Eugenol Attenuates Transmissible Gastroenteritis Virus-Induced Oxidative Stress and Apoptosis Via ROS-NRF2-ARE Signaling
Abstract
1. Introduction
2. Materials and Methods
2.1. Reagents
2.2. Virus, Cell Culture, and Treatment
2.3. Experimental Design and Diet
2.4. Sample Collection
2.5. Serum Antioxidant Indexes
2.6. Western blotting and RT-PCR
2.7. Intestinal Epithelial Cell Apoptosis and ROS Level Detection
2.8. Cell Viability
2.9. Statistical Analysis
3. Results
3.1. Effects of Eugenol on Serum Antioxidant Indicators in TGEV-Infected Weaned Piglets
3.2. Effects of Eugenol on Jejunum Antioxidation-Related Genes in TGEV-Infected Weaned Piglets
3.3. Effects of Eugenol on Jejunum Antioxidation-Related Proteins in TGEV-Infected Weaned Piglets
3.4. Eugenol Decreases TGEV-Induced ROS Increase in Jejunal Epithelial Cells of Weaned Piglets
3.5. Eugenol Alleviates TGEV-Induced Jejunal Epithelial Cell Death in Piglets
3.6. TGEV Damages the Antioxidant Capacity of IPEC-J2 Cells
3.7. Effect of Eugenol on IPEC-J2 Cells Viability
3.8. Eugenol Alleviates TGEV-Induced Oxidative Stress in IPEC-J2 Cells
3.9. Eugenol Relieves Oxidative Stress by Removing ROS
3.10. Effect of Eugenol on TGEV-Induced IPEC-J2 Cells’ Death Pattern
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Singh, D.; Yi, S.V. On the origin and evolution of SARS-CoV-2. Exp. Mol. Med. 2021, 53, 537–547. [Google Scholar] [CrossRef] [PubMed]
- Song, D.; Moon, H.; Kang, B. Porcine epidemic diarrhea: A review of current epidemiology and available vaccines. Clin. Exp. Vaccine Res. 2015, 4, 166–176. [Google Scholar] [CrossRef] [PubMed]
- Liu, Q.; Wang, H.-Y. Porcine enteric coronaviruses: An updated overview of the pathogenesis, prevalence, and diagnosis. Vet. Res. Commun. 2021, 45, 75–86. [Google Scholar] [CrossRef] [PubMed]
- Wu, A.; Yu, B.; Zhang, K.; Xu, Z.; Wu, D.; He, J.; Luo, J.; Luo, Y.; Yu, J.; Zheng, P.; et al. Transmissible gastroenteritis virus targets Paneth cells to inhibit the self-renewal and differentiation of Lgr5 intestinal stem cells via Notch signaling. Cell Death Dis. 2020, 11, 40. [Google Scholar] [CrossRef] [PubMed]
- Pu, J.; Chen, D.; Tian, G.; He, J.; Huang, Z.; Zheng, P.; Mao, X.; Yu, J.; Luo, J.; Luo, Y.; et al. All-Trans Retinoic Acid Attenuates Transmissible Gastroenteritis Virus-Induced Inflammation in IPEC-J2 Cells via Suppressing the RLRs/NF-κB Signaling Pathway. Front. Immunol. 2022, 13, 734171. [Google Scholar] [CrossRef]
- Ding, L.; Li, J.; Li, W.; Fang, Z.; Li, N.; Wu, S.; Li, J.; Hong, M. p53- and ROS-mediated AIF pathway involved in TGEV-induced apoptosis. J. Vet. Med. Sci. 2018, 80, 1775–1781. [Google Scholar] [CrossRef]
- Ding, L.; Zhao, X.; Huang, Y.; Du, Q.; Dong, F.; Zhang, H.; Song, X.; Zhang, W.; Tong, D. Regulation of ROS in transmissible gastroenteritis virus-activated apoptotic signaling. Biochem. Biophys. Res. Commun. 2013, 442, 33–37. [Google Scholar] [CrossRef]
