Docosahexaenoic Acid Alleviates Palmitic Acid-Induced Inflammation of Macrophages via TLR22-MAPK-PPARγ/Nrf2 Pathway in Large Yellow Croaker (Larimichthys crocea)
Abstract
:1. Introduction
2. Materials and Methods
2.1. Macrophages Culture and Treatment
2.2. RNA Isolation and Quantitative Real-Time PCR (RT-qPCR)
2.3. Flow Cytometry Analysis
2.4. Western Blotting
2.5. RNA Interference
2.6. Statistical Analysis
3. Results
3.1. PA-Induced Inflammatory Response in Macrophages of Large Yellow Croaker
3.2. PA Activated the TLR-Related Genes Expression and MAPK Signaling Pathway in Macrophages
3.3. Effects of TLR22-MAPK Signaling Pathway on PA-Induced Inflammation in Macrophages
3.4. PPARγ Participated in PA-Induced Inflammation via TLR22-MAPK Pathway
3.5. p38 MAPK Regulated the PA-Induced Activation of Nrf2
3.6. The Protective Effect of DHA against PA-Induced Inflammation
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Chavez, J.A.; Summers, S.A. Characterizing the effects of saturated fatty acids on insulin signaling and ceramide and diacylglycerol accumulation in 3T3-L1 adipocytes and C2C12 myotubes. Arch. Biochem. Biophys. 2003, 419, 101–109. [Google Scholar] [CrossRef] [PubMed]
- Peng, G.; Li, L.; Liu, Y.; Pu, J.; Zhang, S.; Yu, J.; Zhao, J.; Liu, P. Oleate blocks palmitate-induced abnormal lipid distribution, endoplasmic reticulum expansion and stress, and insulin resistance in skeletal muscle. Endocrinology 2011, 152, 2206–2218. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Leamy, A.K.; Egnatchik, R.A.; Shiota, M.; Ivanova, P.T.; Myers, D.S.; Brown, H.A.; Young, J.D. Enhanced synthesis of saturated phospholipids is associated with ER stress and lipotoxicity in palmitate treated hepatic cells. J. Lipid Res. 2014, 55, 1478–1488. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Korbecki, J.; Bajdak-Rusinek, K. The effect of palmitic acid on inflammatory response in macrophages: An overview of molecular mechanisms. Inflamm. Res. 2019, 68, 915–932. [Google Scholar] [CrossRef] [Green Version]
- Bell, J.G.; Henderson, R.J.; Tocher, D.R.; McGhee, F.; Dick, J.R.; Porter, A.; Smullen, R.P.; Sargent, J.R. Substituting fish oil with crude palm oil in the diet of Atlantic salmon (Salmo salar) affects muscle fatty acid composition and hepatic fatty acid metabolism. J. Nutr. 2002, 132, 222–230. [Google Scholar] [CrossRef] [Green Version]
- Bahurmiz, O.M.; Ng, W.-K. Effects of dietary palm oil source on growth, tissue fatty acid composition and nutrient digestibility of red hybrid tilapia, Oreochromis sp., raised from stocking to marketable size. Aquaculture 2007, 262, 382–392. [Google Scholar] [CrossRef]
- Han, Y.Z.; Jiang, Z.Q.; Ren, T.J.; Koshio, S.; Gao, J.; Komilus, C.F.; Jiang, B.Q. Effect of dietary fish oil replacement with palm oil on growth performance, hematology and liver anti-oxidative enzymes of juvenile Japanese flounder Paralichthys olivaceus (Temminck & Schlegel, 1846). J. Appl. Ichthyol. 2015, 31, 518–524. [Google Scholar] [CrossRef]
