Next Article in Journal
Natural Substances vs. Approved Drugs in the Treatment of Main Cardiovascular Disorders—Is There a Breakthrough?
Previous Article in Journal
Diet and Aging: The Role of Polyphenol-Rich Diets in Slow Down the Shortening of Telomeres: A Review
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Antioxidants
Volume 12
Issue 12
10.3390/antiox12122087
antioxidants-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Lactate Mediates High-Intensity Interval Training—Induced Promotion of Hippocampal Mitochondrial Function through the GPR81-ERK1/2 Pathway

by
Qinghui Shang
1,2,
Xuepeng Bian
2,
Lutao Zhu
2,
Jun Liu
2,
Min Wu
2 and
Shujie Lou
1,2,*
1
Key Laboratory of Exercise and Health Sciences, Shanghai University of Sport, Ministry of Education, Shanghai 200438, China
2
Key Laboratory of Human Performance, Shanghai University of Sport, Shanghai 200438, China
*
Author to whom correspondence should be addressed.
Antioxidants 2023, 12(12), 2087; https://doi.org/10.3390/antiox12122087
Submission received: 31 October 2023 / Revised: 27 November 2023 / Accepted: 5 December 2023 / Published: 7 December 2023
Browse Figures
Review Reports Versions Notes

Abstract

:
Mitochondrial biogenesis and fusion are essential for maintaining healthy mitochondria and ATP production. High-intensity interval training (HIIT) can enhance mitochondrial function in mouse hippocampi, but its underlying mechanism is not completely understood. Lactate generated during HIIT may mediate the beneficial effects of HIIT on neuroplasticity by activating the lactate receptor GPR81. Furthermore, growing evidence shows that lactate contributes to mitochondrial function. Given that mitochondrial function is crucial for cerebral physiological processes, the current study aimed to determine the mechanism of HIIT in hippocampal mitochondrial function. In vivo, GPR81 was knocked down in the hippocampi of mice via the injection of adeno-associated virus (AAV) vectors. The GPR81-knockdown mice were subjected to HIIT. The results demonstrated that HIIT increased mitochondria numbers, ATP production, and oxidative phosphorylation (OXPHOS) in the hippocampi of mice. In addition, HIIT induced mitochondrial biogenesis, fusion, synaptic plasticity, and ERK1/2 phosphorylation but not in GPR81-knockdown mice. In vitro, Neuro-2A cells were treated with L-lactate, a GPR81 agonist, and an ERK1/2 inhibitor. The results showed that both L-lactate and the GPR81 agonist increased mitochondrial biogenesis, fusion, ATP levels, OXPHOS, mitochondrial membrane potential, and synaptic plasticity. However, the inhibition of ERK1/2 phosphorylation blunted L-lactate or the GPR81 agonist-induced promotion of mitochondrial function and synaptic plasticity. In conclusion, our findings suggest that lactate mediates HIIT-induced promotion of mitochondrial function through the GPR81-ERK1/2 pathway.

1. Introduction

Most energy in neurons is used for synaptic transmission, making it important to maintain sufficient mitochondrial ATP production [1]. Numerous studies have demonstrated that abnormal mitochondria may be linked to synapse dysfunction [2,3,4]. Therefore, an improvement in mitochondrial function is important for synaptic plasticity. Emerging evidence has shown that the promotion of mitochondrial function benefits from high-intensity interval training (HIIT) [5,6,7], which is characterized by periods of high-intensity exercise combined with short rest intervals. However, the underlying mechanisms of HIIT on hippocampal mitochondrial function in mice have not been fully elucidated.
In neurons, mitochondria are enriched at presynaptic terminals at the ends of axons and postsynaptic terminals at the ends of dendrites, where bioenergetic demand is particularly high [8]. Mitochondrial biogenesis produces new mitochondria accompanied by mitochondrial fusion to maintain a healthy mitochondrial network [9]. Mitochondrial biogenesis and fusion play active roles in mitochondrial function. Mitochondrial biogenesis is a cellular process in which new and healthy mitochondria are formed [10]. Peroxisome proliferator-activated receptor γ coactivator 1α (PGC-1α) is a master regulator of mitochondrial biogenesis and interacts with transcription factors, including nuclear respiratory factors (NRF1 and NRF2) [11]. Both NRF1 and NRF2 participate in the transcription of mitochondrial transcription factor A (TFAM), which are major regulators of mitochondrial DNA transcription [12]. Mitochondrial fusion requires the coordination of three enzymes, mitofusin 1 and mitofusin 2 (MFN1 and MFN2), and promotes the fusion of the outer mitochondrial membrane (OMM), whereas optic atrophy 1 (OPA1) promotes the fusion of the inner mitochondrial membrane (IMM) [13]. HIIT has been shown to have positive effects on hippocampal mitochondrial biogenesis, fusion, and lactate levels in our previous work [14], indicating the potential roles of lactate in hippocampal mitochondrial function.
Despite the old perception that lactate is a metabolic end-product of glycolysis and causes acidosis in the body, recent studies have emphasized its beneficial effect. When blood lactate levels increase, such as during exercise, there is a net influx of lactate from blood to the brain as an energy substrate [15] or as a signaling molecule [16]. It has been shown that peak blood lactate during HIIT is 12.3 ± 3.5 mM [17]. Our previous research has shown that hippocampal lactate levels increase significantly in mice during HIIT [14]. The neurobiological roles of brain lactate as an energy substrate have now been described. However, the mechanisms of lactate as a signaling molecule in the HIIT-induced promotion of cerebral function are not completely understood. A previous study demonstrated that lactate mediates the effects of exercise on learning and memory by activating BDNF signaling [18]. Lactate can mediate HIIT-induced neurogenesis [19] and angiogenesis [16] in the brain via the lactate receptor (GPR81). In addition, lactate can enhance mitochondrial function in myotubes [20] and promote the gene expression of mitochondrial biogenesis in neuroblastoma cells [21]. Furthermore, our previous work has demonstrated that lactate promotes mitochondrial biogenesis and fusion in primary hippocampal cells [14], but the roles of GPR81 in hippocampal mitochondrial function remain unknown.
GPR81 is a transmembrane G-protein coupled receptor (GPCR) discovered in 2001 for which lactate is the only known endogenous ligand [22,23]. GPR81 is expressed mainly in adipose, brain, skeletal muscle, and liver tissues [23]. Recent studies have shown that GPR81 can activate the cAMP/PKA pathway [20,24,25] and the PLC/PKC/Akt pathway [26]. In addition, GPR81 can regulate the phosphorylation of the ERK1/2 protein kinases [27,28,29]. Studies have shown that ERK1/2 can mediate mitochondrial biogenesis, fusion, and mitochondrial function in lung epithelial cells [30], hair follicle stem cells [31], kidney tissue [32], and human retinal microcapillary endothelial cells [33]. However, whether HIIT can enhance hippocampal mitochondrial function through GPR81-ERK1/2 needs to be explored.
Given the existing evidence, we hypothesized that lactate produced as a consequence of HIIT can activate the GPR81-ERK1/2 pathway, which might further promote hippocampal mitochondrial biogenesis, fusion, and mitochondrial function. To test this hypothesis, we used both in vivo and in vitro studies to identify the roles of GPR81 and ERK1/2 in the HIIT-induced promotion of mitochondrial function.

2. Materials and Methods

2.1. Animals

The 7-week-old male C57BL/6J mice were purchased from the Nanjing Model Animal Research Center and kept in the SPF animal laboratory (temperature of 22 °C ± 2 °C under a 12/12 h light/dark cycle) with free access to water and food. The experimental design and animal use were in accordance with the guidelines set by the Institutional Animal Ethics Committee (IAEC) and approved by the Scientific Research Ethics Committee of Shanghai University of Sport (102772019DW010).

2.2. HIIT Paradigm and Blood Lactate Detection

Mice were subjected to HIIT with a protocol adapted from the study of Morland et al. [16]. Each HIIT session consisted of a 10 min warm-up at 10 m/min and ten bouts of exercise/recovery at intervals of 4 min. After the warm-up, the animals were made to run at 80–90% of the maximum speed for 4 min, and then allowed 2 min of active recovery at 40–50% of the maximum speed with a 10° inclination (Table 1). A maximal exercise-capacity test was performed for each mouse every other week to adjust the running speed to near the maximum it could sustain during ten consecutive intervals. Tail-tip blood was immediately collected from each mouse in each group after HIIT to measure blood lactate. Blood lactate was measured with Lactate-Scout (EKF Co., Leipzig, Germany).

2.3. Adeno-Associated Virus (AAV) Treatment

To study the roles of GPR81 in HIIT-mediated mitochondrial function, AAVs were bilaterally infused into the hippocampus using stereotaxic surgery (AP, −2.3 mm; ML, ±1.9 mm; DV, −2.0 mm). The shGPR81/SED and shGPR81/HIIT groups were injected with AAV harboring shRNA-targeting murine GPR81 to induce the specific knockdown of hippocampal GPR81, and the shNC/SED and shNC/HIIT groups were injected with AAV harboring control short hairpin RNA. The AAVs used above were packaged and purified by HANBIO, Shanghai, China.

2.4. Transmission Electron Microscopy

Mice were decapitated, and the hippocampi were quickly separated from the brains. Then, the hippocampi were dissected into 1 mm3 pieces and placed in 2.5% glutaraldehyde for 2 h at 4 °C. Next, the hippocampi were postfixed with 1% osmium tetroxide in 0.1 M phosphate buffer (PB) for 1 h at room temperature and dehydrated in graded alcohols. The hippocampi were embedded and polymerized for 48 h at 60 °C. Pieces of CA1 regions were selected, and ultrathin sections of 60 nm were cut on a Leica Ultracut (Leica EM UC7, Wetzlar, Germany). The sections were stained with uranyl acetate and lead citrate for 15 min. Images were obtained using a transmission electron microscope (HT7700, Hitachi, Tokyo, Japan). The number of mitochondria in the CA1 region was analyzed.

2.5. Neuro-2A Cell Culture

Neuro-2A cells were purchased from the National Collection of Authenticated Cell Cultures, China. The cells were grown in MEM (11090-081, Gibco, New York, NY, USA) containing 10% FBS (10099141C, Gibco), 1% GlutaMax (35050061, Gibco), 1% sodium pyruvate (11360070, Gibco), 1% NEAA (11140050, Gibco), and 1% penicillin–streptomycin solution (C0222, Beyotime, Shanghai, China) at 37 °C in 5% CO2.

2.6. Cell Treatment

Neuro-2A cells were treated with L-lactate (L7022, Sigma-Aldrich, St. Louis, MO, USA) for six hours or the GPR81 agonist 3-OBA (3-chloro-5-hydroxybenzoic acid, S5400, Selleck, Houston, TX, USA) for three hours. ERK1/2 inhibitor (SCH772984, S7101, Selleck) was applied 30 min before L-lactate and 3-OBA stimulation. L-lactate was prepared in MEM at a final concentration of 15 mM. 3-OBA was prepared as a 1000 mM stock in DMSO and used at a final concentration of 1 mM. SCH772984 was prepared as a 4 mM stock in DMSO and used at a final concentration of 2 μM. Considering the possible effects of DMSO, the DMSO group received equivalent volumes of DMSO.

2.7. JC-1 Staining

JC-1 staining was performed using an enhanced mitochondrial membrane potential (MMP) assay kit with JC-1 (C2003S, Beyotime) to detect the MMP. The cells were pretreated with 2 μM SCH772984 and then incubated with L-lactate or 3-OBA. The cells were washed with PBS once and incubated with 2 mL of JC-1 staining working buffer per well for 20 min at 37 °C. Then, the cells were washed twice with JC-1 staining buffer solution, and 2 mL of MEM was added. The intensities of red fluorescence and green fluorescence were observed by fluorescence microscopy. MMP was measured according to the ratio of red/green fluorescence intensity.

2.8. ATP Detection

ATP levels were detected using an enhanced ATP assay kit (S0027, Beyotime). Mouse hippocampi and Neuro-2A cells were lysed using ATP lysis buffer on ice and centrifuged at 12,000× g at 4 °C for 5 min. The supernatants were collected for assessment. Then, 100 μL of ATP working solution and 20 μL of supernatant were added to a 96-well plate and mixed quickly. ATP levels were measured with a luminometer and normalized to the protein concentration.

2.9. RNA Extraction and Reverse Transcription-Quantitative PCR (RT-qPCR)

Total RNA from cells and tissues was extracted using TRIzol reagent (9109, Takara, Shiga, Japan). Reverse transcription was performed using a PrimeScript™ RT reagent kit (RR047A, Takara) according to the manufacturer’s protocol. Real-time PCR was performed using TB Green® Premix Ex Taq™ II (RR820A, Takara). The primer information for qPCR is listed in Table 2.

2.10. Western Blot Analysis

Mouse hippocampi and Neuro-2A cells were lysed using RIPA lysis buffer (P0013B, Beyotime) containing 1% PMSF (ST506, Beyotime) on ice and centrifuged at 14,000× g at 4 °C for 5 min. The supernatants were collected, and the protein concentrations of the supernatants were measured using a BCA protein assay kit (P0010, Beyotime) according to the manufacturer’s protocol. Samples were boiled in loading buffer (P0015L, Beyotime) at 95 °C for 10 min. Total protein (20 μg) was loaded onto a 10% PAGE gel (PG112/PG113, Epizyme, Shanghai, China) and transferred to a PVDF membrane. The PVDF membrane was blocked in blocking buffer (BSA and TBS-Tween 20) and incubated overnight at 4 °C with the following primary antibodies: GPR81 (SAB1300790, Sigma-Aldrich), p-ERK1/2 (4370, CST, Danvers, MA, USA), t-ERK1/2 (4695, CST), Arc (16290-1-AP, Proteintech, Wuhan, China), c-Fos (2250, CST), Egr1 (4154, CST), BDNF (28205-1-AP, Proteintech), SYN (4329, CST), PSD95 (3450, CST), PGC-1α (NBP1-04676SS, Novus, Littleton, CO, USA), NRF1 (46743, CST), NRF2 (12721, CST), TFAM (ab131607, Abcam, Cambridge, UK), OPA1 (80471, CST), MFN1 (13798-1-AP, Proteintech), MFN2 (9482, CST), and β-Tubulin (10068-1-AP, Proteintech). The membrane was then washed and incubated with a horseradish peroxidase (HRP)-labeled anti-rabbit secondary antibody (SA00001-2, Proteintech) for one hour at room temperature. The protein bands were detected using an enhanced chemiluminescence kit. The densities of the protein blots were quantified using ImageJ (Version 1.54g) and normalized to the band intensity of β-Tubulin.

2.11. Statistical Analysis

All data were analyzed using GraphPad Prism software version 8.0 (GraphPad Software, San Diego, CA, USA). Comparisons for multiple groups were performed using one-way analysis of variance (ANOVA) followed by the Bonferroni post-tests used to measure statistical significance. A value of p < 0.05 was considered to indicate statistical significance.

3. Results

3.1. Knockdown of Hippocampal GPR81 Leads to a Reduction in the Number of Mitochondria in Mice

Our previous work demonstrated that HIIT can enhance hippocampal mitochondrial fusion and biogenesis, which is mainly attributable to the signaling roles of lactate [14]. Hence, on the basis of our previous research, the present study investigated the roles of the lactate receptor GPR81 in the HIIT-induced improvement of mitochondrial function. HIIT increased GPR81 protein expression, and stereotaxically injected AAV harboring shRNA against GPR81 led to the specific knockdown of GPR81 in the hippocampi of mice (Figure 1a). Compared to shNC/SED, HIIT increased the number of mitochondria (Figure 1b,c). However, GPR81 knockdown led to a reduction in the number of mitochondria (Figure 1b,c).

3.2. Knockdown of Hippocampal GPR81 Reduces HIIT-Induced Promotion of OXPHOS and Increases in ATP Levels in Mice

Hippocampal OXPHOS-related gene (NDUFS8, SDHb, Uqcrc1, COX5b, and Atp5a1) expression and ATP levels were used to reflect mitochondrial function in the present study. Compared to the shNC/SED group, HIIT increased the expression of OXPHOS-related genes, including NDUFS8 (Figure 2a), SDHb (Figure 2b), Uqcrc1 (Figure 2c), COX5b (Figure 2d), and Atp5a1 (Figure 2e), as well as the levels of ATP (Figure 2f). However, GPR81 knockdown led to a lower expression of genes associated with OXPHOS (Figure 2a,b,d,e) and lower levels of ATP (Figure 2f). Furthermore, HIIT could no longer increase the expression of OXPHOS-related genes in mice with a knockdown of GPR81 (Figure 2a,c–e). These results demonstrate that HIIT enhances mitochondrial function in a manner mediated by GPR81.

3.3. Knockdown of Hippocampal GPR81 Prevents HIIT from Inducing the Expression of Genes and Proteins Expression Related to Mitochondrial Biogenesis

Exercise can increase mitochondrial biogenesis, which is crucial for mitochondrial energy production. In the present study, higher expression levels of genes and proteins associated with mitochondrial biogenesis were found in shNC/HIIT mice than in shNC/SED mice (Figure 3). However, GPR81 deficiency led to a lower expression of genes and proteins associated with mitochondrial biogenesis (Figure 3b,d–h). Furthermore, a comparison of shGPR81/HIIT mice to shGPR81/SED mice revealed that HIIT failed to promote mitochondrial biogenesis-associated gene and protein expression. These results indicate that HIIT promotes mitochondrial biogenesis through a GPR81-dependent mechanism.

3.4. Knockdown of Hippocampal GPR81 Impairs HIIT-Induced Expression of Genes and Proteins Related to Mitochondrial Fusion

Mitochondrial fusion benefits energy transmission in metabolically active cells [34]. In the present study, the expression of mitochondrial-fusion-related genes and proteins was increased after HIIT (Figure 4). When comparing the shGPR81/SED mice to the shNC/SED mice, the knockdown of GPR81 led to a lower expression of genes and proteins associated with mitochondrial fusion. Furthermore, a comparison of shGPR81/HIIT mice to shGPR81/SED mice revealed that HIIT failed to promote mitochondrial fusion-associated gene and protein expression. These results indicate that GPR81 can regulate HIIT-induced hippocampal mitochondrial fusion.