- Piechota-Polanczyk, A.; Fichna, J. Review article: The role of oxidative stress in pathogenesis and treatment of inflammatory bowel diseases. Naunyn Schmiedeberg’s Arch. Pharmacol. 2014, 387, 605–620. [Google Scholar] [CrossRef]
- Bhattacharyya, A.; Chattopadhyay, R.; Mitra, S.; Crowe, S.E. Oxidative stress: An essential factor in the pathogenesis of gastrointestinal mucosal diseases. Physiol. Rev. 2014, 94, 329–354. [Google Scholar] [CrossRef]
- Filomeni, G.; de Zio, D.; Cecconi, F. Oxidative stress and autophagy: The clash between damage and metabolic needs. Cell Death Differ. 2015, 22, 377–388. [Google Scholar] [CrossRef]
- Pan, X.; Zhou, Y.; Duan, X.; Cui, J.; Liu, J.; Song, X.; Ma, W.; Zhang, W.; Liu, Y.; Fan, Y. The inhibitory effect Polygonum Cillinerve polysaccharide on transmissible gastroenteritis virus of swine. Res. Vet. Sci. 2021, 140, 47–55. [Google Scholar] [CrossRef] [PubMed]
- Flores-Romero, H.; Ros, U.; Garcia-Saez, A.J. Pore formation in regulated cell death. EMBO J. 2020, 39, e105753. [Google Scholar] [CrossRef] [PubMed]
- Kaminskyy, V.O.; Zhivotovsky, B. Free radicals in cross talk between autophagy and apoptosis. Antioxid. Redox Signal. 2014, 21, 86–102. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.-H.; Song, T.-Z.; Zheng, H.-Y.; Li, Y.-H.; Zheng, Y.-T. Jejunal epithelial barrier disruption triggered by reactive oxygen species in early SIV infected rhesus macaques. Free Radic. Biol. Med. 2021, 177, 143–155. [Google Scholar] [CrossRef]
- Pu, J.; Chen, D.; Tian, G.; He, J.; Huang, Z.; Zheng, P.; Mao, X.; Yu, J.; Luo, J.; Luo, Y.; et al. All-Trans Retinoic Acid Attenuates Transmissible Gastroenteritis Virus-Induced Apoptosis in IPEC-J2 Cells via Inhibiting ROS-Mediated P38MAPK Signaling Pathway. Antioxidants 2022, 11, 345. [Google Scholar] [CrossRef]
- Pluskal, T.; Weng, J.-K. Natural product modulators of human sensations and mood: Molecular mechanisms and therapeutic potential. Chem. Soc. Rev. 2018, 47, 1592–1637. [Google Scholar] [CrossRef]
- Ruiz-Medina, B.E.; Lerma, D.; Hwang, M.; Ross, J.A.; Skouta, R.; Aguilera, R.J.; Kirken, R.A.; Varela-Ramirez, A.; Robles-Escajeda, E. Green barley mitigates cytotoxicity in human lymphocytes undergoing aggressive oxidative stress, via activation of both the Lyn/PI3K/Akt and MAPK/ERK pathways. Sci. Rep. 2019, 9, 6005. [Google Scholar] [CrossRef]
- Morán-Santibañez, K.; Vasquez, A.H.; Varela-Ramirez, A.; Henderson, V.; Sweeney, J.; Odero-Marah, V.; Fenelon, K.; Skouta, R. Larrea tridentata Extract Mitigates Oxidative Stress-Induced Cytotoxicity in Human Neuroblastoma SH-SY5Y Cells. Antioxidants 2019, 8, 427. [Google Scholar] [CrossRef]
- Huang, T.; Che, Q.; Chen, X.; Chen, D.; Yu, B.; He, J.; Chen, H.; Yan, H.; Zheng, P.; Luo, Y.; et al. Apple Polyphenols Improve Intestinal Antioxidant Capacity and Barrier Function by Activating the Nrf2/Keap1 Signaling Pathway in a Pig Model. J. Agric. Food Chem. 2022, 70, 7576–7585. [Google Scholar] [CrossRef]
- Hseu, Y.-C.; Vudhya Gowrisankar, Y.; Wang, L.-W.; Zhang, Y.-Z.; Chen, X.-Z.; Huang, P.-J.; Yen, H.-R.; Yang, H.-L. The in vitro and in vivo depigmenting activity of pterostilbene through induction of autophagy in melanocytes and inhibition of UVA-irradiated α-MSH in keratinocytes via Nrf2-mediated antioxidant pathways. Redox Biol. 2021, 44, 102007. [Google Scholar] [CrossRef]
- Taleuzzaman, M.; Jain, P.; Verma, R.; Iqbal, Z.; Mirza, M.A. Eugenol as a Potential Drug Candidate: A Review. Curr. Top. Med. Chem. 2021, 21, 1804–1815. [Google Scholar] [CrossRef] [PubMed]
- Barboza, J.N.; da Silva Maia Bezerra Filho, C.; Silva, R.O.; Medeiros, J.V.R.; de Sousa, D.P. An Overview on the Anti-inflammatory Potential and Antioxidant Profile of Eugenol. Oxid. Med. Cell. Longev. 2018, 2018, 3957262. [Google Scholar] [CrossRef] [PubMed]
- Chen, S.; Wu, X.; Tang, S.; Yin, J.; Song, Z.; He, X.; Yin, Y. Eugenol Alleviates Dextran Sulfate Sodium-Induced Colitis Independent of Intestinal Microbiota in Mice. J. Agric. Food Chem. 2021, 69, 10506–10514. [Google Scholar] [CrossRef] [PubMed]
- Lu, M.-C.; Ji, J.-A.; Jiang, Z.-Y.; You, Q.-D. The Keap1-Nrf2-ARE Pathway As a Potential Preventive and Therapeutic Target: An Update. Med. Res. Rev. 2016, 36, 924–963. [Google Scholar] [CrossRef]
- Abed, D.A.; Goldstein, M.; Albanyan, H.; Jin, H.; Hu, L. Discovery of direct inhibitors of Keap1-Nrf2 protein-protein interaction as potential therapeutic and preventive agents. Acta Pharm. Sin. B 2015, 5, 285–299. [Google Scholar] [CrossRef] [PubMed]
- Du, J.; Chen, D.; Yu, B.; He, J.; Yu, J.; Mao, X.; Luo, Y.; Zheng, P.; Luo, J. L-Leucine Promotes STAT1 and ISGs Expression in TGEV-Infected IPEC-J2 Cells via mTOR Activation. Front. Immunol. 2021, 12, 656573. [Google Scholar] [CrossRef]
- Robles-Escajeda, E.; Lerma, D.; Nyakeriga, A.M.; Ross, J.A.; Kirken, R.A.; Aguilera, R.J.; Varela-Ramirez, A. Searching in mother nature for anti-cancer activity: Anti-proliferative and pro-apoptotic effect elicited by green barley on leukemia/lymphoma cells. PLoS ONE 2013, 8, e73508. [Google Scholar] [CrossRef]
- Kensler, T.W.; Wakabayashi, N.; Biswal, S. Cell survival responses to environmental stresses via the Keap1-Nrf2-ARE pathway. Annu. Rev. Pharmacol. Toxicol. 2007, 47, 89–116. [Google Scholar] [CrossRef]
- G Bardallo, R.; Panisello-Roselló, A.; Sanchez-Nuno, S.; Alva, N.; Roselló-Catafau, J.; Carbonell, T. Nrf2 and oxidative stress in liver ischemia/reperfusion injury. FEBS J. 2021. [Google Scholar] [CrossRef]
- Su, L.-J.; Zhang, J.-H.; Gomez, H.; Murugan, R.; Hong, X.; Xu, D.; Jiang, F.; Peng, Z.-Y. Reactive Oxygen Species-Induced Lipid Peroxidation in Apoptosis, Autophagy, and Ferroptosis. Oxid. Med. Cell. Longev. 2019, 2019, 5080843. [Google Scholar] [CrossRef]
- Guo, Z.; Mo, Z. Keap1-Nrf2 signaling pathway in angiogenesis and vascular diseases. J. Tissue Eng. Regen. Med. 2020, 14, 869–883. [Google Scholar] [CrossRef] [PubMed]
- Zheng, S.; Deng, Z.; Chen, F.; Zheng, L.; Pan, Y.; Xing, Q.; Tsao, R.; Li, H. Synergistic antioxidant effects of petunidin and lycopene in H9c2 cells submitted to hydrogen peroxide: Role of Akt/Nrf2 pathway. J. Food Sci. 2020, 85, 1752–1763. [Google Scholar] [CrossRef] [PubMed]
- Riedl, M.A.; Saxon, A.; Diaz-Sanchez, D. Oral sulforaphane increases Phase II antioxidant enzymes in the human upper airway. Clin. Immunol. 2009, 130, 244–251. [Google Scholar] [CrossRef] [PubMed]
- Tsikas, D. Assessment of lipid peroxidation by measuring malondialdehyde (MDA) and relatives in biological samples: Analytical and biological challenges. Anal. Biochem. 2017, 524, 13–30. [Google Scholar] [CrossRef] [PubMed]
- Kang, R.; Li, R.; Dai, P.; Li, Z.; Li, Y.; Li, C. Deoxynivalenol induced apoptosis and inflammation of IPEC-J2 cells by promoting ROS production. Environ. Pollut. 2019, 251, 689–698. [Google Scholar] [CrossRef]
- Ji, P.; Huang, H.; Yuan, S.; Wang, L.; Wang, S.; Chen, Y.; Feng, N.; Veroniaina, H.; Wu, Z.; Wu, Z.; et al. ROS-Mediated Apoptosis and Anticancer Effect Achieved by Artesunate and Auxiliary Fe(II) Released from Ferriferous Oxide-Containing Recombinant Apoferritin. Adv. Healthc. Mater. 2019, 8, e1900911. [Google Scholar] [CrossRef]
- Zhao, B.; Luo, J.; Wang, Y.; Zhou, L.; Che, J.; Wang, F.; Peng, S.; Zhang, G.; Shang, P. Metformin Suppresses Self-Renewal Ability and Tumorigenicity of Osteosarcoma Stem Cells via Reactive Oxygen Species-Mediated Apoptosis and Autophagy. Oxid. Med. Cell. Longev. 2019, 2019, 9290728. [Google Scholar] [CrossRef]
- Carvalho, R.P.R.; Lima, G.D.d.A.; Machado-Neves, M. Effect of eugenol treatment in hyperglycemic murine models: A meta-analysis. Pharmacol. Res. 2021, 165, 105315. [Google Scholar] [CrossRef]
- Zhang, L.; Wang, K.; Lei, Y.; Li, Q.; Nice, E.C.; Huang, C. Redox signaling: Potential arbitrator of autophagy and apoptosis in therapeutic response. Free Radic. Biol. Med. 2015, 89, 452–465. [Google Scholar] [CrossRef]
- DeNicola, G.M.; Chen, P.-H.; Mullarky, E.; Sudderth, J.A.; Hu, Z.; Wu, D.; Tang, H.; Xie, Y.; Asara, J.M.; Huffman, K.E.; et al. NRF2 regulates serine biosynthesis in non-small cell lung cancer. Nat. Genet. 2015, 47, 1475–1481. [Google Scholar] [CrossRef] [PubMed]
- Singh, A.; Misra, V.; Thimmulappa, R.K.; Lee, H.; Ames, S.; Hoque, M.O.; Herman, J.G.; Baylin, S.B.; Sidransky, D.; Gabrielson, E.; et al. Dysfunctional KEAP1-NRF2 interaction in non-small-cell lung cancer. PLoS Med. 2006, 3, e420. [Google Scholar] [CrossRef] [PubMed]
- Erlank, H.; Elmann, A.; Kohen, R.; Kanner, J. Polyphenols activate Nrf2 in astrocytes via H2O2, semiquinones, and quinones. Free Radic. Biol. Med. 2011, 51, 2319–2327. [Google Scholar] [CrossRef] [PubMed]
- Cuadrado, A.; Pajares, M.; Benito, C.; Jiménez-Villegas, J.; Escoll, M.; Fernández-Ginés, R.; Garcia Yagüe, A.J.; Lastra, D.; Manda, G.; Rojo, A.I.; et al. Can Activation of NRF2 Be a Strategy against COVID-19? Trends Pharmacol. Sci. 2020, 41, 598–610. [Google Scholar] [CrossRef] [PubMed]
- Olagnier, D.; Farahani, E.; Thyrsted, J.; Blay-Cadanet, J.; Herengt, A.; Idorn, M.; Hait, A.; Hernaez, B.; Knudsen, A.; Iversen, M.B.; et al. SARS-CoV2-mediated suppression of NRF2-signaling reveals potent antiviral and anti-inflammatory activity of 4-octyl-itaconate and dimethyl fumarate. Nat. Commun. 2020, 11, 4938. [Google Scholar] [CrossRef] [PubMed]
- Liu, H.; Zhu, S.; Han, W.; Cai, Y.; Liu, C. DMEP induces mitochondrial damage regulated by inhibiting Nrf2 and SIRT1/PGC-1α signaling pathways in HepG2 cells. Ecotoxicol. Environ. Saf. 2021, 221, 112449. [Google Scholar] [CrossRef] [PubMed]
- Foo, J.; Bellot, G.; Pervaiz, S.; Alonso, S. Mitochondria-mediated oxidative stress during viral infection. Trends Microbiol. 2022, 30, 679–692. [Google Scholar] [CrossRef]
- Tummers, B.; Green, D.R. The evolution of regulated cell death pathways in animals and their evasion by pathogens. Physiol. Rev. 2022, 102, 411–454. [Google Scholar] [CrossRef] [PubMed]
- Orzalli, M.H.; Kagan, J.C. Apoptosis and Necroptosis as Host Defense Strategies to Prevent Viral Infection. Trends Cell Biol. 2017, 27, 800–809. [Google Scholar] [CrossRef] [PubMed]
- Bhargava, P.; Schnellmann, R.G. Mitochondrial energetics in the kidney. Nat. Rev. Nephrol. 2017, 13, 629–646. [Google Scholar] [CrossRef] [PubMed]
- Shang, H.-S.; Shih, Y.-L.; Lee, C.-H.; Hsueh, S.-C.; Liu, J.-Y.; Liao, N.-C.; Chen, Y.-L.; Huang, Y.-P.; Lu, H.-F.; Chung, J.-G. Sulforaphane-induced apoptosis in human leukemia HL-60 cells through extrinsic and intrinsic signal pathways and altering associated genes expression assayed by cDNA microarray. Environ. Toxicol. 2017, 32, 311–328. [Google Scholar] [CrossRef] [PubMed]
- Ding, L.; Xu, X.; Huang, Y.; Li, Z.; Zhang, K.; Chen, G.; Yu, G.; Wang, Z.; Li, W.; Tong, D. Transmissible gastroenteritis virus infection induces apoptosis through FasL- and mitochondria-mediated pathways. Vet. Microbiol. 2012, 158, 12–22. [Google Scholar] [CrossRef] [PubMed]
- Li, F.; Li, J.; Wang, P.-H.; Yang, N.; Huang, J.; Ou, J.; Xu, T.; Zhao, X.; Liu, T.; Huang, X.; et al. SARS-CoV-2 spike promotes inflammation and apoptosis through autophagy by ROS-suppressed PI3K/AKT/mTOR signaling. Biochim. Biophys. Acta Mol. Basis Dis. 2021, 1867, 166260. [Google Scholar] [CrossRef] [PubMed]
- Pei, J.; Deng, J.; Ye, Z.; Wang, J.; Gou, H.; Liu, W.; Zhao, M.; Liao, M.; Yi, L.; Chen, J. Absence of autophagy promotes apoptosis by modulating the ROS-dependent RLR signaling pathway in classical swine fever virus-infected cells. Autophagy 2016, 12, 1738–1758. [Google Scholar] [CrossRef] [PubMed]
- Xu, X.; Xu, Y.; Zhang, Q.; Yang, F.; Yin, Z.; Wang, L.; Li, Q. Porcine epidemic diarrhea virus infections induce apoptosis in Vero cells via a reactive oxygen species (ROS)/p53, but not p38 MAPK and SAPK/JNK signalling pathways. Vet. Microbiol. 2019, 232, 1–12. [Google Scholar] [CrossRef] [PubMed]
- Zhao, X.; Xiang, H.; Bai, X.; Fei, N.; Huang, Y.; Song, X.; Zhang, H.; Zhang, L.; Tong, D. Porcine parvovirus infection activates mitochondria-mediated apoptotic signaling pathway by inducing ROS accumulation. Virol. J. 2016, 13, 26. [Google Scholar] [CrossRef]
- Imai, Y.; Kuba, K.; Neely, G.G.; Yaghubian-Malhami, R.; Perkmann, T.; van Loo, G.; Ermolaeva, M.; Veldhuizen, R.; Leung, Y.H.C.; Wang, H.; et al. Identification of oxidative stress and Toll-like receptor 4 signaling as a key pathway of acute lung injury. Cell 2008, 133, 235–249. [Google Scholar] [CrossRef] [PubMed]
- Zhang, S.; Wang, J.; Wang, L.; Aliyari, S.; Cheng, G. SARS-CoV-2 virus NSP14 Impairs NRF2/HMOX1 activation by targeting Sirtuin 1. Cell. Mol. Immunol. 2022, 19, 872–882. [Google Scholar] [CrossRef]
- Laforge, M.; Elbim, C.; Frère, C.; Hémadi, M.; Massaad, C.; Nuss, P.; Benoliel, J.-J.; Becker, C. Tissue damage from neutrophil-induced oxidative stress in COVID-19. Nat. Rev. Immunol. 2020, 20, 515–516. [Google Scholar] [CrossRef]
- Cai, Z.; Lu, C.; He, J.; Liu, L.; Zou, Y.; Zhang, Z.; Zhu, Z.; Ge, X.; Wu, A.; Jiang, T.; et al. Identification and characterization of circRNAs encoded by MERS-CoV, SARS-CoV-1 and SARS-CoV-2. Brief. Bioinform. 2021, 22, 1297–1308. [Google Scholar] [CrossRef] [PubMed]
- Sun, L.; Zhao, C.; Fu, Z.; Fu, Y.; Su, Z.; Li, Y.; Zhou, Y.; Tan, Y.; Li, J.; Xiang, Y.; et al. Genome-scale CRISPR screen identifies TMEM41B as a multi-function host factor required for coronavirus replication. PLoS Pathog. 2021, 17, e1010113. [Google Scholar] [CrossRef]
- Zhao, L.; Li, L.; Xue, M.; Liu, X.; Jiang, C.; Wang, W.; Tang, L.; Feng, L.; Liu, P. Gasdermin D Inhibits Coronavirus Infection by Promoting the Noncanonical Secretion of Beta Interferon. mBio 2022, 13, e0360021. [Google Scholar] [CrossRef] [PubMed]
Ingredients | % | Nutrient Level 3 | Contents |
---|---|---|---|
Corn | 33.80 | Digestible energy (calculated, Mcal/kg) | 3.54 |
Extruded corn | 22.20 | Crude Protein (%) | 19.49 |
Soybean meal | 7.42 | Calcium (%) | 0.75 |
Extruded full-fat soybean | 8.79 | Available phosphorus (%) | 0.37 |
Fish meal | 3.94 | Lysine | 1.35 |
Whey powder | 5.00 | Methionine | 0.39 |
Soybean protein concentrate | 8.00 | Methionine + cysteine | 0.68 |
Soybean oil | 1.65 | Threonine | 0.80 |
Sucrose | 2.00 | Tryptophan | 0.22 |
Limestone | 0.62 | ||
Dicalcium phosphate | 0.46 | ||
NaCl | 0.20 | ||
L-Lysine HCl (78%) | 0.32 | ||
DL-Methionine | 0.07 | ||
L-Threonine (98.5%) | 0.02 | ||
Tryptophan (98%) | 0.01 | ||
Chloride choline | 0.15 | ||
Vitamin premix 1 | 0.05 | ||
Mineral premix 2 | 0.30 | ||
Total | 100 |
Gene | Primers | Sequences | Product size | Accession Numbers |
---|---|---|---|---|
β-actin | Forward | GCAAATGCTTCTAGGCGGAC | 148 | XM_021086047.1 |
Reverse | GCGTCCATCACAGCTTCTCA | |||
Keap1 | Forward | TCTGCTTAGTCATGGTGACCT | 143 | NM_001114671.1 |
Reverse | AAGGGACAACACCACCACTG | |||
Nrf2 | Forward | CTACGGGATTGGGGTTTGGG | 124 | XM_013984303.2 |
Reverse | AACTCAAACAGGGGAAGGGC | |||
HO-1 | Forward | TACCGCTCCCGAATGAACAC | 140 | NM_001004027.1 |
Reverse | TGGTCCTTAGTGTCCTGGGT | |||
NQO1 | Forward | TGCTTACACATACGCTGCCA | 113 | NM_001159613.1 |
Reverse | CGTGGATACCCTGCAGAGAG | |||
Bcl-2 | Forward | AGCATGCGGCCTCTATTTGA | 120 | XM_021099593.1 |
Reverse | GGCCCGTGGACTTCACTTAT | |||
Caspase-3 | Forward | GGATTGAGACGGACAGTGGG | 124 | NM_214131.1 |
Reverse | CCGTCCTTTGAATTTCGCCA | |||
Caspase-8 | Forward | GGATCCCAGGATTTGCCTCC | 135 | NM_001031779.2 |
Reverse | CAGGCTCAGGAACTTGAGGG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, K.; Tang, Y.; Wu, X.; Liang, H.; Chen, D.; Yu, B.; He, J.; Mao, X.; Huang, Z.; Yan, H.; et al. Eugenol Attenuates Transmissible Gastroenteritis Virus-Induced Oxidative Stress and Apoptosis Via ROS-NRF2-ARE Signaling. Antioxidants 2022, 11, 1838. https://doi.org/10.3390/antiox11091838
Wang K, Tang Y, Wu X, Liang H, Chen D, Yu B, He J, Mao X, Huang Z, Yan H, et al. Eugenol Attenuates Transmissible Gastroenteritis Virus-Induced Oxidative Stress and Apoptosis Via ROS-NRF2-ARE Signaling. Antioxidants. 2022; 11(9):1838. https://doi.org/10.3390/antiox11091838
Chicago/Turabian StyleWang, Kang, Yan Tang, Xiu Wu, Hongmin Liang, Daiwen Chen, Bing Yu, Jun He, Xiangbing Mao, Zhiqing Huang, Hui Yan, and et al. 2022. "Eugenol Attenuates Transmissible Gastroenteritis Virus-Induced Oxidative Stress and Apoptosis Via ROS-NRF2-ARE Signaling" Antioxidants 11, no. 9: 1838. https://doi.org/10.3390/antiox11091838
APA StyleWang, K., Tang, Y., Wu, X., Liang, H., Chen, D., Yu, B., He, J., Mao, X., Huang, Z., Yan, H., Wu, A., Luo, Y., Zheng, P., Yu, J., Wang, H., & Luo, J. (2022). Eugenol Attenuates Transmissible Gastroenteritis Virus-Induced Oxidative Stress and Apoptosis Via ROS-NRF2-ARE Signaling. Antioxidants, 11(9), 1838. https://doi.org/10.3390/antiox11091838