- Zhang, J.; Liu, Q.; Pang, Y.; Xu, X.; Cui, K.; Zhang, Y.; Mai, K.; Ai, Q. Molecular cloning and the involvement of IRE1alpha-XBP1s signaling pathway in palmitic acid induced-Inflammation in primary hepatocytes from large yellow croaker (Larimichthys crocea). Fish Shellfish. Immunol. 2020, 98, 112–121. [Google Scholar] [CrossRef]
- Shi, H.; Kokoeva, M.V.; Inouye, K.; Tzameli, I.; Yin, H.; Flier, J.S. TLR4 links innate immunity and fatty acid-induced insulin resistance. J. Clin. Investig. 2006, 116, 3015–3025. [Google Scholar] [CrossRef]
- Rebl, A.; Goldammer, T.; Seyfert, H.M. Toll-like receptor signaling in bony fish. Vet. Immunol. Immunopathol. 2010, 134, 139–150. [Google Scholar] [CrossRef]
- Takeda, K.; Akira, S. TLR signaling pathways. Semin. Immunol. 2004, 16, 3–9. [Google Scholar] [CrossRef] [PubMed]
- Akira, S.; Takeda, K. Toll-like receptor signalling. Nat. Rev. Immunol. 2004, 4, 499–511. [Google Scholar] [CrossRef] [PubMed]
- Rocha, D.M.; Caldas, A.P.; Oliveira, L.L.; Bressan, J.; Hermsdorff, H.H. Saturated fatty acids trigger TLR4-mediated inflammatory response. Atherosclerosis 2016, 244, 211–215. [Google Scholar] [CrossRef] [PubMed]
- Huang, S.; Rutkowsky, J.M.; Snodgrass, R.G.; Ono-Moore, K.D.; Schneider, D.A.; Newman, J.W.; Adams, S.H.; Hwang, D.H. Saturated fatty acids activate TLR-mediated proinflammatory signaling pathways. J. Lipid Res. 2012, 53, 2002–2013. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Panda, R.P.; Chakrapani, V.; Patra, S.K.; Saha, J.N.; Jayasankar, P.; Kar, B.; Sahoo, P.K.; Barman, H.K. First evidence of comparative responses of Toll-like receptor 22 (TLR22) to relatively resistant and susceptible Indian farmed carps to Argulus siamensis infection. Dev. Comp. Immunol. 2014, 47, 25–35. [Google Scholar] [CrossRef] [PubMed]
- Ding, X.; Lu, D.Q.; Hou, Q.H.; Li, S.S.; Liu, X.C.; Zhang, Y.; Lin, H.R. Orange-spotted grouper (Epinephelus coioides) toll-like receptor 22: Molecular characterization, expression pattern and pertinent signaling pathways. Fish Shellfish Immunol. 2012, 33, 494–503. [Google Scholar] [CrossRef]
- Li, H.; Yang, G.; Ma, F.; Li, T.; Yang, H.; Rombout, J.H.; An, L. Molecular characterization of a fish-specific toll-like receptor 22 (TLR22) gene from common carp (Cyprinus carpio L.): Evolutionary relationship and induced expression upon immune stimulants. Fish Shellfish Immunol. 2017, 63, 74–86. [Google Scholar] [CrossRef]
- Ji, J.; Ramos-Vicente, D.; Navas-Perez, E.; Herrera-Ubeda, C.; Lizcano, J.M.; Garcia-Fernandez, J.; Escriva, H.; Bayes, A.; Roher, N. Characterization of the TLR family in Branchiostoma lanceolatum and discovery of a novel TLR22-like involved in dsRNA recognition in Amphioxus. Front. Immunol. 2018, 9, 2525. [Google Scholar] [CrossRef]
- Tan, P.; Dong, X.; Mai, K.; Xu, W.; Ai, Q. Vegetable oil induced inflammatory response by altering TLR-NF-kappaB signalling, macrophages infiltration and polarization in adipose tissue of large yellow croaker (Larimichthys crocea). Fish Shellfish Immunol. 2016, 59, 398–405. [Google Scholar] [CrossRef]
- Xiao, X.; Qin, Q.; Chen, X. Molecular characterization of a Toll-like receptor 22 homologue in large yellow croaker (Pseudosciaena crocea) and promoter activity analysis of its 5’-flanking sequence. Fish Shellfish Immunol. 2011, 30, 224–233. [Google Scholar] [CrossRef]
- Calder, P.C. Omega-3 polyunsaturated fatty acids and inflammatory processes: Nutrition or pharmacology? Br. J. Clin. Pharmacol. 2013, 75, 645–662. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Calder, P.C. n−3 Polyunsaturated fatty acids, inflammation, and inflammatory diseases. Am. J. Clin. Nutr. 2006, 83, 1505S–1519S. [Google Scholar] [CrossRef] [PubMed]
- Lee, J.Y.; Plakidas, A.; Lee, W.H.; Heikkinen, A.; Chanmugam, P.; Bray, G.; Hwang, D.H. Differential modulation of Toll-like receptors by fatty acids: Preferential inhibition by n-3 polyunsaturated fatty acids. J. Lipid Res. 2003, 44, 479–486. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Norris, P.C.; Dennis, E.A. Omega-3 fatty acids cause dramatic changes in TLR4 and purinergic eicosanoid signaling. Proc. Natl. Acad. Sci. USA 2012, 109, 8517–8522. [Google Scholar] [CrossRef] [Green Version]
- Li, Q.; Cui, K.; Wu, M.; Xu, D.; Mai, K.; Ai, Q. Polyunsaturated fatty acids influence LPS-induced inflammation of fish macrophages through differential modulation of pathogen recognition and p38 MAPK/NF-kappaB signaling. Front. Immunol. 2020, 11, 559332. [Google Scholar] [CrossRef]
- Zuo, R.; Ai, Q.; Mai, K.; Xu, W.; Wang, J.; Xu, H.; Liufu, Z.; Zhang, Y. Effects of dietary n-3 highly unsaturated fatty acids on growth, nonspecific immunity, expression of some immune related genes and disease resistance of large yellow croaker (Larmichthys crocea) following natural infestation of parasites (Cryptocaryon irritans). Fish Shellfish Immunol. 2012, 32, 249–258. [Google Scholar] [CrossRef]
- Xu, H.; Turchini, G.M.; Francis, D.S.; Liang, M.; Mock, T.S.; Rombenso, A.; Ai, Q. Are fish what they eat? A fatty acid’s perspective. Prog. Lipid Res. 2020, 80, 101064. [Google Scholar] [CrossRef]
- Du, J.; Xiang, X.; Li, Y.; Ji, R.; Xu, H.; Mai, K.; Ai, Q. Molecular cloning and characterization of farnesoid X receptor from large yellow croaker (Larimichthys crocea) and the effect of dietary CDCA on the expression of inflammatory genes in intestine and spleen. Comp. Biochem. Physiol. B-Biochem. Mol. Biol. 2018, 216, 10–17. [Google Scholar] [CrossRef]
- Li, Q.; Ai, Q.; Mai, K.; Xu, W.; Zheng, Y. A comparative study: In vitro effects of EPA and DHA on immune functions of head-kidney macrophages isolated from large yellow croaker (Larmichthys crocea). Fish Shellfish Immunol. 2013, 35, 933–940. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Xu, D.; Li, Q.; Zhou, Y.; Shen, Y.; Lai, W.; Hao, T.; Ding, Y.; Mai, K.; Ai, Q. Functional analysis and regulation mechanism of interferon gamma in macrophages of large yellow croaker (Larimichthys crocea). Int. J. Biol. Macromol. 2022, 194, 153–162. [Google Scholar] [CrossRef] [PubMed]
- Liu, S.P.; Li, X.Y.; Li, Z.; He, L.N.; Xiao, Y.; Yan, K.; Zhou, Z.G. Octanoylated Ghrelin Inhibits the Activation of the Palmitic Acid-Induced TLR4/NF-kappaB Signaling Pathway in THP-1 Macrophages. ISRN Endocrinol. 2012, 2012, 237613. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Suganami, T.; Tanimoto-Koyama, K.; Nishida, J.; Itoh, M.; Yuan, X.; Mizuarai, S.; Kotani, H.; Yamaoka, S.; Miyake, K.; Aoe, S.; et al. Role of the Toll-like receptor 4/NF-kappaB pathway in saturated fatty acid-induced inflammatory changes in the interaction between adipocytes and macrophages. Arterioscler. Thromb. Vasc. Biol. 2007, 27, 84–91. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Uribe, C.; Folch, H.; Enríquez, R.; Moran, G. Innate and adaptive immunity in teleost fish: A review. Vet. Med. 2011, 56, 486. [Google Scholar] [CrossRef] [Green Version]
- Roach, J.C.; Glusman, G.; Rowen, L.; Kaur, A.; Purcell, M.K.; Smith, K.D.; Hood, L.E.; Aderem, A. The evolution of vertebrate Toll-like receptors. Proc. Natl. Acad. Sci. USA 2005, 102, 9577–9582. [Google Scholar] [CrossRef] [Green Version]
- Li, X.; Ji, R.; Cui, K.; Chen, Q.; Chen, Q.; Fang, W.; Mai, K.; Zhang, Y.; Xu, W.; Ai, Q. High percentage of dietary palm oil suppressed growth and antioxidant capacity and induced the inflammation by activation of TLR-NF-kappaB signaling pathway in large yellow croaker (Larimichthys crocea). Fish Shellfish Immunol. 2019, 87, 600–608. [Google Scholar] [CrossRef]
- Wang, T.; Yang, B.; Ji, R.; Xu, W.; Mai, K.; Ai, Q. Omega-3 polyunsaturated fatty acids alleviate hepatic steatosis-induced inflammation through Sirt1-mediated nuclear translocation of NF-kappaB p65 subunit in hepatocytes of large yellow croaker (Larmichthys crocea). Fish Shellfish Immunol. 2017, 71, 76–82. [Google Scholar] [CrossRef]
- Mu, Y.; Li, M.; Ding, F.; Ding, Y.; Ao, J.; Hu, S.; Chen, X. De novo characterization of the spleen transcriptome of the large yellow croaker (Pseudosciaena crocea) and analysis of the immune relevant genes and pathways involved in the antiviral response. PLoS ONE 2014, 9, e97471. [Google Scholar] [CrossRef] [Green Version]
- Mu, Y.; Ding, F.; Cui, P.; Ao, J.; Hu, S.; Chen, X. Transcriptome and expression profiling analysis revealed changes of multiple signaling pathways involved in immunity in the large yellow croaker during Aeromonas hydrophila infection. BMC Genom. 2010, 11, 506. [Google Scholar] [CrossRef] [Green Version]
- Ding, X.; Liang, Y.; Peng, W.; Li, R.; Lin, H.; Zhang, Y.; Lu, D. Intracellular TLR22 acts as an inflammation equalizer via suppression of NF-κB and selective activation of MAPK pathway in fish. Fish Shellfish Immunol. 2018, 72, 646–657. [Google Scholar] [CrossRef]
- Matsuo, A.; Oshiumi, H.; Tsujita, T.; Mitani, H.; Kasai, H.; Yoshimizu, M.; Matsumoto, M.; Seya, T. Teleost TLR22 recognizes RNA duplex to induce IFN and protect cells from birnaviruses. J. Immunol. 2008, 181, 3474–3485. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ji, J.; Liao, Z.; Rao, Y.; Li, W.; Yang, C.; Yuan, G.; Feng, H.; Xu, Z.; Shao, J.; Su, J. Thoroughly remold the localization and signaling pathway of TLR22. Front. Immunol. 2020, 10, 3003. [Google Scholar] [CrossRef] [PubMed]
- Li, H.; Ruan, X.Z.; Powis, S.H.; Fernando, R.; Mon, W.Y.; Wheeler, D.C.; Moorhead, J.F.; Varghese, Z. EPA and DHA reduce LPS-induced inflammation responses in HK-2 cells: Evidence for a PPAR-γ–dependent mechanism. Kidney Int. 2005, 67, 867–874. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wu, M.; Li, Q.; Mai, K.; Ai, Q. Regulation of free fatty acid receptor 4 on inflammatory gene induced by LPS in large yellow croaker (Larimichthys crocea). Front. Immunol. 2021, 12, 703914. [Google Scholar] [CrossRef] [PubMed]
- Kaspar, J.W.; Niture, S.K.; Jaiswal, A.K. Nrf2:INrf2 (Keap1) signaling in oxidative stress. Free Radic. Biol. Med. 2009, 47, 1304–1309. [Google Scholar] [CrossRef] [Green Version]
- Lee, M.S.; Lee, B.; Park, K.E.; Utsuki, T.; Shin, T.; Oh, C.W.; Kim, H.R. Dieckol enhances the expression of antioxidant and detoxifying enzymes by the activation of Nrf2-MAPK signalling pathway in HepG2 cells. Food Chem. 2015, 174, 538–546. [Google Scholar] [CrossRef]
- Yao, P.; Nussler, A.; Liu, L.; Hao, L.; Song, F.; Schirmeier, A.; Nussler, N. Quercetin protects human hepatocytes from ethanol-derived oxidative stress by inducing heme oxygenase-1 via the MAPK/Nrf2 pathways. J. Hepatol. 2007, 47, 253–261. [Google Scholar] [CrossRef]
- De Caterina, R. n–3 fatty acids in cardiovascular disease. N. Engl. J. Med. 2011, 364, 2439–2450. [Google Scholar] [CrossRef]
- Breslow, J.L. n−3 Fatty acids and cardiovascular disease. Am. J. Clin. Nutr. 2006, 83, 1477S–1482S. [Google Scholar] [CrossRef] [Green Version]
- Kennedy, A.; Martinez, K.; Chuang, C.C.; LaPoint, K.; McIntosh, M. Saturated fatty acid-mediated inflammation and insulin resistance in adipose tissue: Mechanisms of action and implications. J. Nutr. 2009, 139, 1–4. [Google Scholar] [CrossRef]
- White, P.J.; Mitchell, P.L.; Schwab, M.; Trottier, J.; Kang, J.X.; Barbier, O.; Marette, A. Transgenic omega-3 PUFA enrichment alters morphology and gene expression profile in adipose tissue of obese mice: Potential role for protectins. Metabolism 2015, 64, 666–676. [Google Scholar] [CrossRef] [PubMed]
- Wong, S.W.; Kwon, M.J.; Choi, A.M.; Kim, H.P.; Nakahira, K.; Hwang, D.H. Fatty acids modulate Toll-like receptor 4 activation through regulation of receptor dimerization and recruitment into lipid rafts in a reactive oxygen species-dependent manner. J. Biol. Chem. 2009, 284, 27384–27392. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fessler, M.B.; Rudel, L.L.; Brown, J.M. Toll-like receptor signaling links dietary fatty acids to the metabolic syndrome. Curr. Opin. Lipidol. 2009, 20, 379–385. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, L.; Waltenberger, B.; Pferschy-Wenzig, E.M.; Blunder, M.; Liu, X.; Malainer, C.; Blazevic, T.; Schwaiger, S.; Rollinger, J.M.; Heiss, E.H.; et al. Natural product agonists of peroxisome proliferator-activated receptor gamma (PPARgamma): A review. Biochem. Pharmacol. 2014, 92, 73–89. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Gene | Forward (5′-3′) | Reverse (5′-3′) | Accession Number |
---|---|---|---|
β-actin | GACCTGACAGACTACCTCATG | AGTTGAAGGTGGTCTCGTGGA | GU584189 |
tnfα | ACACCTCTCAGCCACAGGAT | CCGTGTCCCACTCCATAGTT | NM_001303385 |
il1β | CATAGGGATGGGGACAACGA | AGGGGACGGACACAAGGGTA | XM_010736551 |
il6 | CGACACACCCACTATTTACAAC | TCCCATTTTCTGAACTGCCTC | XM_010734753 |
cox2 | CTGGAAAGGCAACACAAGC | CGGTGAGAGTCAGGGACAT | XM_010734489 |
arg1 | AACCACCCGCAGGATTACG | AAACTCACTGGCATCACCTCA | XM_19269015 |
il10 | AGTCGGTTACTTTCTGTGGTG | TGTATGACGCAATATGGTCTG | XM_010738826 |
cd68 | GCAGGGCTTCAATCTGACCAA | AGGATGAGCACCAGCAATGTC | NM_001319937 |
cd86 | TGTGCGTCTTAGTCTACCTTCT | AAACTCTTCCGTCATCTTGC | XM_010756962 |
cd209 | GATGGGTGTATTTCAGCGGTAG | TGTTGATAATCACCAGGTCTGC | XM_027278935 |
tlr1 | TGTGCCACCGTTTGGATA | TTCAGGGCGAACTTGTCG | KF318376 |
tlr2 | TCTGCTGGTGTCAGAGGTCA | GGTGAATCCGCCATAGGA | XM_027287556 |
tlr3 | ACTTAGCCCGTTTGTGGAAG | CCAGGCTTAGTTCACGGAGG | XM_019274877 |
tlr7 | ATGCAATGAGCCAAAGTCT | CATGTGAGTCAATCCCTCC | XM_010743042 |
tlr13 | CCTCCTGTTTATGGTAGTGTCC | GCTCGTCATGGGTGTTGTAG | XM_010743101 |
tlr21 | CTTTGCCTACATCACAGGGACT | GAAACACGAGCAGGAGAACATC | KY025428 |
tlr22 | TATGCGAGCAGGAAGACC | CAGAAACACCAGGATCAGC | GU324977 |
myd88 | TACGAAGCGACCAATAACCC | ATCAATCAAAGGCCGAAGAT | EU978950 |
trif | TACAATACTGTTATCCCTCTGCTGC | TCTCTTCTGTTTTCTAATCCTCGCG | MK863372 |
pparγ | TGTCCGAGCTGGAAGACAAC | TGGGGTCATAGGGCATACCA | XM_010731330 |
nrf2 | GATGGAAATGGAGGTGATGC | CATGTTCTTTCTGTCGGTGG | XM_010737768 |
sitlr22 | GCAAGUUUGGUGGUGCUUUTT | AAAGCACCACCAAACUUGCTT | GU324977 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xu, D.; Cui, K.; Li, Q.; Zhu, S.; Zhang, J.; Gao, S.; Hao, T.; Mai, K.; Ai, Q. Docosahexaenoic Acid Alleviates Palmitic Acid-Induced Inflammation of Macrophages via TLR22-MAPK-PPARγ/Nrf2 Pathway in Large Yellow Croaker (Larimichthys crocea). Antioxidants 2022, 11, 682. https://doi.org/10.3390/antiox11040682
Xu D, Cui K, Li Q, Zhu S, Zhang J, Gao S, Hao T, Mai K, Ai Q. Docosahexaenoic Acid Alleviates Palmitic Acid-Induced Inflammation of Macrophages via TLR22-MAPK-PPARγ/Nrf2 Pathway in Large Yellow Croaker (Larimichthys crocea). Antioxidants. 2022; 11(4):682. https://doi.org/10.3390/antiox11040682
Chicago/Turabian StyleXu, Dan, Kun Cui, Qingfei Li, Si Zhu, Junzhi Zhang, Shengnan Gao, Tingting Hao, Kangsen Mai, and Qinghui Ai. 2022. "Docosahexaenoic Acid Alleviates Palmitic Acid-Induced Inflammation of Macrophages via TLR22-MAPK-PPARγ/Nrf2 Pathway in Large Yellow Croaker (Larimichthys crocea)" Antioxidants 11, no. 4: 682. https://doi.org/10.3390/antiox11040682