3.5. Knockdown of Hippocampal GPR81 Impairs HIIT-Induced Expression of Proteins Related to Synaptic Plasticity

Mitochondria support synaptic transmission through the production of ATP, so we further measured the expression of proteins related to synaptic plasticity. Compared with shNC/SED, HIIT increased the protein expression of synaptic plasticity components, including Arc (Figure 5b), Egr1 (Figure 5d), BDNF (Figure 5e), SYN (Figure 5f), and PSD95 (Figure 5g). However, GPR81 deficiency led to a lower expression of synaptic plasticity-related proteins (Figure 5c–g). Furthermore, a comparison of shGPR81/HIIT mice to shGPR81/SED mice revealed that HIIT failed to promote synaptic plasticity-associated protein expression (Figure 5). These results demonstrate that GPR81 can mediate HIIT-induced synaptic plasticity. Given that mitochondria are critical for synaptic plasticity, we hypothesized that the HIIT-induced upregulation of synaptic plasticity may be related to the promotion of mitochondrial function, which needs further investigation.

3.6. Knockdown of Hippocampal GPR81 Inhibits HIIT-Induced ERK1/2 Phosphorylation in Mice

GPR81 promotes ERK1/2 phosphorylation, and ERK1/2 can improve mitochondrial function in many tissues and cells. Therefore, we hypothesized that ERK1/2 plays an important role in GPR81-mediated hippocampal mitochondrial function and measured ERK1/2 phosphorylation in the current study. As shown in Figure 6, HIIT increased ERK1/2 phosphorylation in the hippocampi of mice, whereas GPR81 deficiency led to a reduction in ERK1/2 phosphorylation. Therefore, we hypothesized that GPR81 can regulate ERK1/2 phosphorylation in the hippocampus, which might further enhance mitochondrial function. To test this hypothesis, in vitro studies were performed.

3.7. Inhibition of ERK1/2 Phosphorylation Impairs L-Lactate- or GPR81 Agonist-Induced Increases in MMP in Neuro-2A Cells

To explore whether ERK1/2 could mediate lactate/GPR81-regulated mitochondrial function, Neuro-2A cells were treated with L-lactate, a GPR81 agonist (3OBA), and an ERK1/2 inhibitor (SCH) in vitro. MMP is an indicator of mitochondrial function. Therefore, we investigated whether L-lactate and 3OBA could increase MMP. The results showed that both L-lactate and 3OBA treatment led to a higher MMP (Figure 7), but this effect was blocked by SCH.

3.8. Inhibition of ERK1/2 Phosphorylation Impairs L-Lactate- or GPR81 Agonist-Induced Promotion of OXPHOS and ATP Production in Neuro-2A Cells

To further investigate the effect of L-lactate and GPR81 agonists on mitochondrial function, OXPHOS gene expression and ATP levels were measured in the current study. Compared to the CON conditions, L-lactate treatment led to higher gene expression of NDUFS8 (Figure 8a) and higher ATP levels (Figure 8f). Consistent with the effect of L-lactate, the 3OBA treatment effectively upregulated the expression of genes associated with OXPHOS, including NDUFS8 (Figure 8a), SDHb (Figure 8b), Uqcrc1 (Figure 8c), and Atp5a1 (Figure 8e). In addition, ATP levels were higher in the 3OBA group than in the DMSO group (Figure 8f). However, SCH treatment abolished the effects of L-lactate and 3OBA, which inhibited OXPHOS gene expression and reduced ATP levels, suggesting that it impaired mitochondrial function. These results demonstrate that ERK1/2 mediates the effect of lactate/GPR81 on mitochondrial function in Neuro-2A cells.

3.9. Inhibition of ERK1/2 Phosphorylation Impairs L-Lactate- or GPR81 Agonist-Induced Promotion of Mitochondrial Biogenesis in Neuro-2A Cells

Compared to the CON conditions, the L-lactate treatment increased the expression of genes associated with mitochondrial biogenesis, including PGC-1α (Figure 9a) and NRF1 (Figure 9b), and upregulated the expression of proteins associated with mitochondrial biogenesis, including PGC-1α (Figure 9e), NRF1/2 (Figure 9f,g), and TFAM (Figure 9h). As expected, 3OBA led to the increased expression of genes and proteins associated with mitochondrial biogenesis, which was similar to the effects of L-lactate. Furthermore, the inhibition of ERK1/2 phosphorylation blocked the effects of L-lactate and GPR81 agonist on mitochondrial biogenesis, indicating that lactate/GPR81-regulated mitochondrial biogenesis is dependent on ERK1/2 signaling.

3.10. Inhibition of ERK1/2 Phosphorylation Impairs L-Lactate- or GPR81 Agonist-Induced Promotion of Mitochondrial Fusion in Neuro-2A Cells

Then, we measured the expression of genes and proteins related to mitochondrial fusion in Neuro-2A cells. Compared to the CON conditions, L-lactate treatment increased the expression of genes and proteins associated with mitochondrial fusion (Figure 10a,c–e). 3OBA led to the increased expression of MFN2 (Figure 10e). However, the inhibition of ERK1/2 phosphorylation blocked the effects of L-lactate and 3-OBA on mitochondrial fusion.

3.11. Inhibition of ERK1/2 Phosphorylation Impairs L-Lactate- or GPR81 Agonist-Induced Promotion of Synaptic Plasticity in Neuro-2A Cells

Given that mitochondria play an important role in synaptic plasticity, we next investigated whether lactate/GPR81-mediated synaptic plasticity is dependent on ERK1/2. As expected, both L-lactate and the GPR81 agonist increased the protein expression of synaptic plasticity markers, including Arc (Figure 11b), c-Fos (Figure 11c), Egr1 (Figure 11d), BDNF (Figure 11e), SYN (Figure 11f), and PSD95 (Figure 11g). However, the inhibition of ERK1/2 phosphorylation blocked the effects of L-lactate and the GPR81 agonist on the expression of synaptic plasticity proteins. Together, these results indicate that lactate/GPR81 can mediate synaptic plasticity through ERK1/2 signaling. The lactate-/GPR81-mediated promotion of mitochondrial function may contribute to synaptic plasticity.

4. Discussion

The present study demonstrated that hippocampal GPR81 deficiency impaired mitochondrial biogenesis, fusion, OXPHOS, synaptic plasticity and ERK1/2 phosphorylation induced by HIIT. In addition, both L-lactate and a GPR81 agonist enhanced mitochondrial biogenesis, fusion, ATP production, OXPHOS, and synaptic plasticity in Neuro-2A cells, while these effects were blocked by the inhibition of ERK1/2 phosphorylation. Collectively, these findings provide evidence that HIIT can promote mitochondrial function and synaptic plasticity in the hippocampus via the lactate/GPR81-ERK1/2 pathway (Figure 12).
Mitochondria are essential for calcium homeostasis and ATP production in the brain, processes that are vital for neuronal integrity and synaptic transmission [4,34,35]. Previous studies have shown that aerobic exercise can increase mitochondrial biogenesis, fusion, and mitochondrial function in the brain, which might further promote synaptic plasticity [36,37,38,39]. Recently, HIIT has been shown to be as effective as aerobic exercise in improving mitochondrial function. A single bout of high-intensity exercise can increase hippocampal PGC-1α mRNA levels and mitochondrial DNA (mtDNA) copy numbers [40]. In addition, one week of HIIT has been shown to increase mitochondrial content and neuroplasticity in the hippocampus of mice [5], but the underlying mechanisms remain unclear. Consistent with previous research, the current study showed that six week of HIIT increased the mitochondrial number, OXPHOS gene expression, ATP levels, mitochondrial biogenesis, mitochondrial fusion, and synaptic plasticity in the hippocampi of mice. Our previous work has shown that HIIT induces elevations in blood lactate and hippocampal lactate levels as well as mitochondrial biogenesis and fusion in the hippocampi of mice [14], which indicates that lactate is a potential participant in the HIIT-induced promotion of hippocampal mitochondrial function.
Lactate is a natural ligand of GPR81 [22], and GPR81 has been discovered to participate in regulating several metabolic processes, such as inflammation [41,42,43,44], fatty acid utilization [22,45,46,47], oblast differentiation [26], and tumor growth [24,48]. In addition, lactate/GPR81 has been demonstrated to enhance mitochondrial function in several cells, such as Müller cells [49], C2C12 cells [20], and cancer cells [50]. Moreover, a previous study has shown that GPR81 deficiency reduces mitochondrial activity and inhibits tumor cell survival [50], indicating that GPR81 is crucial for mitochondrial function. Moreover, GPR81 has been found to regulate several signaling pathways. For example, lactate/GPR81 may induce triglyceride accumulation and enhance mitochondrial function in C2C12 cells through the inhibition of the cAMP/PKA pathway [20]. Lactate increases tumor malignancy by promoting tumor small extracellular vesicle production via the GPR81/cAMP/PKA/HIF-1α axis [24]. Furthermore, the lactate/GPR81/HIF1α pathway can mediate hypoxia-induced idiopathic pulmonary fibrosis [51]. Additionally, recent works have illustrated that lactate can activate GPR81/PLC/PKC/Akt signaling during the osteoblast differentiation process [26]. Collectively, the evidence indicates that lactate/GPR81 can regulate metabolic processes and signaling pathways in different peripheral tissues and cells. Further studies should elucidate the effects of lactate/GPR81 in the brain.
In the brain, lactate/GPR81 plays important roles in energy metabolism [52], synaptic function [53], angiogenesis [54], neurogenesis, microglial activation [55], and neuronal network activity [56]. It has been shown that aerobic exercise can promote synaptic growth and prevent synaptic loss in Alzheimer’s disease, which may be related to the regulation of the GPR81/cAMP/PKA signaling pathway [25]. Previous research has also found that HIIT or lactate injection increases neurogenesis in wild-type mice but not in GPR81-knockout mice [19]. In addition, HIIT and lactate subcutaneous injection can increase blood lactate levels, brain VEGFA protein expression, and capillary density in wild-type mice but not in GPR81-knockout mice [16]. These findings suggest that lactate/GPR81 can mediate the beneficial cerebral effects of HIIT. Moreover, L-lactate administration can induce the expression of key regulators of mitochondrial biogenesis and antioxidant defense in the hippocampi of rats [57], indicating that lactate/GPR81 might regulate hippocampal mitochondrial function. Hence, in the current study, we specifically knocked down hippocampal GPR81 to identify the roles of GPR81 in the HIIT-induced promotion of mitochondrial function. We observed that hippocampal GPR81 deficiency impaired HIIT-induced mitochondrial biogenesis, fusion, OXPHOS, and synaptic plasticity, which provides compelling evidence that the HIIT-induced improvement of mitochondrial function in mice is dependent on GPR81.
As part of the downstream signal of GPR81, ERK1/2 activated by GPR81 is involved in regulating many critical metabolic processes. For example, lactate increases myotube diameter via the GRP81/MEK1/2-ERK1/2 pathway in C2C12 cells [28]. Consistent with this, GPR81 may positively affect skeletal muscle mass through the activation of the ERK1/2 pathway [27]. Most importantly, ERK1/2 can increase PGC-1α protein expression in cultured white adipocytes [58]. Additionally, a previous study has shown that the blockade of ERK1/2 phosphorylation abolishes L-lactate-induced plasticity-related gene expression in neurons [59]. Moreover, high-intensity exercise can promote cerebral angiogenesis by activating GPR81 and the ERK1/2-PI3K/Akt signaling pathways [29]. In the present study, we found that HIIT-induced mitochondrial biogenesis and fusion paralleled the increase in hippocampal ERK1/2 phosphorylation. Given the importance of ERK1/2 for mitochondrial function [30,31,32,33], we propose that many of the observed effects of lactate/GPR81-regulated hippocampal mitochondrial benefits may be related to ERK1/2 signaling.
To explore whether ERK1/2 is involved in lactate/GPR81-regulated mitochondrial function, in vitro studies were performed. A previous study has shown that lactate activates the mitochondrial electron transport chain (ETC) to increase mitochondrial ATP production and increase the cellular oxygen consumption rate (OCR) in HepG2 cells [60]. Consistent with this, our results showed that both L-lactate and a GPR81 agonist increased OXPHOS, ATP levels, and MMP in Neuro-2A cells. However, these effects were impaired by the inhibition of ERK1/2 phosphorylation. Therefore, lactate/GPR81-ERK1/2 can regulate the promotion of mitochondrial function in Neuro-2A cells. Furthermore, the change in the ATP/AMP ratio should be analyzed in the cellular model to verify the energetic cellular status in the future. Given that the promotion of mitochondrial function may contribute to synaptic plasticity, we further assessed the expression of proteins related to synaptic plasticity, which was increased in L-lactate- and GPR81 agonist-treated Neuro-2A cells. Therefore, lactate-/GPR81-mediated synaptic plasticity may be associated with the promotion of mitochondrial function in Neuro-2A cells, which needs further investigation.

5. Conclusions

This study demonstrates that hippocampal GPR81 deficiency impairs HIIT-induced mitochondrial biogenesis and fusion and ERK1/2 phosphorylation in the hippocampi of mice. In addition, the inhibition of ERK1/2 phosphorylation blocks the effects of L-lactate and a GPR81 agonist on mitochondrial function in Neuro-2A cells. This is the first study to show that HIIT can promote mitochondrial function and synaptic plasticity in the hippocampi of mice via the lactate/GPR81-ERK1/2 pathway. Our work reveals that the promotion of mitochondrial function contributes to synaptic plasticity, which merits further investigation.

Author Contributions

Conceptualization, Q.S. and S.L.; methodology, Q.S. and S.L.; formal analysis, Q.S. and S.L.; investigation, Q.S., X.B., L.Z., J.L., M.W., and S.L.; resources, S.L.; data curation, Q.S. and S.L.; writing—original draft preparation, Q.S. and S.L.; writing—review and editing, Q.S. and S.L.; visualization, S.L.; supervision, S.L.; project administration, S.L.; funding acquisition, S.L. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Natural Science Foundation of China, grant 31971098, and the Shanghai Key Lab of Human Performance (Shanghai University of sport), grant 11DZ2261100.

Institutional Review Board Statement

The animal study protocol was approved by the Institutional Animal Ethics Committee (IAEC) and approved by the Scientific Research Ethics Committee of Shanghai University of Sport (protocol code 102772019DW010).

Informed Consent Statement

Not applicable.

Data Availability Statement

All the data and materials are available.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Harris, J.J.; Jolivet, R.; Attwell, D. Synaptic energy use and supply. Neuron 2012, 75, 762–777. [Google Scholar] [CrossRef] [PubMed]
  2. Chen, F.; Wegener, G.; Madsen, T.M.; Nyengaard, J.R. Mitochondrial plasticity of the hippocampus in a genetic rat model of depression after antidepressant treatment. Synapse 2013, 67, 127–134. [Google Scholar] [CrossRef] [PubMed]
  3. Shields, L.Y.; Kim, H.; Zhu, L.; Haddad, D.; Berthet, A.; Pathak, D.; Lam, M.; Ponnusamy, R.; Diaz-Ramirez, L.G.; Gill, T.M.; et al. Dynamin-related protein 1 is required for normal mitochondrial bioenergetic and synaptic function in CA1 hippocampal neurons. Cell Death Dis. 2015, 6, e1725. [Google Scholar] [CrossRef] [PubMed]
  4. Mattson, M.P.; Gleichmann, M.; Cheng, A. Mitochondria in neuroplasticity and neurological disorders. Neuron 2008, 60, 748–766. [Google Scholar] [CrossRef] [PubMed]
  5. Dos Santos, J.R.; Bortolanza, M.; Ferrari, G.D.; Lanfredi, G.P.; do Nascimento, G.C.; Azzolini, A.; Del Bel, E.; de Campos, A.C.; Faca, V.M.; Vulczak, A.; et al. One-Week High-Intensity Interval Training Increases Hippocampal Plasticity and Mitochondrial Content without Changes in Redox State. Antioxidants 2020, 9, 445. [Google Scholar] [CrossRef] [PubMed]
  6. Li, F.H.; Li, T.; Ai, J.Y.; Sun, L.; Min, Z.; Duan, R.; Zhu, L.; Liu, Y.Y.; Liu, T.C. Beneficial Autophagic Activities, Mitochondrial Function, and Metabolic Phenotype Adaptations Promoted by High-Intensity Interval Training in a Rat Model. Front. Physiol. 2018, 9, 571. [Google Scholar] [CrossRef] [PubMed]
  7. Li, B.; Liang, F.; Ding, X.; Yan, Q.; Zhao, Y.; Zhang, X.; Bai, Y.; Huang, T.; Xu, B. Interval and continuous exercise overcome memory deficits related to beta-Amyloid accumulation through modulating mitochondrial dynamics. Behav. Brain Res. 2019, 376, 112171. [Google Scholar] [CrossRef]
  8. Schon, E.A.; Przedborski, S. Mitochondria: The next (neurode)generation. Neuron 2011, 70, 1033–1053. [Google Scholar] [CrossRef]
  9. Diaz, F.; Moraes, C.T. Mitochondrial biogenesis and turnover. Cell Calcium 2008, 44, 24–35. [Google Scholar] [CrossRef]
  10. Zhang, Y.; Xu, H. Translational regulation of mitochondrial biogenesis. Biochem. Soc. Trans. 2016, 44, 1717–1724. [Google Scholar] [CrossRef]
  11. Wu, Z.; Puigserver, P.; Andersson, U.; Zhang, C.; Adelmant, G.; Mootha, V.; Troy, A.; Cinti, S.; Lowell, B.; Scarpulla, R.C.; et al. Mechanisms Controlling Mitochondrial Biogenesis and Respiration through the Thermogenic Coactivator PGC-1. Cell 1999, 98, 115–124. [Google Scholar] [CrossRef] [PubMed]
  12. Scarpulla, R.C. Transcriptional paradigms in mammalian mitochondrial biogenesis and function. Physiol. Rev. 2008, 88, 611–638. [Google Scholar] [CrossRef] [PubMed]
  13. Song, Z.; Ghochani, M.; McCaffery, J.M.; Frey, T.G.; Chan, D.C. Mitofusins and OPA1 mediate sequential steps in mitochondrial membrane fusion. Mol. Biol. Cell 2009, 20, 3525–3532. [Google Scholar] [CrossRef] [PubMed]
  14. Hu, J.; Cai, M.; Shang, Q.; Li, Z.; Feng, Y.; Liu, B.; Xue, X.; Lou, S. Elevated Lactate by High-Intensity Interval Training Regulates the Hippocampal BDNF Expression and the Mitochondrial Quality Control System. Front. Physiol. 2021, 12, 629914. [Google Scholar] [CrossRef] [PubMed]
  15. Quistorff, B.; Secher, N.H.; Van Lieshout, J.J. Lactate fuels the human brain during exercise. Faseb J. 2008, 22, 3443–3449. [Google Scholar] [CrossRef] [PubMed]
  16. Morland, C.; Andersson, K.A.; Haugen, O.P.; Hadzic, A.; Kleppa, L.; Gille, A.; Rinholm, J.E.; Palibrk, V.; Diget, E.H.; Kennedy, L.H.; et al. Exercise induces cerebral VEGF and angiogenesis via the lactate receptor HCAR1. Nat. Commun. 2017, 8, 15557. [Google Scholar] [CrossRef]
  17. Coxon, J.P.; Cash, R.F.H.; Hendrikse, J.J.; Rogasch, N.C.; Stavrinos, E.; Suo, C.; Yücel, M. GABA concentration in sensorimotor cortex following high-intensity exercise and relationship to lactate levels. J. Physiol. 2018, 596, 691–702. [Google Scholar] [CrossRef]
  18. El Hayek, L.; Khalifeh, M.; Zibara, V.; Abi Assaad, R.; Emmanuel, N.; Karnib, N.; El-Ghandour, R.; Nasrallah, P.; Bilen, M.; Ibrahim, P.; et al. Lactate Mediates the Effects of Exercise on Learning and Memory through SIRT1-Dependent Activation of Hippocampal Brain-Derived Neurotrophic Factor (BDNF). J. Neurosci. 2019, 39, 2369–2382. [Google Scholar] [CrossRef]
  19. Lambertus, M.; Overberg, L.T.; Andersson, K.A.; Hjelden, M.S.; Hadzic, A.; Haugen, O.P.; Storm-Mathisen, J.; Bergersen, L.H.; Geiseler, S.; Morland, C. L-lactate induces neurogenesis in the mouse ventricular-subventricular zone via the lactate receptor HCA1. Acta Physiol. 2020, 231, e13587. [Google Scholar] [CrossRef]
  20. Sun, J.; Ye, X.; Xie, M.; Ye, J. Induction of triglyceride accumulation and mitochondrial maintenance in muscle cells by lactate. Sci. Rep. 2016, 6, 33732. [Google Scholar] [CrossRef]
  21. Tauffenberger, A.; Fiumelli, H.; Almustafa, S.; Magistretti, P.J. Lactate and pyruvate promote oxidative stress resistance through hormetic ROS signaling. Cell Death Dis. 2019, 10, 653. [Google Scholar] [CrossRef] [PubMed]
  22. Cai, T.Q.; Ren, N.; Jin, L.; Cheng, K.; Kash, S.; Chen, R.; Wright, S.D.; Taggart, A.K.; Waters, M.G. Role of GPR81 in lactate-mediated reduction of adipose lipolysis. Biochem. Biophys. Res. Commun. 2008, 377, 987–991. [Google Scholar] [CrossRef] [PubMed]
  23. Liu, C.; Wu, J.; Zhu, J.; Kuei, C.; Yu, J.; Shelton, J.; Sutton, S.W.; Li, X.; Yun, S.J.; Mirzadegan, T.; et al. Lactate inhibits lipolysis in fat cells through activation of an orphan G-protein-coupled receptor, GPR81. J. Biol. Chem. 2009, 284, 2811–2822. [Google Scholar] [CrossRef] [PubMed]
  24. Luo, M.; Zhu, J.; Ren, J.; Tong, Y.; Wang, L.; Ma, S.; Wang, J. Lactate increases tumor malignancy by promoting tumor small extracellular vesicles production via the GPR81-cAMP-PKA-HIF-1alpha axis. Front. Oncol. 2022, 12, 1036543. [Google Scholar] [CrossRef] [PubMed]
  25. Yang, J.; Yuan, S.; Jian, Y.; Lei, Y.; Hu, Z.; Yang, Q.; Yan, X.; Zheng, L.; Li, J.; Liu, W. Aerobic exercise regulates GPR81 signal pathway and mediates complement- microglia axis homeostasis on synaptic protection in the early stage of Alzheimer’s disease. Life Sci. 2023, 331, 122042. [Google Scholar] [CrossRef] [PubMed]
  26. Wu, Y.; Wang, M.; Zhang, K.; Li, Y.; Xu, M.; Tang, S.; Qu, X.; Li, C. Lactate enhanced the effect of parathyroid hormone on osteoblast differentiation via GPR81-PKC-Akt signaling. Biochem. Biophys. Res. Commun. 2018, 503, 737–743. [Google Scholar] [CrossRef]
  27. Ohno, Y.; Nakatani, M.; Ito, T.; Matsui, Y.; Ando, K.; Suda, Y.; Ohashi, K.; Yokoyama, S.; Goto, K. Activation of Lactate Receptor Positively Regulates Skeletal Muscle Mass in Mice. Physiol. Res. 2023, 72, 465–473. [Google Scholar] [CrossRef]
  28. Ohno, Y.; Oyama, A.; Kaneko, H.; Egawa, T.; Yokoyama, S.; Sugiura, T.; Ohira, Y.; Yoshioka, T.; Goto, K. Lactate increases myotube diameter via activation of MEK/ERK pathway in C2C12 cells. Acta Physiol. 2018, 223, e13042. [Google Scholar] [CrossRef]
  29. Zhang, S.; Wu, F.; Zhan, L.; Lin, W.; Liang, C.; Pang, Y.; Zhang, J.; Mu, Z. Exercise Regulates the Lactate Receptor HCAR1 and ERK1/2-PI3K/Akt Pathways to Promote Cerebral Angiogenesis. Iran. J. Public Health 2022, 51, 2298–2307. [Google Scholar] [CrossRef]
  30. Sun, W.; Liu, M.; Li, Y.; Hu, X.; Chen, G.; Zhang, F. Xanthorrhizol inhibits mitochondrial damage, oxidative stress and inflammation in LPS-induced MLE-12 cells by regulating MAPK pathway. Tissue Cell 2023, 84, 102170. [Google Scholar] [CrossRef]
  31. Liu, J.; Xu, Y.; Wu, Q.; Ding, Q.; Fan, W. Sirtuin-1 protects hair follicle stem cells from TNFalpha-mediated inflammatory stress via activating the MAPK-ERK-Mfn2 pathway. Life Sci. 2018, 212, 213–224. [Google Scholar] [CrossRef]
  32. Wang, Q.; Xu, J.; Li, X.; Liu, Z.; Han, Y.; Xu, X.; Li, X.; Tang, Y.; Liu, Y.; Yu, T.; et al. Sirt3 modulate renal ischemia-reperfusion injury through enhancing mitochondrial fusion and activating the ERK-OPA1 signaling pathway. J. Cell Physiol. 2019, 234, 23495–23506. [Google Scholar] [CrossRef]
  33. Dong, L.; Lin, T.; Li, W.; Hong, Y.; Ren, X.; Ke, Y.; Zhang, X.; Li, X. Antioxidative effects of polypyrimidine tract-binding protein-associated splicing factor against pathological retinal angiogenesis through promotion of mitochondrial function. J. Mol. Med. 2021, 99, 967–980. [Google Scholar] [CrossRef] [PubMed]
  34. Subramanian, S.; Jonas, E.A. Mitochondria: Powerhouses of presynaptic plasticity. J. Physiol. 2021, 599, 1363–1364. [Google Scholar] [CrossRef] [PubMed]
  35. Li, S.; Xiong, G.J.; Huang, N.; Sheng, Z.H. The cross-talk of energy sensing and mitochondrial anchoring sustains synaptic efficacy by maintaining presynaptic metabolism. Nat. Metab. 2020, 2, 1077–1095. [Google Scholar] [CrossRef] [PubMed]
  36. Khodagholi, F.; Zareh Shahamati, S.; Maleki Chamgordani, M.; Mousavi, M.A.; Moslemi, M.; Salehpour, M.; Rafiei, S.; Foolad, F. Interval aerobic training improves bioenergetics state and mitochondrial dynamics of different brain regions in restraint stressed rats. Mol. Biol. Rep. 2021, 48, 2071–2082. [Google Scholar] [CrossRef] [PubMed]
  37. Park, S.S.; Park, H.S.; Kim, C.J.; Baek, S.S.; Kim, T.W. Exercise attenuates maternal separation-induced mood disorder-like behaviors by enhancing mitochondrial functions and neuroplasticity in the dorsal raphe. Behav. Brain Res. 2019, 372, 112049. [Google Scholar] [CrossRef] [PubMed]
  38. Seo, J.H.; Park, H.S.; Park, S.S.; Kim, C.J.; Kim, D.H.; Kim, T.W. Physical exercise ameliorates psychiatric disorders and cognitive dysfunctions by hippocampal mitochondrial function and neuroplasticity in post-traumatic stress disorder. Exp. Neurol. 2019, 322, 113043. [Google Scholar] [CrossRef] [PubMed]
  39. Zhao, N.; Yan, Q.W.; Xia, J.; Zhang, X.L.; Li, B.X.; Yin, L.Y.; Xu, B. Treadmill Exercise Attenuates Abeta-Induced Mitochondrial Dysfunction and Enhances Mitophagy Activity in APP/PS1 Transgenic Mice. Neurochem. Res. 2020, 45, 1202–1214. [Google Scholar] [CrossRef]
  40. Park, J.; Kim, J.; Mikami, T. Exercise-Induced Lactate Release Mediates Mitochondrial Biogenesis in the Hippocampus of Mice via Monocarboxylate Transporters. Front. Physiol. 2021, 12, 736905. [Google Scholar] [CrossRef]
  41. Sun, Z.; Han, Y.; Song, S.; Chen, T.; Han, Y.; Liu, Y. Activation of GPR81 by lactate inhibits oscillatory shear stress-induced endothelial inflammation by activating the expression of KLF2. IUBMB Life 2019, 71, 2010–2019. [Google Scholar] [CrossRef] [PubMed]
  42. Errea, A.; Cayet, D.; Marchetti, P.; Tang, C.; Kluza, J.; Offermanns, S.; Sirard, J.C.; Rumbo, M. Lactate Inhibits the Pro-Inflammatory Response and Metabolic Reprogramming in Murine Macrophages in a GPR81-Independent Manner. PLoS ONE 2016, 11, e0163694. [Google Scholar] [CrossRef]
  43. Hoque, R.; Farooq, A.; Ghani, A.; Gorelick, F.; Mehal, W.Z. Lactate reduces liver and pancreatic injury in Toll-like receptor- and inflammasome-mediated inflammation via GPR81-mediated suppression of innate immunity. Gastroenterology 2014, 146, 1763–1774. [Google Scholar] [CrossRef] [PubMed]
  44. Yang, K.; Xu, J.; Fan, M.; Tu, F.; Wang, X.; Ha, T.; Williams, D.L.; Li, C. Lactate Suppresses Macrophage Pro-Inflammatory Response to LPS Stimulation by Inhibition of YAP and NF-kappaB Activation via GPR81-Mediated Signaling. Front. Immunol. 2020, 11, 587913. [Google Scholar] [CrossRef] [PubMed]
  45. Rooney, K.; Trayhurn, P. Lactate and the GPR81 receptor in metabolic regulation: Implications for adipose tissue function and fatty acid utilisation by muscle during exercise. Br. J. Nutr. 2011, 106, 1310–1316. [Google Scholar] [CrossRef] [PubMed]
  46. Ahmed, K.; Tunaru, S.; Tang, C.; Muller, M.; Gille, A.; Sassmann, A.; Hanson, J.; Offermanns, S. An autocrine lactate loop mediates insulin-dependent inhibition of lipolysis through GPR81. Cell Metab. 2010, 11, 311–319. [Google Scholar] [CrossRef] [PubMed]
  47. Wu, G.; Dai, Y.; Yan, Y.; Zheng, X.; Zhang, H.; Li, H.; Chen, W. The lactate receptor GPR81 mediates hepatic lipid metabolism and the therapeutic effect of metformin on experimental NAFLDs. Eur. J. Pharmacol. 2022, 924, 174959. [Google Scholar] [CrossRef]
  48. Longhitano, L.; Vicario, N.; Tibullo, D.; Giallongo, C.; Broggi, G.; Caltabiano, R.; Barbagallo, G.M.V.; Altieri, R.; Baghini, M.; Di Rosa, M.; et al. Lactate Induces the Expressions of MCT1 and HCAR1 to Promote Tumor Growth and Progression in Glioblastoma. Front. Oncol. 2022, 12, 871798. [Google Scholar] [CrossRef]
  49. Vohra, R.; Aldana, B.I.; Waagepetersen, H.; Bergersen, L.H.; Kolko, M. Dual Properties of Lactate in Müller Cells: The Effect of GPR81 Activation. Investig. Ophthalmol. Vis. Sci. 2019, 60, 999–1008. [Google Scholar] [CrossRef]
  50. Roland, C.L.; Arumugam, T.; Deng, D.; Liu, S.H.; Philip, B.; Gomez, S.; Burns, W.R.; Ramachandran, V.; Wang, H.; Cruz-Monserrate, Z.; et al. Cell surface lactate receptor GPR81 is crucial for cancer cell survival. Cancer Res. 2014, 74, 5301–5310. [Google Scholar] [CrossRef]
  51. Yang, L.; Gilbertsen, A.; Xia, H.; Benyumov, A.; Smith, K.; Herrera, J.; Racila, E.; Bitterman, P.B.; Henke, C.A. Hypoxia enhances IPF mesenchymal progenitor cell fibrogenicity via the lactate/GPR81/HIF1alpha pathway. JCI Insight 2023, 8, e163820. [Google Scholar] [CrossRef] [PubMed]
  52. Vardjan, N.; Chowdhury, H.H.; Horvat, A.; Velebit, J.; Malnar, M.; Muhic, M.; Kreft, M.; Krivec, S.G.; Bobnar, S.T.; Mis, K.; et al. Enhancement of Astroglial Aerobic Glycolysis by Extracellular Lactate-Mediated Increase in cAMP. Front. Mol. Neurosci. 2018, 11, 148. [Google Scholar] [CrossRef] [PubMed]
  53. Zhai, X.; Li, J.; Li, L.; Sun, Y.; Zhang, X.; Xue, Y.; Lv, J.; Gao, Y.; Li, S.; Yan, W.; et al. L-lactate preconditioning promotes plasticity-related proteins expression and reduces neurological deficits by potentiating GPR81 signaling in rat traumatic brain injury model. Brain Res. 2020, 1746, 146945. [Google Scholar] [CrossRef] [PubMed]
  54. Chaudhari, P.; Madaan, A.; Rivera, J.C.; Charfi, I.; Habelrih, T.; Hou, X.; Nezhady, M.; Lodygensky, G.; Pineyro, G.; Muanza, T.; et al. Neuronal GPR81 regulates developmental brain angiogenesis and promotes brain recovery after a hypoxic ischemic insult. J. Cereb. Blood Flow Metab. 2022, 42, 1294–1308. [Google Scholar] [CrossRef] [PubMed]
  55. Kennedy, L.; Glesaaen, E.R.; Palibrk, V.; Pannone, M.; Wang, W.; Al-Jabri, A.; Suganthan, R.; Meyer, N.; Austbo, M.L.; Lin, X.; et al. Lactate receptor HCAR1 regulates neurogenesis and microglia activation after neonatal hypoxia-ischemia. eLife 2022, 11, e76451. [Google Scholar] [CrossRef]
  56. de Castro Abrantes, H.; Briquet, M.; Schmuziger, C.; Restivo, L.; Puyal, J.; Rosenberg, N.; Rocher, A.B.; Offermanns, S.; Chatton, J.Y. The Lactate Receptor HCAR1 Modulates Neuronal Network Activity through the Activation of Galpha and Gbetagamma Subunits. J. Neurosci. 2019, 39, 4422–4433. [Google Scholar] [CrossRef] [PubMed]
  57. Akter, M.; Ma, H.; Hasan, M.; Karim, A.; Zhu, X.; Zhang, L.; Li, Y. Exogenous L-lactate administration in rat hippocampus increases expression of key regulators of mitochondrial biogenesis and antioxidant defense. Front. Mol. Neurosci. 2023, 16, 1117146. [Google Scholar] [CrossRef]
  58. Mukherjee, S.; Yun, J.W. Prednisone stimulates white adipocyte browning via β3-AR/p38 MAPK/ERK signaling pathway. Life Sci. 2022, 288, 120204. [Google Scholar] [CrossRef]
  59. Yang, J.; Ruchti, E.; Petit, J.M.; Jourdain, P.; Grenningloh, G.; Allaman, I.; Magistretti, P.J. Lactate promotes plasticity gene expression by potentiating NMDA signaling in neurons. Proc. Natl. Acad. Sci. USA 2014, 111, 12228–12233. [Google Scholar] [CrossRef]
  60. Cai, X.; Ng, C.P.; Jones, O.; Fung, T.S.; Ryu, K.W.; Li, D.; Thompson, C.B. Lactate activates the mitochondrial electron transport chain independently of its metabolism. Mol. Cell 2023, 83, 3904–3920.e7. [Google Scholar] [CrossRef]
Antioxidants 12 02087 g001
Figure 1. Hippocampal GPR81 deficiency decreases the number of mitochondria. (a) Representative Western blot image and quantification of the relative protein level of GPR81 (n = 6 per group). The results were normalized to the average of all the shNC/SED samples. (b) Representative electron micrographs of mitochondria in the CA1 region of the hippocampus. Scale bar = 2 μm. The arrowheads indicate mitochondria. (c) Quantification of the number of mitochondria. The data are presented as the mean ± SD. * p < 0.05, *** p < 0.001 versus the shNC/SED group. ### p < 0.001 versus the shGPR81/SED group. ns, no significant difference.
Figure 1. Hippocampal GPR81 deficiency decreases the number of mitochondria. (a) Representative Western blot image and quantification of the relative protein level of GPR81 (n = 6 per group). The results were normalized to the average of all the shNC/SED samples. (b) Representative electron micrographs of mitochondria in the CA1 region of the hippocampus. Scale bar = 2 μm. The arrowheads indicate mitochondria. (c) Quantification of the number of mitochondria. The data are presented as the mean ± SD. * p < 0.05, *** p < 0.001 versus the shNC/SED group. ### p < 0.001 versus the shGPR81/SED group. ns, no significant difference.
Antioxidants 12 02087 g001
Antioxidants 12 02087 g002
Figure 2. Hippocampal GPR81 deficiency decreases the expression of genes associated with OXPHOS and the levels of ATP. (a–e) Quantification of the relative mRNA levels of NDUFS8, SDHb, Uqcrc1, COX5b, and Atp5a1 (n = 6 per group). (f) Relative ATP levels (n = 4 per group). The data are presented as the mean ± SD. * p < 0.05, ** p < 0.01, *** p < 0.001 versus the shNC/SED group. ### p < 0.001 versus the shGPR81/SED group. ns, no significant difference.
Figure 2. Hippocampal GPR81 deficiency decreases the expression of genes associated with OXPHOS and the levels of ATP. (a–e) Quantification of the relative mRNA levels of NDUFS8, SDHb, Uqcrc1, COX5b, and Atp5a1 (n = 6 per group). (f) Relative ATP levels (n = 4 per group). The data are presented as the mean ± SD. * p < 0.05, ** p < 0.01, *** p < 0.001 versus the shNC/SED group. ### p < 0.001 versus the shGPR81/SED group. ns, no significant difference.
Antioxidants 12 02087 g002
Antioxidants 12 02087 g003
Figure 3. Hippocampal GPR81 deficiency impairs the expression of genes and proteins associated with mitochondrial biogenesis. (a–c) Quantification of the relative mRNA levels of PGC-1α, NRF1, and TFAM (n = 6 per group). (d) Representative Western blot image. (e–h) Quantification of the relative protein levels of PGC-1α, NRF1, NRF2, and TFAM (n = 6 per group). The data are presented as the mean ± SD. * p < 0.05, ** p < 0.01, *** p < 0.001 versus the shNC/SED group. # p < 0.05 versus the shGPR81/SED group. ns, no significant difference.
Figure 3. Hippocampal GPR81 deficiency impairs the expression of genes and proteins associated with mitochondrial biogenesis. (a–c) Quantification of the relative mRNA levels of PGC-1α, NRF1, and TFAM (n = 6 per group). (d) Representative Western blot image. (e–h) Quantification of the relative protein levels of PGC-1α, NRF1, NRF2, and TFAM (n = 6 per group). The data are presented as the mean ± SD. * p < 0.05, ** p < 0.01, *** p < 0.001 versus the shNC/SED group. # p < 0.05 versus the shGPR81/SED group. ns, no significant difference.
Antioxidants 12 02087 g003
Antioxidants 12 02087 g004
Figure 4. Hippocampal GPR81 deficiency impairs the expression of genes and proteins associated with mitochondrial fusion. (a,b) Quantification of the relative mRNA levels of OPA1 and MFN2 (n = 6 per group). (c) Representative Western blot image. (d–f) Quantification of the relative protein levels of OPA1, MFN1, and MFN2 (n = 6 per group). The data are presented as the mean ± SD (n = 6 per group). * p < 0.05, ** p < 0.01, *** p < 0.001 versus the shNC/SED group. ns, no significant difference.
Figure 4. Hippocampal GPR81 deficiency impairs the expression of genes and proteins associated with mitochondrial fusion. (a,b) Quantification of the relative mRNA levels of OPA1 and MFN2 (n = 6 per group). (c) Representative Western blot image. (d–f) Quantification of the relative protein levels of OPA1, MFN1, and MFN2 (n = 6 per group). The data are presented as the mean ± SD (n = 6 per group). * p < 0.05, ** p < 0.01, *** p < 0.001 versus the shNC/SED group. ns, no significant difference.
Antioxidants 12 02087 g004
Antioxidants 12 02087 g005
Figure 5. Hippocampal GPR81 deficiency impairs the expression of proteins associated with synaptic plasticity. (a) Representative Western blot image. (b–g) Quantification of the relative protein levels of Arc, c-Fos, Egr1, BDNF, SYN, and PSD95 (n = 6 per group). The data are presented as the mean ± SD. * p < 0.05, ** p < 0.01, *** p < 0.001 versus the shNC/SED group. ns, no significant difference.
Figure 5. Hippocampal GPR81 deficiency impairs the expression of proteins associated with synaptic plasticity. (a) Representative Western blot image. (b–g) Quantification of the relative protein levels of Arc, c-Fos, Egr1, BDNF, SYN, and PSD95 (n = 6 per group). The data are presented as the mean ± SD. * p < 0.05, ** p < 0.01, *** p < 0.001 versus the shNC/SED group. ns, no significant difference.
Antioxidants 12 02087 g005
Antioxidants 12 02087 g006
Figure 6. Hippocampal GPR81 deficiency inhibits ERK1/2 phosphorylation in mice. (a) Representative Western blot image. (b,c) Quantification of the relative protein levels of p-ERK1/2 and t-ERK1/2 (n = 6 per group). The data are presented as the mean ± SD. * p < 0.05, ** p < 0.01 versus the shNC/SED group. ns, no significant difference.
Figure 6. Hippocampal GPR81 deficiency inhibits ERK1/2 phosphorylation in mice. (a) Representative Western blot image. (b,c) Quantification of the relative protein levels of p-ERK1/2 and t-ERK1/2 (n = 6 per group). The data are presented as the mean ± SD. * p < 0.05, ** p < 0.01 versus the shNC/SED group. ns, no significant difference.
Antioxidants 12 02087 g006
Antioxidants 12 02087 g007
Figure 7. Inhibition of ERK1/2 phosphorylation impairs mitochondrial function in Neuro-2A cells. (a) Representative images of JC-1 staining. Scale bar = 100 μm. Red represents the JC-1 aggregate signal; green represents the JC-1 monomer signal. (b) Quantification of JC-1 staining (n = 3 per group). The data are presented as the mean ± SD. *** p < 0.001 versus the CON group. ### p < 0.001 versus the LA group. &&& p < 0.001 versus the DMSO group. $$ p < 0.01 versus the 3OBA group.
Figure 7. Inhibition of ERK1/2 phosphorylation impairs mitochondrial function in Neuro-2A cells. (a) Representative images of JC-1 staining. Scale bar = 100 μm. Red represents the JC-1 aggregate signal; green represents the JC-1 monomer signal. (b) Quantification of JC-1 staining (n = 3 per group). The data are presented as the mean ± SD. *** p < 0.001 versus the CON group. ### p < 0.001 versus the LA group. &&& p < 0.001 versus the DMSO group. $$ p < 0.01 versus the 3OBA group.
Antioxidants 12 02087 g007
Antioxidants 12 02087 g008
Figure 8. Inhibition of ERK1/2 phosphorylation impairs mitochondrial function in Neuro-2A cells. (a–e) Quantification of the relative mRNA levels of NDUFS8, SDHb, Uqcrc1, COX5b, and Atp5a1 (n = 3 per group). (f) Relative ATP levels (n = 3 per group). The data are presented as the mean ± SD. * p < 0.05, *** p < 0.001 versus the CON group. # p < 0.05, ## p < 0.01 versus the LA group. & p < 0.05, && p < 0.01, &&& p < 0.001 versus the DMSO group. $ p < 0.05, $$ p < 0.01, $$$ p < 0.001 versus the 3OBA group. ns, no significant difference.
Figure 8. Inhibition of ERK1/2 phosphorylation impairs mitochondrial function in Neuro-2A cells. (a–e) Quantification of the relative mRNA levels of NDUFS8, SDHb, Uqcrc1, COX5b, and Atp5a1 (n = 3 per group). (f) Relative ATP levels (n = 3 per group). The data are presented as the mean ± SD. * p < 0.05, *** p < 0.001 versus the CON group. # p < 0.05, ## p < 0.01 versus the LA group. & p < 0.05, && p < 0.01, &&& p < 0.001 versus the DMSO group. $ p < 0.05, $$ p < 0.01, $$$ p < 0.001 versus the 3OBA group. ns, no significant difference.
Antioxidants 12 02087 g008
Antioxidants 12 02087 g009
Figure 9. Inhibition of ERK1/2 phosphorylation impairs mitochondrial biogenesis in Neuro-2A cells. (a–c) Quantification of the relative mRNA levels of PGC-1α, NRF1, and TFAM (n = 3 per group). (d) Representative Western blot image. (e–h) Quantification of the relative protein levels of PGC-1α, NRF1, NRF2, and TFAM (n = 6 per group). The data are presented as the mean ± SD. * p < 0.05, *** p < 0.001 versus the CON group. # p < 0.05, ## p < 0.01, ### p < 0.001 versus the LA group. & p < 0.05, && p < 0.01, &&& p < 0.001 versus the DMSO group. $ p < 0.05, $$ p < 0.01, $$$ p < 0.001 versus the 3OBA group. ns, no significant difference.
Figure 9. Inhibition of ERK1/2 phosphorylation impairs mitochondrial biogenesis in Neuro-2A cells. (a–c) Quantification of the relative mRNA levels of PGC-1α, NRF1, and TFAM (n = 3 per group). (d) Representative Western blot image. (e–h) Quantification of the relative protein levels of PGC-1α, NRF1, NRF2, and TFAM (n = 6 per group). The data are presented as the mean ± SD. * p < 0.05, *** p < 0.001 versus the CON group. # p < 0.05, ## p < 0.01, ### p < 0.001 versus the LA group. & p < 0.05, && p < 0.01, &&& p < 0.001 versus the DMSO group. $ p < 0.05, $$ p < 0.01, $$$ p < 0.001 versus the 3OBA group. ns, no significant difference.
Antioxidants 12 02087 g009
Antioxidants 12 02087 g010
Figure 10. Inhibition of ERK1/2 phosphorylation impairs mitochondrial fusion in Neuro-2A cells. (a,b) Quantification of the relative mRNA levels of OPA1 and MFN2 (n = 3 per group). (c) Representative Western blot image. (d,e) Quantification of the relative protein levels of OPA1 and MFN2 (n = 6 per group). The data are presented as the mean ± SD. * p < 0.05, *** p < 0.001 versus the CON group. # p < 0.05, ## p < 0.01 versus the LA group. &&& p < 0.001 versus the DMSO group. $ p < 0.05 versus the 3OBA group. ns, no significant difference.
Figure 10. Inhibition of ERK1/2 phosphorylation impairs mitochondrial fusion in Neuro-2A cells. (a,b) Quantification of the relative mRNA levels of OPA1 and MFN2 (n = 3 per group). (c) Representative Western blot image. (d,e) Quantification of the relative protein levels of OPA1 and MFN2 (n = 6 per group). The data are presented as the mean ± SD. * p < 0.05, *** p < 0.001 versus the CON group. # p < 0.05, ## p < 0.01 versus the LA group. &&& p < 0.001 versus the DMSO group. $ p < 0.05 versus the 3OBA group. ns, no significant difference.
Antioxidants 12 02087 g010
Antioxidants 12 02087 g011
Figure 11. Inhibition of ERK1/2 phosphorylation impairs synaptic plasticity in Neuro-2A cells. (a) Representative Western blot image. (b–g) Quantification of the relative protein levels of Arc, c-Fos, Egr1, BDNF, SYN, and PSD95 (n = 6 per group). The data are presented as the mean ± SD. * p < 0.05, ** p < 0.01, *** p < 0.001 versus the CON group. ## p < 0.01, ### p < 0.001 versus the LA group. & p < 0.05, && p < 0.01, &&& p < 0.001 versus the DMSO group. $ p < 0.05, $$ p < 0.01, $$$ p < 0.001 versus the 3OBA group. ns, no significant difference.
Figure 11. Inhibition of ERK1/2 phosphorylation impairs synaptic plasticity in Neuro-2A cells. (a) Representative Western blot image. (b–g) Quantification of the relative protein levels of Arc, c-Fos, Egr1, BDNF, SYN, and PSD95 (n = 6 per group). The data are presented as the mean ± SD. * p < 0.05, ** p < 0.01, *** p < 0.001 versus the CON group. ## p < 0.01, ### p < 0.001 versus the LA group. & p < 0.05, && p < 0.01, &&& p < 0.001 versus the DMSO group. $ p < 0.05, $$ p < 0.01, $$$ p < 0.001 versus the 3OBA group. ns, no significant difference.
Antioxidants 12 02087 g011
Antioxidants 12 02087 g012
Figure 12. HIIT increases blood lactate levels, and lactate crosses the blood–brain barrier (BBB) into the hippocampus. Then, lactate binds the lactate receptor GPR81 and activates ERK1/2. ERK1/2 phosphorylation can promote mitochondrial biogenesis and fusion and enhance mitochondrial function, thereby increasing synaptic plasticity.
Figure 12. HIIT increases blood lactate levels, and lactate crosses the blood–brain barrier (BBB) into the hippocampus. Then, lactate binds the lactate receptor GPR81 and activates ERK1/2. ERK1/2 phosphorylation can promote mitochondrial biogenesis and fusion and enhance mitochondrial function, thereby increasing synaptic plasticity.
Antioxidants 12 02087 g012
Table 1. HIIT paradigm.
Table 1. HIIT paradigm.
WeekWarm-Up Speed
(m/min)		Warm-Up
Duration
(min)		Training
Speed
(m/min)		Stimuli
Duration
(min)		Recovery
Speed
(m/min)		Recovery
Duration
(min)		Number of BotsSession
Duration
(min)
1101022–2341021060
2101022–2341021060
3101026.5–28.5412–14.521060
4101026.5–28.5412–14.521060
5101030–33412–1521060
6101030–33412–1521060
Table 2. Sequences of the primers used in the RT-qPCR assays.
Table 2. Sequences of the primers used in the RT-qPCR assays.
GenesPrimerSequence (5′-3′)Accession Number
NDUFS8ForwardAGTGGCGGCAACGTACAAGNM_144870
ReverseTCGAAAGAGGTAACTTAGGGTCA
SDHbForwardAATTTGCCATTTACCGATGGGANM_023374
ReverseAGCATCCAACACCATAGGTCC
Uqcrc1ForwardACGCAAGTGCTACTTCGCANM_025407
ReverseCAGCGTCAATCCACACTCCC
COX5bForwardTCTAGTCCCGTCCATCAGCAACNM_009942
ReverseGCAGCCAAAACCAGATGACAGT
Atp5a1ForwardTCTCCATGCCTCTAACACTCGNM_007505
ReverseCCAGGTCAACAGACGTGTCAG
PGC-1αForwardTTCATCTGAGTATGGAGTCGCTNM_008904
ReverseGGGGGTGAAACCACTTTTGTAA
NRF1ForwardGTGGGACAGCAAGCGATTGTANM_001164230
ReverseTTGTACTTTCGCACCACATTCT
TFAMForwardCAAAGGATGATTCGGCTCAGGNM_009360
ReverseTCGACGGATGAGATCACTTCG
OPA1ForwardTGGAAAATGGTTCGAGAGTCAGNM_001199177
ReverseCATTCCGTCTCTAGGTTAAAGCG
MFN2ForwardTGACCTGAATTGTGACAAGCTGNM_133201
ReverseAGACTGACTGCCGTATCTGGT
GAPDHForwardAGGTCGGTGTGAACGGATTTGNM_008084
ReverseTGTAGACCATGTAGTTGAGGTCA
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Shang, Q.; Bian, X.; Zhu, L.; Liu, J.; Wu, M.; Lou, S. Lactate Mediates High-Intensity Interval Training—Induced Promotion of Hippocampal Mitochondrial Function through the GPR81-ERK1/2 Pathway. Antioxidants 2023, 12, 2087. https://doi.org/10.3390/antiox12122087

AMA Style

Shang Q, Bian X, Zhu L, Liu J, Wu M, Lou S. Lactate Mediates High-Intensity Interval Training—Induced Promotion of Hippocampal Mitochondrial Function through the GPR81-ERK1/2 Pathway. Antioxidants. 2023; 12(12):2087. https://doi.org/10.3390/antiox12122087

Chicago/Turabian Style

Shang, Qinghui, Xuepeng Bian, Lutao Zhu, Jun Liu, Min Wu, and Shujie Lou. 2023. "Lactate Mediates High-Intensity Interval Training—Induced Promotion of Hippocampal Mitochondrial Function through the GPR81-ERK1/2 Pathway" Antioxidants 12, no. 12: 2087. https://doi.org/10.3390/antiox12122087

APA Style

Shang, Q., Bian, X., Zhu, L., Liu, J., Wu, M., & Lou, S. (2023). Lactate Mediates High-Intensity Interval Training—Induced Promotion of Hippocampal Mitochondrial Function through the GPR81-ERK1/2 Pathway. Antioxidants, 12(12), 2087. https://doi.org/10.3390/antiox12122087

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop