A Metabolic Network Mediating the Cycling of Succinate, a Product of ROS Detoxification into α-Ketoglutarate, an Antioxidant
Abstract
1. Introduction
2. Material and Methods
2.1. Bacterial Cultures and Biomass Measurement
2.2. Cell Fractionation and Metabolic Profiling
2.3. Detection of Enzymatic Activity
2.3.1. Blue Native Polyacrylamide Gel Electrophoresis (BN-PAGE) and Enzyme Activity
2.3.2. Detection of Enzymatic Activity by HPLC and Spectrophotometric Assays
2.3.3. Gene Expression Profiling Using Quantitative Real Time Polymerase Chain Reaction (qRT-PCR)
2.4. Statistical Analysis
3. Results
3.1. Oxidative Environment Evoked by Lack of Sulfur Leads to Succinate Accumulation in P. fluorescens
3.2. Metabolite and Enzyme Profiles in Cell-Free Extracts (CFEs) from Control and S-Deficient Cultures
3.3. Gene Expression Profiling in P. fluorescens under Sulfur Starvation
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Finkel, T.; Holbrook, N.J. Oxidants, oxidative stress and the biology of ageing. Nature 2000, 408, 239–247. [Google Scholar] [CrossRef] [PubMed]
- Green, J.; Paget, M.S. Bacterial redox sensors. Nat. Rev. Microbiol. 2004, 2, 954–966. [Google Scholar] [CrossRef] [PubMed]
- Ferguson, G.D.; Bridge, W.J. The glutathione system and the related thiol network in Caenorhabditis elegans. Redox Biol. 2019, 24, 101171. [Google Scholar] [CrossRef]
- Middaugh, J.; Hamel, R.; Jean-Baptiste, G.; Beriault, R.; Chenier, D.; Appanna, V.D. Aluminum triggers decreased aconitase activity via Fe-S cluster disruption and the overexpression of isocitrate dehydrogenase and isocitrate lyase: A metabolic network mediating cellular survival. J. Biol. Chem. 2005, 280, 3159–3165. [Google Scholar] [CrossRef] [PubMed]
- Mailloux, R.J.; Bériault, R.; Lemire, J.; Singh, R.; Chénier, D.R.; Hamel, R.D.; Appanna, V.D. The tricarboxylic acid cycle, an ancient metabolic network with a novel twist. PLoS ONE 2007, 2, e690. [Google Scholar] [CrossRef] [PubMed]
- Tong, W.-H.; Rouault, T.A. Metabolic regulation of citrate and iron by aconitases: Role of iron-sulfur cluster biogenesis. BioMetals 2007, 20, 549–564. [Google Scholar] [CrossRef] [PubMed]
- Hirst, J. Towards the molecular mechanism of respiratory complex I. Biochem. J. 2009, 425, 327–339. [Google Scholar] [CrossRef] [PubMed]
- Chenier, D.; Beriault, R.; Mailloux, R.; Baquie, M.; Abramia, G.; Lemire, J.; Appanna, V. Involvement of fumarase C and NADH oxidase in metabolic adaptation of Pseudomonas fluorescens cells evoked by aluminum and gallium toxicity. Appl. Environ. Microbiol. 2008, 74, 3977–3984. [Google Scholar] [CrossRef] [PubMed]
- Py, B.; Barras, F. Building Fe–S proteins: Bacterial strategies. Nat. Rev. Microbiol. 2010, 8, 436–446. [Google Scholar] [CrossRef] [PubMed]
- Legendre, F.; Tharmalingam, S.; Bley, A.M.; MacLean, A.; Appanna, V.D. Metabolic adaptation and NADPH homeostasis evoked by a sulfur-deficient environment in Pseudomonas fluorescens. Antonie Van Leeuwenhoek 2020, 113, 605–616. [Google Scholar] [CrossRef]
- Auger, C.; Lemire, J.; Cecchini, D.; Bignucolo, A.; Appanna, V.D. The metabolic reprogramming evoked by nitrosative stress triggers the anaerobic utilization of citrate in Pseudomonas fluorescens. PLoS ONE 2011, 12, e28469. [Google Scholar] [CrossRef] [PubMed]
- Albaugh, V.L.; Mukherjee, K.; Barbul, A. Proline Precursors and Collagen Synthesis: Biochemical Challenges of Nutrient Supplementation and Wound Healing. J. Nutr. 2017, 147, 2011–2017. [Google Scholar] [CrossRef] [PubMed]
- Mailloux, R.J.; Singh, R.; Brewer, G.; Auger, C.; Lemire, J.; Appanna, V.D. Alpha-ketoglutarate dehydrogenase and glutamate dehydrogenase work in tandem to modulate the antioxidant alpha-ketoglutarate during oxidative stress in Pseudomonas fluorescens. J. Bacteriol. 2009, 191, 3804–3810. [Google Scholar] [CrossRef] [PubMed]
- Lemire, J.; Milandu, Y.; Auger, C.; Bignucolo, A.; Appanna, V.P.; Appanna, V.D. Histidine is a source of the antioxidant, alpha-ketoglutarate, in Pseudomonas fluorescens challenged by oxidative stress. FEMS Microbiol. Lett. 2010, 309, 170–177. [Google Scholar] [PubMed]
- Lemire, J.; Mailloux, R.; Darwich, R.; Auger, C.; Appanna, V.D. Disruption of L-carntine metabolism by aluminum toxicity and oxidative stress promotes dyslipidemia in human astrocytic and hepatic cells. Toxicol. Lett. 2011, 203, 219–226. [Google Scholar] [CrossRef] [PubMed]
- Liu, S.; He, L.; Yao, K. The Antioxidative Function of Alpha-Ketoglutarate and Its Applications. BioMed Res. Int. 2018, 2018, 3408467. [Google Scholar] [CrossRef] [PubMed]
- Mailloux, R.J.; Puiseux-Dao, S.; Appanna, V.D. Alpha-ketoglutarate abrogates the nuclear localization of HIF-1alpha in aluminum-exposed hepatocytes. Biochimie 2009, 91, 408–415. [Google Scholar] [CrossRef] [PubMed]
- Singh, R.; Lemire, J.; Mailloux, R.J.; Chénier, D.; Hamel, R.; Appanna, V.D. An ATP and oxalate generating variant tricarboxylic acid cycle counters aluminum toxicity in Pseudomonas fluorescens. PLoS ONE 2009, 4, e7344. [Google Scholar] [CrossRef] [PubMed]
- Bériault, R.; Hamel, R.; Chenier, D.; Mailloux, R.J.; Joly, H.; Appanna, V.D. The overexpression of NADPH-producing enzymes counters the oxidative stress evoked by gallium, an iron mimetic. BioMetals 2007, 20, 165–176. [Google Scholar] [CrossRef]
- Jarrett, S.G.; Boulton, M.E. Antioxidant up-regulation and increased nuclear DNA protection play key roles in adaptation to oxidative stress in epithelial cells. Free Radic Biol. Med. 2005, 38, 1382–1391. [Google Scholar] [CrossRef]
- Alhasawi, A.; Auger, C.; Appanna, V.P.; Chahma, M.; Appanna, V.D. Zinc toxicity and ATP production in Pseudomonas fluorescens. J. Appl. Microbiol. 2014, 117, 65–73. [Google Scholar] [CrossRef] [PubMed]
- Auger, C.; Appanna, V.D. A novel ATP-generating machinery to counter nitrosative stress is mediated by substrate-level phosphorylation. Biochim. Biophys Acta 2015, 1850, 43–50. [Google Scholar] [CrossRef] [PubMed]
- Thomas, S.C.; Alhasawi, A.; Auger, C.; Omri, A.; Appanna, V.D. The role of formate in combatting oxidative stress. Antonie Van Leeuwenhoek 2016, 109, 263–271. [Google Scholar] [CrossRef] [PubMed]
- Aldarini, N.; Alhasawi, A.A.; Thomas, S.C.; Appanna, V.D. The role of glutamine synthetase in energy production and glutamine metabolism during oxidative stress. Antonie Van Leeuwenhoek 2017, 110, 629–639. [Google Scholar] [CrossRef] [PubMed]
- Anderson, S.; Appanna, V.D.; Huang, J.; Viswanatha, T. A novel role for calcite in calcium homeostasis. FEBS Lett. 1992, 308, 94–96. [Google Scholar] [CrossRef]
- Bradford, M.M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef]
- Mesquita, C.S.; Oliveira, R.; Bento, F.; Geraldo, D.; Rodrigues, J.V.; Marcos, J.C. Simplified 2,4-dinitrophenylhydrazine spectrophotometric assay for quantification of carbonyls in oxidized proteins. Anal. Biochem. 2014, 458, 69–71. [Google Scholar] [CrossRef] [PubMed]
- Alhasawi, A.; Appanna, V. Aspartate metabolism and pyruvate homeostasis triggered by oxidative stress in Pseudomonas fluorescens: A functional metabolomic study. Metabolomics 2015, 6, 1792–1801. [Google Scholar] [CrossRef]
- Han, S.; Auger, C.; Appanna, V.P.; Lemire, J.; Castonguay, Z.; Akbarov, E.; Appanna, V.D. A blue native polyacrylamide gel electrophoretic technology to probe the functional proteomics mediating nitrogen homeostasis in Pseudomonas fluorescens. J. Microbiol. Methods. 2012, 90, 206–210. [Google Scholar] [CrossRef] [PubMed]
- Auger, C.; Appanna, V.; Castonguay, Z.; Han, S.; Appanna, V.D. A facile electrophoretic technique to monitor phosphoenolpyruvate-dependent kinases. Electrophoresis 2012, 33, 1095–1101. [Google Scholar] [CrossRef] [PubMed]
- Auger, C.; Appanna, N.D.; Alhasawi, A.; Appanna, V.D. Deciphering metabolic networks by blue native polyacrylamide gel electrophoresis: A functional proteomic exploration. EuPA Open Proteom. 2015, 7, 64–72. [Google Scholar] [CrossRef][Green Version]
- Alhasawi, A.A.; Thomas, S.C.; Tharmalingam, S.; Legendre, F.; Appanna, V.D. Isocitrate Lyase and Succinate Semialdehyde Dehydrogenase Mediate the Synthesis of α-Ketoglutarate in Pseudomonas fluorescens. Front. Microbiol. 2019, 10, 1929. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Singh, R.; Mailloux, R.J.; Puiseux-Dao, S.; Appanna, V.D. Oxidative stress evokes a metabolic adaptation that favors increased NADPH synthesis and decreased NADH production in Pseudomonas fluorescens. J. Bacteriol. 2007, 189, 6665–6675. [Google Scholar] [CrossRef] [PubMed]
- Legendre, F.; MacLean, A.; Appanna, V.P.; Appanna, V.D. Biochemical pathways to α-ketoglutarate, a multi-faceted metabolite. World J. Microbiol. Biotechnol. 2020, 36, 123. [Google Scholar] [CrossRef] [PubMed]
- Bignucolo, A.; Appanna, V.P.; Thomas, S.C.; Auger, C.; Han, S.; Omri, A.; Appanna, V.D. Hydrogen peroxide stress provokes a metabolic reprogramming in Pseudomonas fluorescens: Enhanced production of pyruvate. J. Biotechnol. 2013, 167, 309–315. [Google Scholar] [CrossRef] [PubMed]
- Appanna, V.P.; Alhasawi, A.A.; Auger, C.; Thomas, S.C.; Appanna, V.D. Phospho-transfer networks and ATP homeostasis in response to an ineffective electron transport chain in Pseudomonas fluorescens. Arch. Biochem. Biophys. 2016, 606, 26–33. [Google Scholar] [CrossRef] [PubMed]
- Coudray-Lucas, C.; Le Bever, H.; Cynober, L.; De Bandt, J.P.; Carsin, H. Ornithine alpha-ketoglutarate improves wound healing in severe burn patients: A prospective randomized double-blind trial versus isonitrogenous controls. Crit. Care Med. 2000, 28, 1772–1776. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.; Hou, Y.; Yi, D.; Li, Y.; Ding, B.; Zhu, H.; Liu, J.; Xiao, H.; Wu, G. Dietary supplementation with glutamate precursor α-ketoglutarate attenuates lipopolysaccharide-induced liver injury in young pigs. J. Amino Acids 2015, 47, 1309–1318. [Google Scholar] [CrossRef] [PubMed]
- Sultana, S.; Talegaonkar, S.; Nishad, D.K.; Mittal, G.; Ahmad, F.J.; Bhatnagar, A. Alpha ketoglutarate nanoparticles: A potentially effective treatment for cyanide poisoning. Eur. J. Pharm. Biopharm. 2018, 126, 221–232. [Google Scholar] [CrossRef] [PubMed]
- Lemire, J.; Alhasawi, A.; Appanna, V.P.; Tharmalingam, S.; Appanna, V.D. Metabolic defence against oxidative stress: The road less travelled so far. J. Appl. Microbiol. 2017, 123, 798–809. [Google Scholar] [CrossRef] [PubMed]
- Mills, E.; O’Neill, L.A.J. Succinate: A metabolic signal in inflammation. Trends Cell Biol. 2014, 24, 313–320. [Google Scholar] [CrossRef] [PubMed]
- Hamel, R.; Appanna, V.D.; Viswanatha, T.; Puiseux-Dao, S. Overexpression of isocitrate lyase is an important strategy in the survival of Pseudomonas fluorescens exposed to aluminum. Biochem. Biophys. Res. Commun. 2004, 317, 1189–1194. [Google Scholar] [CrossRef] [PubMed]
- Mailloux, R.J.; Hamel, R.; Appanna, V.D. Aluminum toxicity elicits a dysfunctional TCA cycle and succinate accumulation in hepatocytes. J. Biochem. Mol. Toxicol. 2006, 20, 198–208. [Google Scholar] [CrossRef] [PubMed]
- MacLean, A.; Bley, A.M.; Appanna, V.P.; Appanna, V.D. Metabolic manipulation by Pseudomonas fluorescens: A powerful stratagem against oxidative and metal stress. J. Med. Microbiol. 2020, 69, 339–346. [Google Scholar] [CrossRef] [PubMed]
- Ravasz, D.; Kacso, G.; Fodor, V.; Horvath, K.; Adam-Vizi, V.; Chinopoulos, C. Catabolism of GABA, succinic semialdehyde or gamma-hydroxybutyrate through the GABA shunt impair mitochondrial substrate-level phosphorylation. Neurochem. Int. 2017, 109, 41–53. [Google Scholar] [CrossRef] [PubMed]
- Zhang, S.; Qian, X.; Chang, S.; Dismukes, G.C.; Bryant, D.A. Natural and Synthetic Variants of the Tricarboxylic Acid Cycle in Cyanobacteria: Introduction of the GABA Shunt into Synechococcus sp. PCC 7002. Front. Microbiol. 2016, 7, 1972. [Google Scholar] [CrossRef] [PubMed]




= Cycle producing KG from glutamate,
= Regeneration of KG from succinate, the product of ROS detoxification.
= Cycle producing KG from glutamate,
= Regeneration of KG from succinate, the product of ROS detoxification.
| Gene Name | Enzyme Symbol | Genome ID (Gene Location) | Forward Primer [5′ to 3′] | Reverse Primer [5′ to 3′] |
|---|---|---|---|---|
| Succinate dehydrogenase (sdhB) | SDH | NZ_LT907842.1 (4306753–4307457) | CTCGACGGTCTGTACGAGTG | CTGGACCCAGGAACTTGTCC |
| Fumarate reductase (sdhA) | FRD | NZ_LT907842.1 (2366315–2368087) | GATCGCGACGACGAAAACTG | GGAACTGTCTTCGGCGAGAA |
| Glutamate Decarboxylase (Gldc) | GDC | NZ_LT907842.1 (5096095 5096823) | TTTCGACCTGCCGGAAATGA | TTCACCTCATGGGCCTGTTC |
| Alpha-ketoglutarate decarboxylase (alkB) | KGDC | NZ_LT907842.1 (3673836–3674501) | CCCCAGAAGATCGCCTTGTT | TCGGCATCACCCCATGAAAA |
| Isocitrate dehydrogenase (NAD+) (AceK) | ICDH (NAD+) | NZ_LT907842.1 (4980207–4981922) | CCCGAGGATGAGATGGCTTC | AAGGCGGGAATTCTTCAGGG |
| Succinate semialdehyde dehydrogenase (SSADH) | SSADH | NC_007492.2 (225316–226758) | GTCGTCAGCTGATGTCGGAA | GTCGAACACGATGAATGGCG |
| Isocitrate lyase (AceA) | ICL | NZ_LT907842.1 (6193725–6195050) | CCCACGGGTCTTCTTTCAGG | ACAAAGTCGGCTACTGGTCG |
| Housekeeping Gene: Chaperonin 60 (cpn60) | N/A | NZ_LT907842.1 (5505175–5506821) | GCGACATGATCGAAATGGGC | GCCAGTCGAGCCTTCTTTCT |
| Housekeeping Gene: DNA-directed RNA polymerase subunit alpha (rpoA) | N/A | NZ_LT907842.1 (6028685–6029686) | TCCTGTTGTCCTCAATGCCC | TGCAGCTTGATAGCCAGACC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Legendre, F.; MacLean, A.; Tharmalingam, S.; Appanna, V.D. A Metabolic Network Mediating the Cycling of Succinate, a Product of ROS Detoxification into α-Ketoglutarate, an Antioxidant. Antioxidants 2022, 11, 560. https://doi.org/10.3390/antiox11030560
Legendre F, MacLean A, Tharmalingam S, Appanna VD. A Metabolic Network Mediating the Cycling of Succinate, a Product of ROS Detoxification into α-Ketoglutarate, an Antioxidant. Antioxidants. 2022; 11(3):560. https://doi.org/10.3390/antiox11030560
Chicago/Turabian StyleLegendre, Félix, Alex MacLean, Sujeenthar Tharmalingam, and Vasu D. Appanna. 2022. "A Metabolic Network Mediating the Cycling of Succinate, a Product of ROS Detoxification into α-Ketoglutarate, an Antioxidant" Antioxidants 11, no. 3: 560. https://doi.org/10.3390/antiox11030560
APA StyleLegendre, F., MacLean, A., Tharmalingam, S., & Appanna, V. D. (2022). A Metabolic Network Mediating the Cycling of Succinate, a Product of ROS Detoxification into α-Ketoglutarate, an Antioxidant. Antioxidants, 11(3), 560. https://doi.org/10.3390/antiox11030560
