Next Article in Journal
Niemann-Pick Disease Type C (NPDC) by Mutation of NPC1 and NPC2: Aberrant Lysosomal Cholesterol Trafficking and Oxidative Stress
Previous Article in Journal
Physiological and Transcriptome Analysis of the Effects of Exogenous Strigolactones on Drought Responses of Pepper Seedlings
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Antioxidants
Volume 12
Issue 12
10.3390/antiox12122020
antioxidants-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Integration of Transcriptomics and Proteomics Analysis Reveals the Molecular Mechanism of Eriocheir sinensis Gills Exposed to Heat Stress

by
Chenchen Shen
1,2,
Guangpeng Feng
1,2,3,*,
Feng Zhao
1,
Xiaorong Huang
1,
Min Wang
1 and
Haihua Wang
3
1
East China Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences, Shanghai 200090, China
2
College of Fisheries and Life sciences, Shanghai Ocean University, Shanghai 200090, China
3
Jiangxi Institute for Fisheries Sciences, Poyang Lake Fisheries Research Centre of Jiangxi, Nanchang 330039, China
*
Author to whom correspondence should be addressed.
Antioxidants 2023, 12(12), 2020; https://doi.org/10.3390/antiox12122020
Submission received: 12 October 2023 / Revised: 10 November 2023 / Accepted: 17 November 2023 / Published: 21 November 2023
Browse Figures
Versions Notes

Abstract

:
Heat stress is an increasingly concerning topic under global warming. Heat stress can induce organisms to produce excess reactive oxygen species, which will lead to cell damage and destroy the antioxidant defense of aquatic animals. Chinese mitten crab, Eriocheir sinensis, is sensitive to the change in water temperature, and parent crabs are more vulnerable during the breeding stage. In the present study, the multi-omics responses of parent E. sinensis gills to heat stress (24 h) were determined via transcriptome and proteome. The integrative analysis revealed that heat shock protein 70 (HSP70) and glutathione s-transferase (GST) were significantly up-regulated at gene and protein levels after heat stress, indicating that HSP70 and the antioxidant system participated in the regulatory mechanism of heat stress to resist oxidative damage. Moreover, the “Relaxin signaling pathway” was also activated at gene and protein levels under 30 °C stress, which implied that relaxin may be essential and responsible for reducing the oxidative damage of gills caused by extreme heat stress. These findings provided an understanding of the regulation mechanism in E. sinensis under heat stress at gene and protein levels. The mining of key functional genes, proteins, and pathways can also provide a basis for the cultivation of new varieties resistant to oxidative stress.

1. Introduction

Extreme heat weather occurs frequently, and water temperature increases obviously under the influence of global warming [1]. Heat stress can elevate the production of reactive oxygen species (ROS) in aquatic animals, and excess ROS will lead to cell damage and destroy the antioxidant defense, which negatively affects the growth and development of organisms [2,3,4]. To reduce the oxidative stress caused by high temperature, various antioxidants, such as superoxide dismutase (SOD), glutathione s-transferase (GST), and glutathione peroxidase (GSH-Px), function jointly to keep redox balance [5]. Moreover, heat shock proteins (HSPs), especially HSP70, were found to counteract extreme high-temperature environment and minimize cell damage caused by high ROS levels [6,7]. Thus, antioxidants and heat shock proteins play an important role in resistance to excess ROS under heat stress. The response of animals to heat stress consists of a highly ordered series of events, mainly including the rapid changes in gene expression and the synthesis of proteins involved in environmental adaptation [8]. Due to the robustness and reliability of identifying gene expression patterns and functions, the comparative transcriptome has been widely used to analyze the molecular mechanisms in aquatic animals exposed to heat stress [9,10,11]. Additionally, proteome can comprehensively investigate the changes in proteins and signaling pathways within tissues under heat stress [12]. Therefore, the integrative analysis of the transcriptome and proteome has become a research hotspot in the response of complex molecules to heat stress [13,14,15].
Eriocheir sinensis, a representative crab in crustaceans, is a crucial economic and ecological aquatic species in China, and is also an invasive species in Europe and America [16,17]. E. sinensis belongs to an aquatic ectotherm which is sensitive to the change in water temperature, and parent crabs are more vulnerable during the reproduction period [18]. Water temperature can affect the normal behavior of E. sinensis such as predation, copulation, and spawn. Previous reports have found that the appropriate temperatures for juvenile, adult, and parent E. sinensis were 20–25 °C, 22–30 °C, and 8–11 °C, respectively [19,20,21]. Meanwhile, studies of acute heat stress have shown that high temperature can affect antioxidant activity, immune defense, and metabolic ability, leading to the disorder of free radical metabolism [22,23]. However, most studies on the heat stress of E. sinensis focused on the juvenile crabs and the physiological–biochemical level, which cannot reveal the response mechanism of high temperature on E. sinensis.
The gills, a vital organ participating in respiratory, metabolism, and stress response, are in direct contact with water and are continuously exposed to complex water environments [24,25,26]. The gills are easily damaged by environmental factors, such as salinity, ammonia nitrogen, and heavy metal [27,28,29]. Moreover, gills are often used as a target organ under heat stress for transcriptomic or proteomic studies [30,31,32]. The gills contain abundant innate immune cells and stress pathways against external stress [33,34]. Therefore, the gills are an appropriate object to study the molecular mechanism of heat stress in this study.
In order to understand the molecular mechanisms in gills’ response to the heat stress of E. sinensis, the transcriptome and proteome were collectively performed via Illumina sequencing technology and label-free quantitative proteomics technology. The genes and proteins related to antioxidation have been focused on closely. Our results can provide new insight into the regulatory events under heat stress at transcriptional and translational levels, and improve the understanding of the antioxidation mechanism of E. sinensis under heat stress.

2. Materials and Methods

2.1. Animal and Acute Heat Stress Treatment

A total of 120 parent Eriocheir sinensis (adult male-to-female ratio 1:1) were collected from the Shanghai Hubao Aquaculture Cooperatives (Baoshan District, Shanghai, China) in November 2022. The average weights of female and male crabs were 122.00 ± 12.25 g and 144.25 ± 11.32 g, respectively. To prevent mating, crabs were temporarily raised in two tanks according to sex, and gradually domesticated from 18 ± 0.5 °C (the indoor water temperature) to 10 ± 0.5 °C (the initial experimental temperature), which is an appropriate temperature for parent crabs [12], with a decrease of 1 °C/d. Then, crabs were acclimatized at 10 ± 0.5 °C for three weeks. During domestication, crabs were fed with puffed compound fodder (Changzhou Haida Biological Feed Co., Ltd., Changzhou, China) every night, and the main ingredients were fish meal, soybean meal, rapeseed meal, and so on. The quality parameters of water were monitored to maintain the temperature 10 ± 0.5 °C, pH of 7.0–7.5, and dissolved oxygen > 6 mg/L.
According to our previous research, parent crabs have a better ability to adapt to high temperature, and the gills showed slight pathological changes at 20 °C and obvious pathological changes at 30 °C. Thus, 20 °C and 30 °C were chosen as experimental temperatures. In the formal experiment, parent crabs were randomly divided into three groups: medium-temperature (MT), high-temperature (HT), and control (CT) groups. Each group contained 30 crabs (adult male-to-female ratio 1:1), and no food was provided in the formal period. The CT group was constantly cultured at 10 ± 0.5 °C. The water temperature of MT group was increased from 10 °C to 20 °C, and the water temperature of HT group was increased from 10 °C to 30 °C, altering the water temperature in the tank at a constant rate of 3 °C per 1 h (the optimum heating rate obtained by pre-experiment). A 2000 W heating rod and temperature controller (temperature control range 0–80 °C, temperature sensitivity 0.1 °C, Korea A-MI) were equipped to adjust water temperature. After reaching the target temperature, six experimental crabs (3 female crabs and 3 male crabs) in each group (MT, HT, and CT) were quickly removed at 24 h for gills dissection. The samples were pooled (sextuple repetition) and immediately flash-frozen in liquid nitrogen for further analysis.

2.2. Transcriptome Sequencing and Analysis

The total RNA was extracted using TRIzol reagent (Aidlab, Beijing, China) following the manufacturer’s procedure. The quality and integrity of total RNA were analyzed via NanoDrop 2000 spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA). The cDNA libraries construction, transcriptome sequencing, and data analysis were accomplished by using Shanghai Majorbio Bio-pharm Technology Co., Ltd. (Shanghai, China) on the Illumina NovaSeq 6000 platform. To obtain high-quality clean data, raw data were initially filtered via TransRate (http://hibberdlab.com/transrate/ (accessed on 20 December 2022)) and CD-HIT (http://weizhongli-lab.org/cd-hit/ (accessed on 20 December 2022)). The assembly integrity of transcriptome was evaluated using BUSCO (http://busco.ezlab.org (accessed on 20 December 2022)). The transcriptome de novo assembly was performed using Trinity. Then, the unigenes were matched with sequences in BLAST against the Non-redundant (NR), STRING, SWISS-PROT, Protein family (Pfam), EGGNOG, Gene ontology (GO), and the Kyoto Encyclopedia of Genes and Genome (KEGG) databases, with a cut-off E-value of 1 × 10−5. RSEM normalization (http://deweylab.biostat.wisc.edu/rsem/ (accessed on 21 December 2022)) was used to perform expression levels for mRNA by calculating fragments per kilobase of exon per million mapped fragments (FPKM). The differentially expressed genes (DEGs) were selected with a fold change ≥ 2 and p-value < 0.01 via DEGseq. GO and KEGG functional enrichment analysis were conducted using Goatools (https://github.com/tanghaibao/GOatools (accessed on 22 December 2022)) and KOBAS (http://kobas.cbi.pku.edu.cn/home.do (accessed on 22 December 2022)), respectively. The corrected p-value < 0.05 was defined as significantly enriched terms or pathways.

2.3. Proteome Sequencing and Analysis

Proteome sequencing and data analysis were accomplished via label-free quantitative proteomics technology. The proteins of gills were successively extracted and quality-controlled through bicinchoninic acid assay and sodium dodecyl sulfate polyacrylamide gel electrophoresis. Subsequently, proteins were enzymatically hydrolyzed into peptides and LC-MS/MS (liquid chromatography tandem mass spectrometry) was applied. Based on Proteome Discoverer TM Software 2.2, the proteins were identified from raw data against the NR, SWISS-PROT, Pfam, Subcell-location, GO, and KEGG databases. According to the criteria of fold change ≥ 1.2 and p-value < 0.05, the differentially expressed proteins (DEPs) were identified for MT, HT, and CT groups. All DEPs were subjected to GO and KEGG enrichment analyses.

2.4. Screening of Genes and Proteins Related to Antioxidation

The keyword screening method was used to screen antioxidase and heat shock family in all differentially expressed gene and protein databases. The antioxidase included superoxide dismutase (SOD), catalase (CAT), glutathione (GSH), glutathione peroxidase (GSH-Px), glutathione S-transferase (GST), and peroxiredoxin. The members of heat shock family mainly included heat shock proteins 70 (HSP70), heat shock proteins 60 (HSP60), and heat shock proteins 90 (HSP90).

2.5. Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR)

Eight genes, including phosphoinositide-3 kinase (PIK3CA), caspase-7 (CASP7), heat shock protein 70 (HSP70), heat shock protein 90 (HSP90), eukaryotic translation initiation factor 6 (EIF6), ATP synthase (ATPase), v-type proton ATPase (V-ATPase), and anti-lipopolysaccharide factor (ALF) were selected and analyzed via quantitative real-time polymerase chain reaction (qRT-PCR). β-actin was selected as the endogenous control gene in this study. The gene-specific primers were designed using Primer Premier 5.0 (Table 1). All genes were submitted to GenBank (SUB13970835), and accession numbers were in Table S1. The conditions of PCR amplification were set as: 95 °C for 5 min, then 35 cycles of 95 °C for 30 s, 55 °C for 30 s, and 72 °C for 1 min. The qRT-PCR analysis was performed on an Applied Biosystem 7500 real-time PCR system (Applied Biosystems, Thermo Fisher Scientific, Waltham, MA, USA) with the 2 × SYBR Green qPCR Mix (Aidlab Biotechnologies Co., Ltd., Beijing, China), while the relative levels of gene expression among the different samples were measured using the 2−ΔΔCt method [35].

3. Results

3.1. Overall Statistics for Transcriptomic and Proteomic Sequencing

The transcriptomic of gills under heat stress was carried out via Illumina paired-end sequencing technology, which generated 150,986,054 raw reads. After filtering low-quality reads, 49,537,350, 51,705,776 and 48,425,930 clean reads were obtained in the CT, MT, and HT groups with a GC content of 44.92%, 45.01%, and 49.16%, respectively. The de novo transcriptome assembly yielded 77,708 transcripts and 49,754 unigenes with an average length of 920.74 bp, an N50 of 1740 bp, and a GC content of 46.47% (Table S2). The statistical summary of gene functional annotations via BLAST analysis is shown in Table S3. The proteome of gills matched 5008 spectrogram and identified 750 proteins. After grouping, the number of confirmed proteins was 514. The relative molecular masses of the identified proteins were mostly distributed in the range of 21–61 kDa, and 24.70% of protein sequence coverage was less than 5% (Figure 1). The statistical summary of protein functional annotations via BLAST analysis is shown in Table S4.

3.2. Comparison and Enrichment Analysis of DEGs

Abundant DEGs were identified in gills transcriptome, including 5303 DEGs with 2672 up-regulated and 2631 down-regulated genes in MT vs. CT; 10,941 DEGs with 7838 up-regulated and 3103 down-regulated genes in HT vs. CT; and 8545 DEGs with 6550 up-regulated and 1995 down-regulated genes between HT vs. MT (Figure 2A–C). The number of up-regulated DEGs in HT vs. CT was 2.93 times higher than that in MT vs. CT, and more DEGs (76.65%) were significantly up-regulated in HT vs. MT, indicating that 30 °C heat stress can induce more genes in the gills of E. sinensis. Meanwhile, DEGs related to the heat shock protein family, antioxidant system, energy metabolism, and immune defense were significantly differentially expressed (Table 2). KEGG enrichment analysis indicated that 25 and 13 pathways were significantly enriched in MT vs. CT and HT vs. CT, respectively (Figure 2D,E), including nine co-enrichment KEGG pathways, such as “Complement and coagulation cascades”, “Phagosome”, and “Protein digestion and absorption” (Figure S1). Clotting factor B, clotting factor G, and prophenoloxidase-activating enzyme (PPAE) were up-regulated in the “Complement and coagulation cascades”. C-type lectin (CTL), integrin, and ras-related C3 botulinum toxin substrate 1 (RAC1) were up-regulated, but cathepsin L (CTSL) and v-type proton ATPase (V-ATPase) were down-regulated in the “Phagosome”. Notably, more DEGs were up-regulated in MT vs. CT in the “Phagosome” than HT vs. CT. The specific enrichment pathways of MT vs. CT mainly included “Fc gamma R-mediated phagocytosis”, “Regulation of actin cytoskeleton”, and “Toll and Imd signaling pathway”, and the specific enrichment pathways of HT vs. CT mainly included “Relaxin signaling pathway” and “Renin–angiotensin system” (Table 3, Figure S2). Furthermore, the top two enriched pathways in HT vs. MT were “Oxidative phosphorylation” and “Thermogenesis” (Figure 2F and Figure S3), and abundant DEGs were down-regulated, including ATPase, V-ATPase, SDH, ND, COX, CYC, and so on.

3.3. Comparison and Enrichment Analysis of DEPs

Abundant DEPs were identified in gills proteome, including 333 DEPs with 147 up-regulated and 186 down-regulated genes in MT vs. CT, 187 DEPs with 100 up-regulated and 87 down-regulated genes in HT vs. CT, and 362 DEPs with 189 up-regulated and 173 down-regulated genes in HT vs. MT (Figure 3A–C). The number of up-regulated DEPs in MT vs. CT was slightly higher than that in HT vs. CT, indicating that 20 °C stress can induce more proteins in the gills of E. sinensis. Meanwhile, DEPs related to the heat shock protein family, antioxidant system, and energy metabolism were also significantly differentially expressed (Table 4). KEGG enrichment analysis indicated that three and 13 pathways were significantly enriched in MT vs. CT and HT vs. CT, respectively (Figure 3D,E). For MT vs. CT, scavenger receptor class B-I (SR-BI) and v-ATPase were up-regulated, and the cathepsin family (CTSL, CTSA, CTSC), arylsulfatase, and β-glucuronidase were down-regulated in the “Lysosome”. MAP kinase (MAPK), talin-2, actin, and myosin regulatory light chain 2 were down-regulated in the “Platelet activation” (Figure S4). For HT vs. CT, MAPK and cathepsin family (CTSL and CTSC) were up-regulated in “Apoptosis”; MAPK and β arrestin-1 were up-regulated in “Relaxin signaling pathway”; phospholipase D delta was down-regulated in “Phospholipase D signaling pathway” (Figure S5).

3.4. Integrative Analysis of the Transcriptome and Proteome

A total of 490 proteins and genes were associated, including 76 associated differentially expressed genes and proteins (DEGs/DEPs) with 24 up-regulated co-expressed genes and proteins (co-up-DEGs-DEPs) and 20 down-regulated co-expressed genes and proteins (co-down-DEGs-DEPs) in MT vs. CT; 72 associated DEGs/DEPs with 18 co-up-DEGs-DEPs and 13 co-down-DEGs-DEPs in HT vs. CT; and 88 associated DEGs/DEPs with 32 co-up-DEGs-DEPs and 16 co-down-DEGs-DEPs in HT vs. MT (Figure 4). HSP70, GST, integrin β, chitinase 1, and pseudo-hemocyanin in MT vs. CT, and hemocyanin, ficolin-1, and retinol dehydrogenase 12 in HT vs. CT were up-regulated (Table S5). Moreover, eukaryotic translation initiation factor 6 (EIF6), spliceosome RNA helicase, and ras-related GTP binding protein 7 (Rab7) were all down-regulated in MT vs. CT and HT vs. CT.
From the 490 associated DEGs-DEPs, a total of 236 associated DEGs-DEPs were analyzed for the enrichment of the KEGG metabolic pathway (Figure 5). The “Lysosome” and “Platelet activation” were significantly enriched in MT vs. CT. In “Lysosome”, SR-BI and v-ATPase were up-regulated, and the cathepsin family (CTSL, CTSA, CTSC), arylsulfatase, and β-glucuronidase were down-regulated. In “Platelet activation”, more up-regulated DEGs were significantly enriched, including glycoprotein IIb/IIIa (GPIIb/IIIa), tyrosine-protein kinase Src (cSrc), actin, and talin-2, and then DEPs of “Platelet activation” were up-regulated in HT vs. MT, including MAPK, talin-2, myosin regulatory light chain, and actin (Figure S6). “Relaxin signaling pathway” and “Phospholipase D signaling pathway” were significantly enriched in HT vs. CT.
In order to verify the sequencing results, eight genes were selected randomly for further confirmation via qRT-PCR. The results confirmed a good consistency of the qRT-PCR and RNA-Seq data (Figure 6).

4. Discussion

4.1. The Differences of DEPs and DEGs in the Integrative Analysis

In this study, 9462 DEGs and 427 DEPs were identified at the gene and protein levels, respectively, and from them, 123 DEGs-DEPs were co-expressed. The number of DEGs was significantly higher than that of DEPs, which is a common situation in the integrative analysis of transcriptomics and proteomics [25,36]. Alli Shaik and Lundberg both found that the protein expression level mainly depends on its mRNA level when an organism is in homeostasis chronically, but the translational level will change differently from the transcriptional level if the homeostasis is broken [37,38]. Then, due to a series of complex regulatory mechanisms such as post-transcriptional modification, including phosphorylation and ubiquitylation, the genes and proteins are not expressed synchronously at the transcriptional and translational levels [39,40,41]. Moreover, some proteins may be masked by high-abundance proteins, restricting their detection, and the mRNAs could not be efficiently translated, resulting in low or null protein levels. Additionally, the normal protein synthesis will be inhibited if the individual is subjected to heat stress [42], and this may also be the cause of the low amount of protein expression. Therefore, heat stress may disrupt the cell state of gills (homeostasis) and inhibit the expression of protein. The post-transcriptional regulatory mechanisms may exist in the response to heat stress, which needs further study.

4.2. Co-Expression of HSP70 and GST at Gene and Protein Levels under Heat Stress

The co-DEG-DEPs with consistent expression patterns at the transcriptional and translational levels were further investigated, which may play a key role in response to heat stress (Figure 7). HSP70 is a member of the heat shock protein family, which can prevent protein folding, refold denatured protein, and degrade denatured protein [43]. Moreover, it has been demonstrated that HSP70 plays an important role in combating heat stress, and the highly expressed HSP70 gene can improve the heat tolerance of cells, thus inhibiting the generation of oxygen radical and the apoptosis rate induced by heat stress [6,44,45]. Previous studies have reported that HSP70 gene was significantly up-regulated in Rimicaris exoculata, Penaeus monodon, Scylla paramamosain, and Litopenaeus vannamei under heat stress (28–35 °C) [46,47,48]. In this study, HSP70 was up-regulated at both the gene and protein levels under heat stress, and the expression of HSP70 was significantly higher at 30 °C than 20 °C in this study, indicating that the highly expressed HSP70 is involved in the regulatory mechanism of heat stress, especially higher temperature. In addition to the heat shock protein family, the antioxidant system is also an important component of resistance to oxidative damage caused by heat stress [49]. Various antioxidants, including SOD, GSH-Px, and CAT, were significantly up-regulated at the gene or protein level, but only GST was co-up-regulated at two levels in this study. GST can effectively remove reactive oxygen species in time [50], thus the significant up-regulation of GST implied that the antioxidant system is activated in response to heat stress. Moreover, hemocyanin and pseudo-hemocyanin were significantly up-regulated at the gene and protein levels, which both belong to the arthropod hemocyanin superfamily [51]. The main function of hemocyanin is oxygen transport, and pseudo-hemocyanin functions as protein storage [52]. It is speculated that the hemocyanin superfamily may participate in the regulatory mechanism of gills under heat stress. Additionally, although the expression of genes and proteins related to energy metabolism and immune defense lacks a good consistency, the regulation of many energy metabolism enzymes and immune factors at the gene level still indicated that heat stress would impair energy metabolism and immune defense.

4.3. Effective Pathways Involved in Response to Heat Stress

In this study, ACE gene was up-regulated in the “Renin–angiotensin system”. ACE can catalyze the conversion of angiotensin I to angiotensin II, thus playing a role in constricting blood vessels and increasing blood pressure [53]. The up-regulation of the ACE gene can activate the renin–angiotensin system, which can increase platelet sensitivity and blood pressure, and promote thrombosis [54]. Notably, more up-regulated genes in MT vs. CT were significantly enriched in the “Platelet activation”, and more DEPs of “Platelet activation” were up-regulated in HT vs. MT, suggesting that platelet activation was enabled at both the transcriptional and translational levels with increasing temperature. Platelet activation refers to a series of reactions that occur in platelets during the early stage of hemostasis, which is also the key to thrombosis [55]. Glycoprotein IIb/IIIa (GPIIb/IIIa), a receptor-mediating platelet binding to fibrinogen, was up-regulated in MT vs. CT, which plays a key role in platelet activation [56]. GPIIb/IIIa can directly affect the downstream pathway “Complement and coagulation cascades”. The “Complement and coagulation cascades” was significantly enriched in MT vs. CT and HT vs. CT, and clotting factor B, clotting factor G, and PPAE genes were up-regulated. Clotting factors (B and G) belong to the serine protease family, and participate in the clotting system of crustaceans. When the tissue is damaged or infected by foreign pathogens, crustaceans can produce blood clots through the cascade reaction of the clotting system to prevent excessive bleeding and pathogen invasion [57]. Similarly, “Complement and coagulation cascades” was also significantly enriched, and the related genes in the gills were induced in Oncorhynchus mykiss under heat stress [58,59]. Moreover, the coagulation pathway-associated genes (coagulation factor II, fibrinogen gamma chain, and carboxypeptidase B2) were also up-regulated, and angiotensinogen was significantly up-regulated at the transcription and protein levels in O. mykiss under heat stress [60]. In general, the complement-mediated hemolysis, platelet activation, and thrombosis occur in humans under oxidative stress [61]. Therefore, acute heat stress may cause oxidative stress, which can induce gill damage, blood coagulation, and thrombosis in E. sinensis, resulting in increased blood pressure and physiological imbalance.
Two important innate immune defense pathways (“Lysosome” and “Phagosome”) were enriched. In MT vs. CT, “Lysosome” was significantly enriched at both gene and protein levels, and many cathepsin (CTSL, CTSA and CTSC) and β-glucuronidase were significantly down-regulated. Similarly, it was also found that the cathepsin family (CTSL, CTSC, CTSD), glucosylceramidase, lysosomal alphaglucosidase, and arylsulfatase B were down-regulated in Procambarus clarkii under heat stress [62]. These genes or proteins involved in the dissolution and digestion of foreign macromolecules in lysosomes were significantly down-regulated, implying that heat stress may affect the function and integrity of lysosomes [63]. Additionally, SR-BI was significantly up-regulated at both transcription and protein levels in the “Lysosome”. SR-BI participates in the macrophage migration and inflammation. After bacterial stimulation, SR-BI gene in E. sinensis, Marsupenaeus japonicus and Litopenaeus vannamei was up-regulated, indicating that SR-BI can enhance the phagocytosis of invading bacteria, thereby protecting shrimp and crabs from bacterial damage [64,65,66]. Therefore, the SR-BI gene may have the same function under heat stress. Notably, “Phagosome” was significantly enriched at the gene level under both 20 °C and 30 °C heat stress. Phagosome plays an important role in invertebrate resistance to bacterial infection [67]. In the “Phagosome”, CTL, integrin, and RAC1 were up-regulated, suggesting that the phagosome of E. sinensis was an important immune way in early response to heat stress. Meanwhile, “Fc gamma R-mediated phagocytosis” was significantly enriched at the gene level under 30 °C heat stress, also suggesting that phagocytosis plays a key immune function in response to heat stress.
Notably, most pathways related to stress were enriched in the MT group. It is speculated that this may be because a 30 °C stress severely damaged the tissue structure of gills, leading to branchial dysfunction and more missed pathways. The enriched pathways in the HT and MT groups indicated that the mechanisms of parent crabs coping with different heat stresses were discernible. Moreover, parent crabs may be more adaptable to 20 °C stress than 30 °C stress. Fortunately, based on the integrated proteomics and transcriptomic analysis, the “Relaxin signaling pathway” was significantly enriched at both the gene and protein levels under 30 °C stress (Figure 7). More DEGs were up-regulated in the “Relaxin signaling pathway”. Relaxin (RLN) is a polypeptide hormone, which can reduce the accumulation of peroxide products, inhibit oxidative damage, and improve the antioxidant capacity of endothelial cells [68,69]. RXFP1, the homologous receptor of RLN1 and RLN2 [70], and genes associated with cAMP production such as PI3K, AC, PKC, and CREB were up-regulated, promoting the generation of cAMP and thus activating gene transcription such as NOS1. Moreover, RLN2 has been proven to reduce cellular oxidative damage in hypoxic rats [71], but RLN is rarely reported in decapoda under heat stress. Therefore, although the “Relaxin signaling pathway” did not involve many DEPs at the protein level, the activation of “Relaxin signaling pathway” at the gene level still implied that RLN may play an important role in the response of E. sinensis gills to extreme heat stress.

5. Conclusions

In summary, we first performed an integrated proteomics and transcriptomic analysis of the response of E. sinensis gills to heat stress. Several candidate genes and proteins, especially HSP70 and GST with high consistency in both gene and protein levels, were involved in resisting heat stress. Moreover, functional analysis showed that the “Renin–angiotensin system”, “Platelet activation”, and “Complement and coagulation cascades” were significantly enriched, suggesting that acute heat stress may induce gill damage, blood coagulation, and thrombosis in E. sinensis, resulting in increased blood pressure and physiological imbalance. Pathways related to phagocytosis such as “Phagosome” and “Fc gamma R-mediated phagocytosis” were activated at the gene level, indicating that phagocytosis plays a key immune function in response to high temperature stress. Then, the activation of “Relaxin signaling pathway” implied that RLN may be essential and responsible for reducing the oxidative damage of gills caused by extreme heat stress. Our findings can provide novel insights into the molecular mechanism of E. sinensis under heat stress at transcriptional and translational levels. The mining of key functional genes, proteins and pathways can also provide a basis for the cultivation of new varieties resistant to oxidative stress.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/antiox12122020/s1, Table S1: The accession numbers of qRT-PCR genes in GenBank; Table S2: Statistics of de novo transcriptome assembly; Table S3: Statistical summary of gene functional annotations via BLAST analysis; Table S4: Statistical summary of protein functional annotations; Table S5: The important co-DEG-DEPs at the gene and protein levels; Figure S1: The co-enrichment KEGG pathways “Complement and coagulation cascades” in MT vs. CT (A) and HT vs. CT (B), and “Phagosome” in MT vs. CT (C) and HT vs. CT (D) in transcriptomics; Figure S2: The specific enrichment pathways of MT vs. CT in transcriptomics: “Fc gamma R-mediated phagocytosis” (A), “Regulation of actin cytoskeleton” (B), and “Toll and Imd signaling pathway” (C), and the specific enrichment pathways of HT vs. CT “Relaxin signaling pathway” (D) and “Renin–angiotensin system” (E); Figure S3: The top two enriched pathways in HT vs. MT in transcriptomics: “Oxidative phosphorylation” (A) and “Thermogenesis” (B); Figure S4: The enrichment pathways of MT vs. CT in proteomics: “Lysosome” (A) and “Platelet activation” (B); Figure S5: The enrichment pathways of MT vs. CT in proteomics: “Apoptosis” (A), “Relaxin signaling pathway” (B), and “Phospholipase D signaling pathway” (C); Figure S6: The enrichment pathways “Platelet activation” of MT vs. CT in transcriptomics (A) and HT vs. MT in proteomics (B).

Author Contributions

Conceptualization, C.S. and G.F.; methodology, C.S.; validation, C.S. and X.H.; investigation, C.S.; resources, G.F.; writing—original draft preparation, C.S. and G.F.; writing—review and editing, C.S., G.F. and F.Z.; visualization, C.S., M.W. and H.W.; supervision, G.F.; project administration, G.F.; funding acquisition, G.F. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the National Natural Science Foundation of China (General Project 31972795); the Innovative and Entrepreneurial Talents Project of Jiangxi Province (jxsq2020102109).

Institutional Review Board Statement

Eriocheir sinensis in the experiments belongs to cultured crab, which is not a rare protected species and does not involve animal welfare.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are available in the article. Further information is available upon request from the corresponding author.

Acknowledgments

We would like to express our great appreciation to the technical support from Shanghai Majorbio Bio-pharm Technology Co., Ltd. (Shanghai, China).

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Alfonso, S.; Gesto, M.; Sadoul, B. Temperature increase and its effects on fish stress physiology in the context of global warming. J. Fish Biol. 2021, 98, 1496–1508. [Google Scholar] [CrossRef]
  2. Barbarossa, V.; Bosmans, J.; Wanders, N.; King, H.; Schipper, A.M. Threats of global warming to the world’s freshwater fishes. Nat. Commun. 2021, 12, 1701. [Google Scholar] [CrossRef]
  3. Ng’onga, M.; Kalaba, F.K.; Mwitwa, J.; Nyimbiri, B. The interactive effects of rainfall, temperature and water level on fish yield in Lake Bangweulu fishery, Zambia. J. Therm. Biol. 2019, 84, 45–52. [Google Scholar] [CrossRef]
  4. Roach, T.; Neuner, G.; Kranner, I.; Buchner, O. Heat acclimation under drought stress induces antioxidant enzyme activity in the alpine plant Primula minima. Antioxidants 2023, 12, 1093. [Google Scholar] [CrossRef]
  5. Sgobba, A.; Paradiso, A.; Dipierro, S.; De Gara, L.; De Pinto, M.C. Changes in antioxidants are critical in determining cell responses to short- and long-term heat stress. Physiol. Plant. 2015, 153, 68–78. [Google Scholar] [CrossRef] [PubMed]
  6. Anirudhan, A.; Okomoda, V.T.; Iryani, M.T.M.; Andriani, Y.; Wahid, M.E.A.; Tan, M.P.; Danish-Daniel, M.; Wong, L.L.; Tengku-Muhammad, T.S.; Mok, W.J.; et al. Pandanus tectorius fruit extract promotes Hsp70 accumulation, immune-related genes expression and Vibrio parahaemolyticus tolerance in the white-leg shrimp Penaeus vannamei. Fish Shellfish Immunol. 2021, 109, 97–105. [Google Scholar] [CrossRef]
  7. Jeyachandran, S.; Chellapandian, H.; Park, K.; Kwak, I. A review on the involvement of heat shock proteins (extrinsic chaperones) in response to stress conditions in aquatic organisms. Antioxidants 2023, 12, 1444. [Google Scholar] [CrossRef] [PubMed]
  8. Staib, J.L.; Quindry, J.C.; French, J.P.; Criswell, D.S.; Powers, S.K. Increased temperature, not cardiac load, activates heat shock transcription factor 1 and heat shock protein 72 expression in the heart. Am. J. Physiol. Regul. Integr. Comp. Physiol. 2007, 292, 432–439. [Google Scholar] [CrossRef]
  9. Nitzan, T.; Kokou, F.; Doron-Faigenboim, A.; Slosman, T.; Biran, J.; Mizrahi, I.; Zak, T.; Benet, A.; Cnaani, A. Transcriptome analysis reveals common and differential response to low temperature exposure between tolerant and sensitive blue tilapia (Oreochromis aureus). Front. Genet. 2019, 10, 100. [Google Scholar] [CrossRef]
  10. Shi, W.; Hu, R.; Wang, P.; Zhao, R.; Shen, H.; Li, H.; Wang, L.; Qiao, Y.; Jiang, G.; Cheng, J.; et al. Transcriptome analysis of acute high temperature-responsive genes and pathways in Palaemon gravieri. Comp. Biochem. Physiol. Part D Genom. Proteom. 2022, 41, 100958. [Google Scholar] [CrossRef] [PubMed]
  11. Shrestha, A.M.S.; Lilagan, C.A.I.; Guiao, J.E.B.; Romana-Eguia, M.R.R.; Lagman, M.C.A. Comparative transcriptome profiling of heat stress response of the mangrove crab Scylla serrata across sites of varying climate profiles. BMC Genom. 2021, 22, 580. [Google Scholar] [CrossRef] [PubMed]
  12. Zhang, H.Y.; Lei, G.; Zhou, H.W.; He, C.; Liao, J.L.; Huang, Y.J. Quantitative iTRAQ-based proteomic analysis of rice grains to assess high night temperature stress. Proteomics 2017, 17, 1600365. [Google Scholar] [CrossRef]
  13. Becker, D.; Reydelet, Y.; Lopez, J.A.; Jackson, C.; Colbourne, J.K.; Hawat, S.; Hippler, M.; Zeis, B.; Paul, R.J. The transcriptomic and proteomic responses of Daphnia pulex to changes in temperature and food supply comprise environment-specific and clone-specific elements. BMC Genom. 2018, 19, 376. [Google Scholar] [CrossRef]
  14. Huang, L.; Peng, L.; Yan, X. Multi-omics responses of red algae Pyropia haitanensis to intertidal desiccation during low tides. Algal. Res. 2021, 58, 102376. [Google Scholar] [CrossRef]
  15. Liu, F.; Zhang, T.; He, Y.; Zhan, W.; Xie, Q.; Lou, B. Integration of transcriptome and proteome analyses reveals the regulation mechanisms of Larimichthys polyactis liver exposed to heat stress. Fish Shellfish Immunol. 2023, 135, 108704. [Google Scholar] [CrossRef]
  16. Feng, G.; Zhuang, P. Stock enhancement and genetic preservation of Chinese mitten crab (Eriocheir sinensis) in the Yangtze River estuary. In Aquaculture in China, Success Stories and Modern Trends, 2nd ed.; Gui, J., Tang, Q., Li, Z., Liu, J., De Silva, S., Eds.; John Wiley & Sons: Hoboken, NJ, USA, 2018; Volume 6, pp. 514–526. [Google Scholar]
  17. Herborg, L.M.; Rushton, S.; Clare, A.; Bentley, M.G. The invasion of the Chinese mitten crab (Eriocheir sinensis) in the United Kingdom and its comparison to continental Europe. Biol. Invasions 2005, 7, 959–968. [Google Scholar] [CrossRef]
  18. Sébert, P.; Simon, B.; Péqueux, A. Effects of hydrostatic pressure on energy metabolism and osmoregulation in crab and fish. Comp. Biochem. Physiol. Part A Physiol. 1997, 116, 281–290. [Google Scholar] [CrossRef]
  19. Chang, H.K.; Sang, G.H. The complete larval development of the mitten crab Eriocheir sinensis H. Milne Edwards, 1853 (Decapoda, Brachyura, Grapsidae) reared in the laboratory and a key to the known zoeae of the Varuninae. Crustaceana 1995, 68, 793–812. [Google Scholar] [CrossRef]
  20. Geng, Z. The Environment Adaptability and Conservation Strategy of Eriocheir sinensis in Estuarine Life Stages. Ph.D. Thesis, East China Normal University, Shanghai, China, 2018. (In Chinese). [Google Scholar]
  21. Zhang, L.S. Study on forecast of fishing season of Chinese mitten-handed crab (Eriocheir sinensis) seeds at the mouth of Yangtse River. Fish. Sci. Technol. Inf. 2002, 2, 56–60. (In Chinese) [Google Scholar]
  22. Jakubowska, M.; Normant, M. Effect of temperature on the physiology and bioenergetics of adults of the Chinese mitten crab Eriocheir sinensis: Considerations for a species invading cooler waters. Mar. Freshwater Behav. Physiol. 2011, 44, 171–183. [Google Scholar] [CrossRef]
  23. Lv, F. Effects of Environmental Factors on the Osmoregulation of Eriocheir sinensis. Master’s Thesis, Ocean University of China, Qingdao, China, 2002. (In Chinese). [Google Scholar]
  24. Burnett, L.E.; McMahon, B.R. Facilitation of CO2 excretion by carbonic anhydrase located on the surface of the basal membrane of crab gill epithelium. Resp. Physiol. 1985, 62, 348. [Google Scholar] [CrossRef]
  25. Henry, R.P.; Lucu, C.; Onken, H.; Weihrauch, D. Multiple functions of the crustacean gill: Osmotic/ionic regulation, acid-base balance, ammonia excretion, and bioaccumulation of toxic metals. Front. Physiol. 2012, 3, 431. [Google Scholar] [CrossRef] [PubMed]
  26. Huang, Y.; Wang, M.; Zhao, X.; Shi, Q. Transcriptome sequencing of the gill and barbel of Southern catfish (Silurus meridionalis) revealed immune responses and novel rhamnose-binding lectins (RBLs). Genomics 2018, 111, 222–230. [Google Scholar] [CrossRef] [PubMed]
  27. Wang, H.; Wei, H.; Tang, L.; Lu, J.; Mu, C.; Wang, C. A proteomics of gills approach to understanding salinity adaptation of Scylla paramamosain. Gene 2018, 677, 119–131. [Google Scholar] [CrossRef] [PubMed]
  28. Shen, C.; Tang, D.; Bai, Y.; Luo, Y.; Wu, L.; Zhang, Y.; Wang, Z. Comparative transcriptome analysis of the gills of Procambarus clarkii provide novel insights into the response mechanism of ammonia stress tolerance. Mol. Biol. Rep. 2021, 48, 2611–2618. [Google Scholar] [CrossRef] [PubMed]
  29. Guo, H.; Chen, T.; Liang, Z.; Fan, L.; Shen, Y.; Zhou, D. iTRAQ and PRM-based comparative proteomic profiling in gills of white shrimp Litopenaeus vannamei under copper stress. Chemosphere 2021, 263, 128270. [Google Scholar] [CrossRef]
  30. Zheng, J.; Cao, J.; Mao, Y.; Su, Y.; Wang, J. Comparative transcriptome analysis provides comprehensive insights into the heat stress response of Marsupenaeus japonicu. Aquaculture 2019, 502, 338–346. [Google Scholar] [CrossRef]
  31. Zhang, Y.; Sun, J.; Mu, H.; Li, J.; Zhang, Y.; Xu, F.; Xiang, Z.; Qian, P.; Qiu, J.; Yu, Z. Proteomic basis of stress responses in the gills of the pacific oyster Crassostrea gigas. J. Proteome Res. 2015, 14, 304–317. [Google Scholar] [CrossRef] [PubMed]
  32. Fields, P.A.; Burmester, E.M.; Cox, K.M.; Karch, K.R. Rapid proteomic responses to a near-lethal heat stress in the salt marsh mussel Geukensia demissa. J. Exp. Biol. 2016, 219, 2673–2686. [Google Scholar]
  33. Xu, Z.; Takizawa, F.; Parra, D.; Gómez, D.; Jørgensen, L.V.G.; LaPatra, S.E.; Sunyer, J.O. Mucosal immunoglobulins at respiratory surfaces mark an ancient association that predates the emergence of tetrapods. Nat. Commun. 2016, 7, 10728. [Google Scholar] [CrossRef]
  34. Wang, W.; Yang, S.P.; Wang, C.G.; Shi, L.L.; Guo, H.; Chan, S.M. Gill transcriptomes reveal involvement of cytoskeleton remodeling and immune defense in ammonia stress response in the banana shrimp Fenneropenaeus merguiensis. Fish Shellfish Immunol. 2017, 71, 319. [Google Scholar] [CrossRef]
  35. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
  36. Jiang, P.; Chen, X.; Qian, L.; Ai, T.; Xu, Q.; Xiang, W.; Hu, B.; Liu, X.; Wang, J.; Wang, C. Integrated transcriptomic and proteomic analysis of the physiological changes of the liver in domesticated Eurasian perch, Perca fluviatilis. Comp. Biochem. Physiol. Part D Genom. Proteom. 2022, 41, 100957. [Google Scholar] [CrossRef]
  37. Alli Shaik, A.; Wee, S.; Li, R.H.X.; Li, Z.; Carney, T.J.; Mathavan, S.; Gunaratne, J. Functional mapping of the zebrafish early embryo proteome and transcriptome. J. Proteome Res. 2014, 13, 5536–5550. [Google Scholar] [CrossRef]
  38. Lundberg, E.; Fagerberg, L.; Klevebring, D.; Matic, I.; Geiger, T.; Cox, J.; Älgenäs, C.; Lundeberg, J.; Mann, M.; Uhlen, M. Defining the transcriptome and proteome in three functionally different human cell lines. Mol. Syst. Biol. 2010, 6, 450. [Google Scholar] [CrossRef]
  39. Nakayama, K.I.; Nakayama, K. Ubiquitin ligases: Cell-cycle control and cancer. Nat. Rev. Cancer 2006, 6, 369–381. [Google Scholar] [CrossRef]
  40. Le Roch, K.G.; Johnson, J.R.; Florens, L.; Zhou, Y.; Santrosyan, A.; Grainger, M.; Yan, S.F.; Williamson, K.C.; Holder, A.A.; Carucci, D.J.; et al. Global analysis of transcript and protein levels across the Plasmodium falciparum life cycle. Genome Res. 2014, 14, 2308–2318. [Google Scholar] [CrossRef]
  41. Zhang, M.; Chen, Z.; Yuan, F.; Wang, B.; Chen, M. Integrative transcriptome and proteome analyses provide deep insights into the molecular mechanism of salt tolerance in Limonium bicolor. Plant Mol. Biol. 2022, 108, 127–143. [Google Scholar] [CrossRef]
  42. Ahmed, R.G. Heat stress induced histopathology and pathophysiology of the central nervous system. Int. J. Dev. Neurosci. 2005, 23, 549–557. [Google Scholar] [CrossRef] [PubMed]
  43. Li, Q.; Iryani, M.; Lv, A.; Sun, J.; Anirudhan, A.; Tan, M.P.; Danish-Daniel, M.; Wong, L.L.; Baruah, K.; Sorgeloos, P.; et al. Effects of heat shock protein 70 knockdown on the tolerance of the brine shrimp Artemia franciscana to aquaculture-related stressors: Implications for aquatic animal health and production. Aquaculture 2022, 550, 737872. [Google Scholar]
  44. Huang, W.J.; Xia, L.M.; Zhu, F.; Huang, B.; Zhou, C.; Zhu, H.F.; Wang, B.; Chen, B.; Lei, P.; Shen, G.X. Transcriptional upregulation of HSP70-2 by HIF-1 in cancer cells in response to hypoxia. Int. J. Cancer 2010, 124, 298–305. [Google Scholar] [CrossRef]
  45. Zhou, J.; Schmid, T.; Frank, R.; Brüne, B. PI3K/Akt is required for heat shock proteins to protect hypoxiainducible factor 1 α from pVHl-independent degradation. J. Biol. Chem. 2004, 279, 13506–13513. [Google Scholar] [CrossRef]
  46. Cottin, D.; Shillito, B.; Chertemps, T.; Tanguy, A.; Léger, N.; Ravaux, J. Identification of differentially expressed genes in the hydrothermal vent shrimp Rimicaris exoculata exposed to heat stress. Mar. Genom. 2010, 3, 71–78. [Google Scholar] [CrossRef]
  47. Liu, Z.M.; Zhu, X.L.; Lu, J.; Cai, W.J.; Ye, Y.P.; Lv, Y.P. Effect of high temperature stress on heat shock protein expression and antioxidant enzyme activity of two morphs of the mud crab Scylla paramamosain. Comp. Biochem. Physiol. Part A Mol. Integr. Physiol. 2018, 223, 10–17. [Google Scholar] [CrossRef]
  48. Rahi, M.L.; Mahmud, S.; Dilruba, K.J.; Sabbir, W.; Aziz, D.; Hurwood, D.A. Temperature induced changes in physiological traits and expression of selected candidate genes in black tiger shrimp (Penaeus monodon) larvae. Aquacult. Rep. 2021, 19, 100620. [Google Scholar] [CrossRef]
  49. Chen, Y.; Liu, E.; Li, C.; Pan, C.; Zhao, X.; Wang, Y.; Ling, Q. Effects of heat stress on histopathology, antioxidant enzymes, and transcriptomic profiles in gills of pikeperch Sander lucioperca. Aquaculture 2021, 534, 736277. [Google Scholar] [CrossRef]
  50. Yang, S.; Yang, X.; Li, Y.; Li, D.; Gong, Q.; Huang, X.; Wu, J.; Huang, A.; Kong, F.; Han, X.; et al. The multilevel responses of Acipenser baerii and its hybrids (A. baerii ♀ × A. schrenckii ♂) to chronic heat stress. Aquaculture 2021, 541, 736773. [Google Scholar] [CrossRef]
  51. Burmester, T. Origin and evolution of arthropod hemocyanins and related proteins. J. Comp. Physiol. B 2002, 172, 95–107. [Google Scholar] [PubMed]
  52. Burmester, T. Molecular evolution of the arthropod hemecyanin superfamily. Mol. Biol. Evol. 2001, 18, 184–195. [Google Scholar] [CrossRef] [PubMed]
  53. Shen, X.Z.; Ong, F.S.; Bernstein, E.A.; Janjulia, T.; Blackwell, W.L.B.; Shah, K.H.; Taylor, B.L.; Gonzalez-Villalobos, R.A.; Fuchs, S.; Bernstein, K.E. Nontraditional roles of angiotensin-converting enzyme. Hypertension 2012, 59, 763–768. [Google Scholar] [CrossRef] [PubMed]
  54. Leung, P.S.; Wong, T.P.; Lam, S.Y.; Chan, H.C.; Wong, P.Y.D. Testicular hormonal regulation of the renin-angiotensin system in the rat epididymis. Life Sci. 2000, 66, 1317–1324. [Google Scholar] [CrossRef] [PubMed]
  55. Chen, M.; Yan, R.; Zhou, K.; Li, X.; Zhang, Y.; Liu, C.; Jiang, M.; Ye, H.; Meng, X.; Pang, N.; et al. Akt-mediated platelet apoptosis and its therapeutic implications in immune thrombocytopenia. Proc. Natl. Acad. Sci. USA 2018, 115, 10682–10691. [Google Scholar] [CrossRef]
  56. Isenberg, W.M.; Mcever, R.P.; Phillips, D.R.; Shuman, M.A.; Bainton, D.F. The platelet fibrinogen receptor: An immunogold-surface replica study of agonist-induced ligand binding and receptor clustering. J. Cell Biol. 1987, 104, 1655–1663. [Google Scholar] [CrossRef] [PubMed]
  57. Hyrsl, P.; Dobes, P.; Wang, Z.; Hauling, T.; Wilhelmsson, C.; Theopold, U. Clotting factors and eicosanoids protect against nematode infections. J. Innate Immun. 2010, 3, 65–70. [Google Scholar] [CrossRef]
  58. Kang, Y.; Liu, Z.; Shi, H.; Wang, J.; Huang, J.; Li, Y.; Li, J.; Wang, Y. Label-free quantification of protein expression in the rainbow trout (Oncorhynchus mykiss) in response to short-term exposure to heat stress. Comp. Biochem. Physiol. Part D Genom. Proteom. 2019, 30, 158–168. [Google Scholar] [CrossRef] [PubMed]
  59. Rebl, A.; Verleih, M.; Köbis, J.M.; Kühn, C.; Wimmers, K.; Köllner, B.; Goldammer, T. Transcriptome profiling of gill tissue in regionally bred and globally farmed rainbow trout strains reveals different strategies for coping with thermal stress. Mar. Biotechnol. 2013, 15, 445–460. [Google Scholar] [CrossRef] [PubMed]
  60. Roh, H.J.; Kim, A.; Kim, N.; Lee, Y.; Kim, D.H. Multi-omics analysis provides novel insight into immuno-physiological pathways and development of thermal resistance in rainbow trout exposed to acute thermal stress. Int. J. Mol. Sci. 2020, 21, 9198. [Google Scholar] [CrossRef]
  61. Fibach, E.; Dana, M. Oxidative stress in paroxysmal nocturnal hemoglobinuria and other conditions of complement-mediated hemolysis. Free Radic. Biol. Med. 2015, 88, 63–69. [Google Scholar] [CrossRef]
  62. Luo, L.; Huang, J.H.; Liu, D.L.; Jiang, S.G.; Zhou, F.L.; Jiang, S.; Yang, Q.B.; Li, Y.D.; Li, T.; Tan, L.Q.; et al. Transcriptome reveals the important role of metabolic imbalances, immune disorders and apoptosis in the treatment of Procambarus clarkii at super high temperature. Comp. Biochem. Physiol. Part D Genom. Proteom. 2021, 37, 100781. [Google Scholar] [CrossRef]
  63. Helip-Wooley, A.; Thoene, J.G. Sucrose-induced vacuolation results in increased expression of cholesterol biosynthesis and lysosomal genes. Exp. Cell Res. 2004, 292, 89–100. [Google Scholar] [CrossRef]
  64. Bi, W.J.; Li, D.X.; Xu, Y.H.; Xu, S.; Li, J.; Zhao, X.F.; Wang, J.X. Scavenger receptor B protects shrimp from bacteria by enhancing phagocytosis and regulating expression of antimicrobial peptides. Dev. Comp. Immunol. 2015, 51, 10–21. [Google Scholar] [CrossRef] [PubMed]
  65. Liu, T. Function of FREP and SRB-Croquemort on Immune Response in Litopenaeus vannamei. Master’s Thesis, Northwest A&F University, Xianyang, China, 2016. (In Chinese). [Google Scholar]
  66. Wu, Y.M. Phagocytosis Function Research of Class B Scavenger Receptor (EsSR-B1) in Hemocytes of Chinese Mitten Crab (Eriocheir sinensis). Master’s Thesis, East China Normal University, Shanghai, China, 2018. (In Chinese). [Google Scholar]
  67. Zhong, A.H.; Wang, Y.B.; Bi, L.F.; Xu, H.L. The transcriptomic analysis of in vitro hemocytes of blood clam (Tegillarca granosa) challenged with Vibrio alginolyticus. Oceanol. Limnol. Sin. 2023, 54, 286–295. (In Chinese) [Google Scholar]
  68. Perna, A.M.; Masini, E.; Nistri, S.; Briganti, V.; Chiappini, L.; Stefano, P.; Bigazzi, M.; Pieroni, C.; Sacchi, T.B.; Bani, D. Novel drug development opportunity for relaxin in acute myocardial infarction: Evidences from as wine model. FASEB J. 2005, 19, 1525–1527. [Google Scholar] [CrossRef]
  69. Wei, Q.; Chen, B.; Zhao, L.; Amanguli, R.; Zhao, B.; Jiang, T.; Zhang, C.; Li, Z.; Duan, M.; Gao, X. Serelaxin protects against hypoxia/reoxygenation-induced mouse cardiac microvascular endothelialcell injury by inhibiting oxidative stress responses. Chin. J. Tissue Eng. Res. 2023, 27, 3621–3627. (In Chinese) [Google Scholar]
  70. Bathgate, R.A.D.; Halls, M.L.; van der Westhuizen, E.T.; Callander, G.E.; Kocan, M.; Summers, R.J. Relaxin family peptides and their receptors. Physiol. Rev. 2013, 93, 405. [Google Scholar] [CrossRef] [PubMed]
  71. Nistri, S.; Fiorillo, C.; Becatti, M.; Dani, D. Human relaxin-2 (serelaxin) attenuates oxidative stress in cardiac muscle cells exposed in vitro to hypoxia-reoxygenation. Evidence for the involvement of reduced glutathione up-regulation. Antioxidants 2020, 9, 774. [Google Scholar] [CrossRef] [PubMed]
Antioxidants 12 02020 g001
Figure 1. Protein molecular weight distribution (A) and protein coverage distribution (B).
Figure 1. Protein molecular weight distribution (A) and protein coverage distribution (B).
Antioxidants 12 02020 g001
Antioxidants 12 02020 g002
Figure 2. Volcano plots for DEGs in the MT vs. CT (A), HT vs. CT (B), and HT vs. MT (C); and KEGG enrichment analysis of DEGs in the MT vs. CT (D), HT vs. CT (E), and HT vs. MT (F).
Figure 2. Volcano plots for DEGs in the MT vs. CT (A), HT vs. CT (B), and HT vs. MT (C); and KEGG enrichment analysis of DEGs in the MT vs. CT (D), HT vs. CT (E), and HT vs. MT (F).
Antioxidants 12 02020 g002
Antioxidants 12 02020 g003
Figure 3. Volcano plots for DEPs in the MT vs. CT (A), HT vs. CT (B), and HT vs. MT (C); and KEGG enrichment analysis of DEPs in the MT vs. CT (D), HT vs. CT (E), and HT vs. MT (F).
Figure 3. Volcano plots for DEPs in the MT vs. CT (A), HT vs. CT (B), and HT vs. MT (C); and KEGG enrichment analysis of DEPs in the MT vs. CT (D), HT vs. CT (E), and HT vs. MT (F).
Antioxidants 12 02020 g003
Antioxidants 12 02020 g004
Figure 4. Differentially expressed genes and proteins association analysis in the MT vs. CT (A), HT vs. CT (B), and HT vs. MT (C).
Figure 4. Differentially expressed genes and proteins association analysis in the MT vs. CT (A), HT vs. CT (B), and HT vs. MT (C).
Antioxidants 12 02020 g004
Antioxidants 12 02020 g005
Figure 5. KEGG enrichment of differentially expressed genes and proteins’ association analysis in the MT vs. CT (A) and HT vs. CT (B).
Figure 5. KEGG enrichment of differentially expressed genes and proteins’ association analysis in the MT vs. CT (A) and HT vs. CT (B).
Antioxidants 12 02020 g005
Antioxidants 12 02020 g006
Figure 6. Comparison of the expression profiles of eight genes as determined via RNA-seq and validated through qRT-PCR in the gills of Eriocheir sinensis.
Figure 6. Comparison of the expression profiles of eight genes as determined via RNA-seq and validated through qRT-PCR in the gills of Eriocheir sinensis.
Antioxidants 12 02020 g006
Antioxidants 12 02020 g007
Figure 7. The regulation mechanisms of Eriocheir sinensis gill exposed to heat stress at mRNA and protein levels.
Figure 7. The regulation mechanisms of Eriocheir sinensis gill exposed to heat stress at mRNA and protein levels.
Antioxidants 12 02020 g007
Table 1. Real-time quantitative PCR primers used in this study.
Table 1. Real-time quantitative PCR primers used in this study.
Gene NameForward Primer Sequence (5′–3′)Reverse Primer Sequence (5′–3′)
β-actinGGCATCCACGAGACCACTTCTCCTGCTTGCTGATCCACAT
PIK3CAGCTCAGCATAGGCATAATAGGAGATACGCCAAATAG
CASP7GATGCTGGAGGACAGGGATTAGCGATGGTTGAAGATG
HSP70CCAGCGTCAAGCAACCAATCAACTTCACGGCGGAGC
HSP90AGGTCGTCCGAGTCCACAGTCGCTGCTCTTCATTCC
EIF6ATCCACGACACCCTACAAGAGCCCAGTCATTCACTAACA
ATPaseCGCCCATCCTCAACTCCTCTCCACCAAACAGACCAATC
V-ATPaseCCAGAACCAGCGTTACCACTCCTCTACCCTCAGCATC
ALFTAGTAGTTCCTGGCTGTTCCCCCTCTATCGGCTGGTTCTG
Table 2. DEGs potentially associated with heat shock protein family, antioxidant system, energy metabolism, and immune defense.
Table 2. DEGs potentially associated with heat shock protein family, antioxidant system, energy metabolism, and immune defense.
Functional Group/GeneDescriptionRegulationMT vs. CTHT vs. CTHT vs. MT
Heat shock protein family
HSP 70Heat shock protein 70UpXXX
HSP 90Heat shock protein 90UpXXX
Antioxidant system
SODCopper/zinc superoxide dismutaseUpXXX
GSTGlutathione S-transferaseUpXXX
GSH-PxGlutathione peroxidase 3Up X
Energy metabolism
COXCytochrome c oxidase subunitUpX
Down XX
NDNADH dehydrogenase subunitUpX
Down XX
CYCCytochrome cDown XX
SDHSuccinate dehydrogenaseDown XX
IDHIsocitrate dehydrogenaseDown X
CSCitrate synthaseDown X
ATPaseATP synthaseDown XX
V-ATPaseV-type proton ATPaseDown XX
Immune defense
CTLLDLa domain-containing C-type lectinUpXXX
CYP450Cytochrome P450 3A11UpXXX
IAPInhibitor of apoptosis proteinUpXXX
ChitinaseChitinaseUpXXX
AREApoptosis-resistant E3 ubiquitin proteinUpXXX
CASP3Caspase 3UpXX
CASP7Caspase 7UpX
CASP10Caspase 10Up X
ALFAnti-lipopolysaccharide factorUp XX
Note: “X” represents where regulation has occurred.
Table 3. Main specific enrichment pathways and differentially expressed genes in the MT vs. CT and HT vs. CT of gills.
Table 3. Main specific enrichment pathways and differentially expressed genes in the MT vs. CT and HT vs. CT of gills.
Functional Pathway/GeneDescriptionRegulationMT vs. CTHT vs. CT
Fc gamma R-mediated phagocytosis
PTPRCReceptor-type tyrosine-protein phosphataseUpX
PIK3CAPhosphoinositide-3 kinaseUpX
RAC1Rho-related proteinUpX
ECM–receptor interaction
Integrin αIntegrin alphaUpX
Integrin βIntegrin betaUpX
Regulation of actin cytoskeleton
ActinActinUpX
Integrin αIntegrin alphaUpX
Integrin βIntegrin betaUpX
PIK3CAPhosphoinositide-3 kinaseUpX
RAC1Rho-related proteinUpX
Toll and Imd signaling pathway
DuoxDual oxidaseUpX
IAPInhibitor of apoptosis proteinUpX
Relaxin signaling pathway
RXFP1Relaxin family peptide receptor 1Up X
RXFP2Relaxin receptor 2Up X
GNAOGuanine nucleotide-binding protein G(o) subunit alpha isoform X2Up X
NOS1Nitric oxide synthaseUp X
PIK3CAPhosphoinositide-3 kinaseUp X
ACAdenylate cyclaseUp X
RelishRelishUp X
PKCProtein kinase CUp X
PLC1-Phosphatidylinositol 4,5-bisphosphate phosphodiesteraseUp X
CREBcAMP-Responsive element binding proteinUp X
VEGFVascular endothelial growth factorUp X
JUNTranscription factor AP-1Up X
PKAcAMP-Dependent protein kinase catalyticUp X
Renin–angiotensin system
NAPAminopeptidase N-likeUp X
ACEAngiotensin-converting enzymeUp X
Note: “X” represents where regulation has occurred.
Table 4. DEPs potentially associated with heat shock protein family, antioxidant system, and energy metabolism.
Table 4. DEPs potentially associated with heat shock protein family, antioxidant system, and energy metabolism.
Functional Group/GeneDescriptionRegulationMT vs. CTHT vs. CTHT vs. MT
Heat shock protein family
HSP 70Heat shock protein 70UpXXX
HSP 60Heat shock protein 60UpX
Antioxidant system
CATCatalaseUpXX
Down X
GSTGlutathione S-transferaseUpXX
Down X
Energy metabolism
COXCytochrome c oxidaseUpXXX
NDNADH dehydrogenaseUpXX
Down X
CSCitrate synthaseUp XX
DownX
ATPaseATP synthaseUp X
Note: “X” represents where regulation has occurred.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Shen, C.; Feng, G.; Zhao, F.; Huang, X.; Wang, M.; Wang, H. Integration of Transcriptomics and Proteomics Analysis Reveals the Molecular Mechanism of Eriocheir sinensis Gills Exposed to Heat Stress. Antioxidants 2023, 12, 2020. https://doi.org/10.3390/antiox12122020

AMA Style

Shen C, Feng G, Zhao F, Huang X, Wang M, Wang H. Integration of Transcriptomics and Proteomics Analysis Reveals the Molecular Mechanism of Eriocheir sinensis Gills Exposed to Heat Stress. Antioxidants. 2023; 12(12):2020. https://doi.org/10.3390/antiox12122020

Chicago/Turabian Style

Shen, Chenchen, Guangpeng Feng, Feng Zhao, Xiaorong Huang, Min Wang, and Haihua Wang. 2023. "Integration of Transcriptomics and Proteomics Analysis Reveals the Molecular Mechanism of Eriocheir sinensis Gills Exposed to Heat Stress" Antioxidants 12, no. 12: 2020. https://doi.org/10.3390/antiox12122020

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop