.-J.; Guo, S.-D. Macrophage Plasticity and Atherosclerosis Therapy. Front. Mol. Biosci. 2021, 8, 679797. [Google Scholar] [CrossRef]
- Miller, Y.I.; Viriyakosol, S.; Worrall, D.S.; Boullier, A.; Butler, S.; Witztum, J.L. Toll-Like Receptor 4–Dependent and –Independent Cytokine Secretion Induced by Minimally Oxidized Low-Density Lipoprotein in Macrophages. Arter. Thromb. Vasc. Biol. 2005, 25, 1213–1219. [Google Scholar] [CrossRef]
- Dasu, M.R.; Devaraj, S.; Park, S.; Jialal, I. Increased Toll-Like Receptor (TLR) Activation and TLR Ligands in Recently Diagnosed Type 2 Diabetic Subjects. Diabetes Care 2010, 33, 861–868. [Google Scholar] [CrossRef]
- Collot-Teixeira, S.; Martin, J.; McDermott-Roe, C.; Poston, R.; McGregor, J.L. CD36 and macrophages in atherosclerosis. Cardiovasc. Res. 2007, 75, 468–477. [Google Scholar] [CrossRef]
- Bufler, P.; Stiegler, G.; Schuchmann, M.; Hess, S.; Krüger, C.; Stelter, F.; Eckerskorn, C.; Schütt, C.; Engelmann, H. Soluble lipopolysaccharide receptor (CD14) is released via two different mechanisms from human monocytes and CD14 transfectants. Eur. J. Immunol. 1995, 25, 604–610. [Google Scholar] [CrossRef]
- Wright, S.D.; Ramos, R.A.; Tobias, P.S.; Ulevitch, R.J.; Mathison, J.C. CD14, a receptor for complexes of lipopolysaccharide (LPS) and LPS binding protein. Science 1990, 249, 1431–1433. [Google Scholar] [CrossRef]
- Frey, B.E.A.; Miller, D.S.; Jahr, G.; Sundan, A.; Espevik, I.I.T.; Finlay, S.B.B.; Wright, S.D. Soluble CD14 participates in the response of cells to lipopolysaccharide. J Exp Med. 1992, 176, 1655–1671. [Google Scholar] [CrossRef] [PubMed]
- Overhagen, S.; Blumensatt, M.; Fahlbusch, P.; de Wiza, D.H.; Müller, H.; Maxhera, B.; Akhyari, P.; Ouwens, D.M. Soluble CD14 inhibits contractile function and insulin action in primary adult rat cardiomyocytes. Biochim. Et Biophys. Acta (BBA) Mol. Basis Dis. 2017, 1863, 365–374. [Google Scholar] [CrossRef] [PubMed]
- Bas, S.; Gauthier, B.R.; Spenato, U.; Stingelin, S.; Gabay, C. CD14 Is an Acute-Phase Protein. J. Immunol. 2004, 172, 4470–4479. [Google Scholar] [CrossRef] [PubMed]
- Reiner, A.P.; Lange, E.M.; Jenny, N.S.; Chaves, P.H.; Ellis, J.; Li, J.; Walston, J.; Lange, L.A.; Cushman, M.; Tracy, R.P. Soluble CD14: Genomewide Association Analysis and Relationship to Cardiovascular Risk and Mortality in Older Adults. Arter. Thromb. Vasc. Biol. 2013, 33, 158–164. [Google Scholar] [CrossRef]
- Hermansson, C.; Lundqvist, A.; Magnusson, L.U.; Ullström, C.; Bergström, G.; Hultén, L.M. Macrophage CD14 expression in human carotid plaques is associated with complicated lesions, correlates with thrombosis, and is reduced by angiotensin receptor blocker treatment. Int. Immunopharmacol. 2014, 22, 318–323. [Google Scholar] [CrossRef] [PubMed]
- Rokita, E.; Menzel, E.J. Characteristics of CD14 shedding from human monocytes: Evidence for the competition of soluble CD14 (sCD14) with CD14 receptors for lipopolysaccharide (LPS) binding. Apmis 1997, 105, 510–518. [Google Scholar] [CrossRef]
- Rogacev, K.S.; Cremers, B.; Zawada, A.M.; Seiler, S.; Binder, N.; Ege, P.; Große-Dunker, G.; Heisel, I.; Hornof, F.; Jeken, J.; et al. CD14++CD16+ Monocytes Independently Predict Cardiovascular Events: A Cohort Study of 951 Patients Referred for Elective Coronary Angiography. J. Am. Coll. Cardiol. 2012, 60, 1512–1520. [Google Scholar] [CrossRef]
- Wildgruber, M.; Aschenbrenner, T.; Wendorff, H.; Czubba, M.; Glinzer, A.; Haller, B.; Schiemann, M.; Zimmermann, A.; Berger, H.; Eckstein, H.-H.; et al. The “Intermediate” CD14++CD16+ monocyte subset increases in severe peripheral artery disease in humans. Sci. Rep. 2016, 6, 39483. [Google Scholar] [CrossRef]
- Berg, K.E.; Ljungcrantz, I.; Andersson, L.; Bryngelsson, C.; Hedblad, B.; Fredrikson, G.N.; Nilsson, J.; Björkbacka, H. Elevated CD14++ CD16− Monocytes Predict Cardiovascular Events. Circ. Cardiovasc. Genet. 2012, 5, 122–131. [Google Scholar] [CrossRef]
Characteristics | Non-Diabetic Subjects | T2D | p-Value |
---|---|---|---|
N = 70 | N = 69 | ||
Sex, men | 39 (55.7%) | 34 (49.3%) | 0.555 |
Age, years | 56.5 [47.0; 62.8] | 63.0 [56.0; 69.0] | <0.001 |
Hypertension | 15 (21.4%) | 47 (68.1%) | <0.001 |
Dyslipidemia | 20 (28.6%) | <0.001 | |
BMI, kg/m2 | 25.6 [23.9; 27.7] | 28.9 [26.6; 32.0] | <0.001 |
Tobacco exp | 35 (50.7%) | 36 (52.2%) | 0.931 |
Glucose, mg/dL | 92.0 [85.0; 98.0] | 147 [120; 206] | <0.001 |
Triglycerides, mg/dL | 89.0 [74.0; 128] | 128 [97.0; 168] | <0.001 |
Total cholesterol, mg/dL | 213 [189; 234] | 202 [148; 220] | 0.024 |
HDL cholesterol, mg/dL | 56.4 [48.1; 66.5] | 45.0 [38.2; 57.0] | <0.001 |
LDL cholesterol, mg/dL | 121 [94.0; 152] | 93.4 [60.2; 138] | 0.031 |
HbA1c, % | 5.60 [5.40; 5.90] | 7.80 [6.80; 8.75] | <0.001 |
Plaque, n (%) | 38 (54.3%) | 44 (63.8%) | 0.335 |
Gene | Forward Primer 5′ --> 3′ | Reverse Primer 5′ --> 3′ | Tm °C |
---|---|---|---|
CD36 | GAGAACTGTTATGGGGCTAT | TTCAACTGGAGAGGCAAAGG | 59.8/63.1 |
SRA1 | CCAGGGACATGGGAATGCAA | CCAGTGGGACCTCGATCTCC | 67.5/66.6 |
SCARB1 | TCAGCTCCCAAGGGCTCTGTGC | AAAGGCGCTTTGCCTGGCCT | 71.6/70.9 |
ABCA1 | TGAGCTACCCACCCTATGAACA | CCCCTGAACCCAAGGAAGTG | 65.9/65.6 |
ABCG1 | CCTGCTGTACTTGGGGATCGGGAACG | CCAGCGCGGCAAACAGCACAAAG | 73.0/72.2 |
TLR4 | GCTCGGTCAGACGGTGATAG | TAGGAACCACCTCCACGCAG | 64.8/66.7 |
CD14 | GCTGTGTAGGAAAGAAGCTA | TTTAGAAACGGCTCTAGGTTG | 60.2/60.8 |
GAPDH | TCTTCTTTTGCGTCGCCAG | AGCCCCAGCCTTCTCCA | 63.8/66.0 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sanjurjo, L.; Castelblanco, E.; Julve, J.; Villalmanzo, N.; Téllez, É.; Ramirez-Morros, A.; Alonso, N.; Mauricio, D.; Sarrias, M.-R. Contribution of Elevated Glucose and Oxidized LDL to Macrophage Inflammation: A Role for PRAS40/Akt-Dependent Shedding of Soluble CD14. Antioxidants 2023, 12, 1083. https://doi.org/10.3390/antiox12051083
Sanjurjo L, Castelblanco E, Julve J, Villalmanzo N, Téllez É, Ramirez-Morros A, Alonso N, Mauricio D, Sarrias M-R. Contribution of Elevated Glucose and Oxidized LDL to Macrophage Inflammation: A Role for PRAS40/Akt-Dependent Shedding of Soluble CD14. Antioxidants. 2023; 12(5):1083. https://doi.org/10.3390/antiox12051083
Chicago/Turabian StyleSanjurjo, Lucía, Esmeralda Castelblanco, Josep Julve, Nuria Villalmanzo, Érica Téllez, Anna Ramirez-Morros, Núria Alonso, Dídac Mauricio, and Maria-Rosa Sarrias. 2023. "Contribution of Elevated Glucose and Oxidized LDL to Macrophage Inflammation: A Role for PRAS40/Akt-Dependent Shedding of Soluble CD14" Antioxidants 12, no. 5: 1083. https://doi.org/10.3390/antiox12051083
APA StyleSanjurjo, L., Castelblanco, E., Julve, J., Villalmanzo, N., Téllez, É., Ramirez-Morros, A., Alonso, N., Mauricio, D., & Sarrias, M.-R. (2023). Contribution of Elevated Glucose and Oxidized LDL to Macrophage Inflammation: A Role for PRAS40/Akt-Dependent Shedding of Soluble CD14. Antioxidants, 12(5), 1083. https://doi.org/10.3390/antiox12051083