Increased Ingestion of Hydroxy-Methionine by Both Sows and Piglets Improves the Ability of the Progeny to Counteract LPS-Induced Hepatic and Splenic Injury with Potential Regulation of TLR4 and NOD Signaling
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animals, Treaztments, and Sample Collection
2.2. Histopathological and Redox Status Analysis
2.3. Real-Time q-PCR and Western-Blot Analyses
2.4. Statistical Analysis
3. Results
3.1. Liver and Spleen Histopathology
3.2. Antioxidant Parameters in Liver and Spleen
3.3. Expression of TLR4 and NODs Signaling in Liver and Spleen
3.4. Production of Selected TLR4 and NODs Signaling Proteins in Liver and Spleen
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Burley, H.K. Enrichment of Methionine from Naturally Concentrated Feedstuffs for Use in Organic Poultry Diets. Ph.D. Thesis, The Pennsylvania State University, State College, PA, USA, 2012. [Google Scholar]
- Schingoethe, D.J.; Ahrar, M. Protein solubility, amino acid composition, and biological value of regular and heat-treated soybean and sunflower meals. J. Dairy Sci. 1979, 62, 925–931. [Google Scholar] [CrossRef]
- Conde-Aguilera, J.A.; Floc’h, N.L.; Huërou-Luron, I.L.; Mercier, Y.; Tesseraud, S.; Lefaucheur, L.; Milgen, J.V. Splanchnic tissues respond differently when piglets are offered a diet 30% deficient in total sulfur amino acid for 10 days. Eur. J. Nutr. 2016, 55, 2209–2219. [Google Scholar] [CrossRef] [PubMed]
- Baker, D.H. Comparative species utilization and toxicity of sulfur amino acids. J. Nutr. 2006, 136, 1670–1675. [Google Scholar] [CrossRef] [Green Version]
- Giguére, A.; Girard, C.L.; Matte, J.J. Methionine, folic acid and vitamin B12 in growing-finishing pigs: Impact on growth performance and meat quality. Arch. Anim. Nutr. 2008, 62, 193–206. [Google Scholar] [CrossRef]
- Zhao, L.; Zhang, N.Y.; Pan, Y.X.; Zhu, L.Y.; Batonon-Alavo, D.I.; Ma, L.B.; Khalil, M.M.; Qi, D.S.; Sun, L.H. Efficacy of 2-hydroxy-4-Methylthio-butanoic acid compared to DL-Methionine on growth performance, carcass traits, feather growth, and redox status of Cherry Valley ducks. Poult. Sci. 2018, 97, 3166–3175. [Google Scholar] [CrossRef]
- Fang, Z.; Yao, K.; Zhang, X.; Zhao, S.; Sun, Z.; Tian, G.; Yu, B.; Lin, Y.; Zhu, B.Q.; Jia, G.; et al. Nutrition and health relevant regulation of intestinal sulfur amino acid metabolism. Amino Acids 2010, 39, 633–640. [Google Scholar] [CrossRef]
- Zhang, Y.; Xu, B.Y.; Zhao, L.; Zhu, L.Y.; Batonon-Alavo, D.; Jachacz, J.; Qi, D.S.; Zhang, S.J.; Ma, L.B.; Sun, L.H. Increased consumption of sulfur amino acids by both sows and piglets enhances the ability of the progeny to adverse effects induced by lipopolysaccharide. Animals 2019, 9, 1048. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Goswami, P.S.; Friendship, R.M.; Gyles, C.L.; Poppe, C.; Boerlin, P. Preliminary investigations of the distribution of Escherichia coli O149 in sows, piglets, and their environment. Can. J. Vet. Res. 2011, 75, 57–60. [Google Scholar] [PubMed]
- Hou, X.; Zhang, J.; Ahmad, H.; Zhang, H.; Xu, Z.; Wang, T. Evaluation of antioxidant activities of ampelopsin and its protective effect in lipopolysaccharide-induced oxidative stress piglets. PLoS ONE 2014, 9, e108314. [Google Scholar] [CrossRef] [Green Version]
- Fukata, M.; Vamadevan, A.S.; Abreu, M.T. Toll-like receptors (TLRs) and Nod-like receptors (NLRs) in inflammatory disorders. Semin. Immunol. 2009, 21, 242–253. [Google Scholar] [CrossRef]
- Takeuchi, O.; Akira, S. Pattern recognition receptors and inflammation. Cell 2010, 140, 805–820. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sabroe, I.; Parker, L.C.; Dower, S.K.; Whyte, M.K.B. The role of TLR activation in inflammation. J. Pathol. 2008, 214, 126–135. [Google Scholar] [CrossRef]
- Lappas, M. NOD1 and NOD2 regulate proinflammatory and prolabor mediators in human fetal membranes and myometrium via nuclear factor-kappa B. Biol. Reprod. 2013, 89, 14. [Google Scholar] [CrossRef] [PubMed]
- Takada, H.; Uehara, A. Enhancement of TLR-mediated innate immune responses by peptidoglycans through NOD signaling. Curr. Pharm. Des. 2006, 12, 4163–4172. [Google Scholar] [CrossRef]
- Moreira, L.O.; Zamboni, D.S. NOD1 and NOD2 signaling in infection and inflammation. Front. Immunol. 2012, 3, 328. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- National Research Council (NRC). Nutrient Requirements of Swine, 11th ed.; National Academy Press: Washington, DC, USA, 2012. [Google Scholar]
- Sun, L.H.; Zhang, N.Y.; Zhu, M.K.; Zhao, L.; Zhou, J.C.; Qi, D.S. Prevention of aflatoxin B1 hepatoxicity by dietary selenium is associated with inhibition of cytochrome P450 isozymes and up-regulation of 6 selenoprotein genes in chick liver. J. Nutr. 2016, 146, 655–661. [Google Scholar] [CrossRef]
- Zhao, L.; Sun, L.H.; Huang, J.Q.; Briens, M.; Qi, D.S.; Xu, S.W.; Lei, G.X. A novel organic selenium compound exerts unique regulation of selenium speciation, selenogenome, and selenoproteins in broiler chicks. J. Nutr. 2017, 147, 789–797. [Google Scholar] [CrossRef] [Green Version]
- Zhou, J.C.; Zhao, H.; Li, J.G.; Xia, X.J.; Wang, K.N.; Zhang, Y.J.; Liu, Y.; Zhao, Y.; Lei, G.X. Selenoprotein gene expression in thyroid and pituitary of young pigs is not affected by dietary selenium deficiency or excess. J. Nutr. 2009, 139, 1061–1066. [Google Scholar] [CrossRef] [Green Version]
- Huang, J.Q.; Ren, F.Z.; Jiang, Y.Y.; Xiao, C.; Lei, X.G. Selenoproteins protect against avian nutritional muscular dystrophy by metabolizing peroxides and regulating redox/apoptotic signaling. Free Radic. Biol. Med. 2015, 83, 129–138. [Google Scholar] [CrossRef] [PubMed]
- Masaki, T.; Chiba, S.; Tatsukawa, H.; Yasuda, T.; Noguchi, H.; Seike, M.; Yoshimatsu, M. Adiponectin protects LPS-induced liver injury through modulation of TNF-α in KK-Ay obese mice. Hepatology 2004, 40, 177–184. [Google Scholar] [CrossRef] [PubMed]
- Véronique, B. Effects of Proinflammatory Agents on Oxygen Species Production by Bovine Mammary Epithelial and Immune Cells. Master’s Thesis, McGill University, Montreal, QC, Canada, 2000. [Google Scholar]
- Schmöcker, C.; Weylandt, K.H.; Kahlke, L.; Wang, J.; Lobeck, H.; Tiegs, G.; Berg, T.; Kang, J.X. Omega-3 fatty acids alleviate chemically induced acute hepatitis by suppression of cytokines. Hepatology 2007, 45, 864–869. [Google Scholar] [CrossRef] [PubMed]
- Vailati-Riboni, M.; Xu, T.; Qadir, B.; Buckrout, R.; Parys, C.; Loor, J.J. In vitro methionine supplementation during lipopolysaccharide stimulation modulates immune metabolic gene network expression in isolated polymorphonuclear cells from lactating Holstein cows. J. Dairy Sci. 2019, 102, 8343–8351. [Google Scholar] [CrossRef]
- Dai, H.; Coleman, D.N.; Hu, L.; Martinez-Cortés, I.; Wang, M.; Parys, C.; Shen, X.; Loor, J.J. Methionine and arginine supplementation alter inflammatory and oxidative stress responses during lipopolysaccharide challenge in bovine mammary epithelial cells in vitro. J. Dairy Sci. 2020, 103, 676–689. [Google Scholar] [CrossRef]
- Li, Q.; Liu, Y.L.; Che, Z.Q.; Zhu, H.L.; Meng, G.Q.; Hou, Y.Y. Dietary L-arginine supplementation alleviates liver injury caused by Escherichia coli LPS in weaned pigs. Innate Immun. 2012, 18, 804–814. [Google Scholar] [CrossRef]
- Li, Y.; Zhao, X.L.; Jiang, X.M.; Chen, L.; Hong, L.; Zhuo, Y.; Lin, Y.; Fang, Z.F.; Che, L.Q.; Feng, B.; et al. Effects of dietary supplementation with exogenous catalase on growth performance, oxidative stress, and hepatic apoptosis in weaned piglets challenged with lipopolysaccharide. J. Anim. Sci. 2020, 98, skaa067. [Google Scholar] [CrossRef] [PubMed]
- Swennen, Q.; Geraert, P.A.; Mercier, Y.; Everaert, N.; Stinckens, A.; Willemsen, H.; Li, Y.; Decuypere, E.; Buyse, J. Effects of dietary protein content and 2-hydroxy-4-methylthiobutanoic acid or DL-methionine supplementation on performance and oxidative status of broiler chickens. Br. J. Nutr. 2011, 106, 1845–1854. [Google Scholar] [CrossRef] [Green Version]
- Toborek, M.; Kopieczna-Grzebieniak, E.; Dr´ozdz, M.; Wieczorek, M. Increased lipid peroxidation as a mechanism of methionine-induced atherosclerosis in rabbits. Atherosclerosis 1995, 115, 217–224. [Google Scholar] [CrossRef]
- Wang, Z.G.; Pan, X.J.; Zhang, W.Q.; Peng, Z.Q.; Zhao, R.Q.; Zhou, G.H. Methionine and selenium yeast supplementation of the maternal diets affects antioxidant activity of breeding eggs. Poult. Sci. 2010, 89, 931–937. [Google Scholar] [CrossRef]
- Noor, Z.; Noor, M.; Khan, S.A.; Younas, W.; Ualiyeva, D.; Hassan, Z.; Yousafzai, A.M. Dietary supplementations of methionine improve growth performances, innate immunity, digestive enzymes, and antioxidant activities of rohu (Labeo rohita). Fish Physiol. Biochem. 2021, 47, 451–464. [Google Scholar] [CrossRef] [PubMed]
- Sun, L.; Pham, T.T.; Cornell, T.T.; McDonough, K.L.; McHugh, W.M.; Blatt, N.B.; Dahmer, M.K.; Shanley, T.P. Myeloid-specific gene deletion of protein phosphatase 2A magnifies MyD88- and TRIF-dependent inflammation following endotoxin challenge. J. Immunol. 2017, 198, 404–416. [Google Scholar] [CrossRef] [Green Version]
- Qiao, J.Y.; Sun, Z.Y.; Liang, D.M.; Li, H.H. Lactobacillus salivarius alleviates inflammation via NF-κB signaling in ETEC K88-induced IPEC-J2 cells. J. Anim. Sci. Biotechnol. 2020, 11, 76. [Google Scholar] [CrossRef]
- Bulgari, O.; Dong, X.W.; Roca, A.L.; Carli, A.M.; Loor, J.J. Innate immune responses induced by lipopolysaccharide and lipoteichoic acid in primary goat mammary epithelial cells. J. Anim. Sci. Biotechnol. 2017, 8, 28. [Google Scholar] [CrossRef] [PubMed]
- Walter, K.R.; Lin, X.; Jacobi, S.K.; Käser, T.; Esposito, D.; Odle, J. Dietary arachidonate in milk replacer triggers dual benefits of PGE2 signaling in LPS-challenged piglet alveolar macrophages. J. Anim. Sci. Biotechnol. 2019, 10, 13. [Google Scholar] [CrossRef]
- Chen, L.; Li, S.; Zheng, J.; Li, W.T.; Jiang, X.M.; Zhao, X.L.; Li, J.; Che, L.Q.; Lin, Y.; Xu, S.Y.; et al. Effects of dietary Clostridium butyricum supplementation on growth performance, intestinal development, and immune response of weaned piglets challenged with lipopolysaccharide. J. Anim. Sci. Biotechnol. 2018, 9, 62. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, K.L.; Chen, G.Y.; Cao, G.T.; Xu, Y.L.; Wang, Y.X.; Yang, C.M. Effects of Clostridium butyricum and Enterococcus faecalis on growth performance, intestinal structure, and inflammation in lipopolysaccharide-challenged weaned piglets. J. Anim. Sci. 2019, 97, 4140–4151. [Google Scholar] [CrossRef] [PubMed]
- Vijayan, V.; Khandelwal, M.; Manglani, K.; Gupta, S.; Surolia, A. Methionine down-regulates TLR4/MyD88/NF-κB signalling in osteoclast precursors to reduce bone loss during osteoporosis. Br. J. Pharmacol. 2014, 171, 107–121. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dai, H.; Coleman, D.N.; Lopes, M.G.; Hu, L.; Martinez-Cortés, I.; Parys, C.; Shen, X.; Loor, J.J. Alterations in immune and antioxidant gene networks by gamma-d-glutamyl-meso-diaminopimelic acid in bovine mammary epithelial cells are attenuated by in vitro supply of methionine and arginine. J. Dairy Sci. 2021, 104, 776–785. [Google Scholar] [CrossRef]
- Leng, W.B.; Liu, Y.L.; Shi, H.F.; Li, S.; Zhu, H.L.; Pi, D.A.; Hou, Y.Q. Aspartate alleviates liver injury and regulates mRNA expressions of TLR4 and NOD signaling-related genes in weaned pigs after lipopolysaccharide challenge. J. Nutr. Biochem. 2014, 25, 592–599. [Google Scholar] [CrossRef]
- Xu, X.; Wang, X.Y.; Wu, H.T.; Zhu, H.L.; Liu, C.C.; Hou, Y.Q.; Dai, B.; Liu, X.T.; Liu, Y.L. Glycine relieves intestinal injury by maintaining mTOR signaling and suppressing AMPK, TLR4, and NOD signaling in weaned piglets after lipopolysaccharide challenge. Int. J. Mol. Sci. 2018, 19, 1980. [Google Scholar] [CrossRef] [Green Version]
- Kang, P.; Wang, X.Y.; Wu, H.T.; Zhu, H.L.; Hou, Y.Q.; Wang, L.M.; Liu, Y.L. Glutamate alleviates muscle protein loss by modulating TLR4, NODs, Akt/FOXO and mTOR signaling pathways in LPS-challenged piglets. PLoS ONE 2017, 12, e0182246. [Google Scholar] [CrossRef] [Green Version]
- Liu, Y.L.; Wang, X.Y.; Hou, Y.Q.; Yin, Y.L.; Qiu, Y.S.; Wu, G.Y.; Hu, C.A. Roles of amino acids in preventing and treating intestinal diseases: Recent studies with pig models. Amino Acids 2017, 49, 1277–1291. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.C.; Mu, T.Q.; Jia, H.; Yang, Y.; Wu, Z.L. Protective effects of glycine against lipopolysaccharide-induced intestinal apoptosis and inflammation. Amino Acids 2021, 1–12. [Google Scholar] [CrossRef] [PubMed]
Ingredients (%) | Sows | Piglets | |
---|---|---|---|
Gestation | Lactation | Post-Weaning | |
Corn | 61.77 | 65.74 | 17.60 |
Expanded corn | - | - | 15.0 |
Wheat flour | - | - | 10.0 |
Wheat bran | 15 | - | - |
Soybean meal | 14 | 28 | - |
Expanded soybeans | - | - | 8.0 |
Fermented soybean meal | - | - | 5.0 |
Corn gluten feed | 2.0 | - | - |
Fish meal | - | - | 4.0 |
Whey powder | - | - | 12.0 |
Soybean oil | 3.5 | 2.5 | - |
Sugar | - | - | 8.0 |
Glucose | - | - | 6.0 |
Emulsified fat powder | - | - | 5.0 |
Plasma protein | - | - | 5.0 |
CaCO3 | 1.00 | 0.60 | 0.50 |
CaHPO4 | 1.20 | 1.70 | 1.50 |
Salt | 0.30 | 0.30 | 0.30 |
DL-Met | 0.07 | 0.06 | 0.30 |
L-Lys | 0.16 | 0.10 | 0.50 |
L-Thr | - | - | 0.30 |
Vitamin premix 2 | 0.50 | 0.50 | 0.50 |
Mineral premix 3 | 0.50 | 0.50 | 0.50 |
Crude protein (%) | 14.6 | 17.6 | 21.0 |
Digestible energy (MJ/kg) | 13.7 | 14.2 | 14.2 |
Total Lys (%) | 0.75 | 0.98 | 1.45 |
Total Met (%) | 0.29 | 0.32 | 0.48 |
Total Met + Cys (%) | 0.52 | 0.60 | 0.82 |
D Lys (%) | 0.65 | 0.85 | 1.30 |
SID Met (%) | 0.26 | 0.28 | 0.45 |
SID Met + Cys (%) | 0.45 | 0.52 | 0.72 |
Calcium (%) | 0.69 | 0.69 | 0.65 |
Total phosphorus (%) | 0.60 | 0.63 | 0.64 |
Gene | Accession | Forward (5′-3′) | Reverse (5′-3′) |
---|---|---|---|
TLR4 | NM_001113039.2 | TGCTTTCTCCGGGTCACTTC | TTAGGAACCACCTGCACGC |
MyD88 | NM_001099923.1 | GGCCCAGCATTGAAGAGGA | GACATCCAAGGGATGCTGCTA |
TRAF6 | NM_001105286.1 | TTGGCTGCCATGAAAAGATGC | CTGAGCAACAGCCAGAGGAA |
NOD1 | NM_001114277.1 | CAACCAAATCGGCGACGAAG | GCCGTTGAATGCAAGACTCAG |
NOD2 | NM_001105295.1 | CTGTGAGCAGCTGCAGAAGT | TGGTTGTTTCCCAGCCTCAAT |
NF-κB | NM_001048232.1 | AGTACCCTGAGGCTATAACTCGC | TCCGCAATGGAGGAGAAGTC |
COX2 | NC_000845.1 | ATGATCTACCCGCCTCACAC | AAAAGCAGCTCTGGGTCAAA |
TNF-α | NM_214022.1 | GGCCCAAGGACTCAGATCAT | CTGTCCCTCGGCTTTGACAT |
IL-6 | NM_214399.1 | CCCTGAGGCAAAAGGGAAAGAA | CTCAGGTGCCCCAGCTACAT |
IL-1β | NM_214055.1 | CCCAATTCAGGGACCCTACC | TTTTGGGTGCAGCACTTCAT |
IL-8 | NM_213867.1 | CTTCCAAACTGGCTGTTGCC | GTTGTTGTTGCTTCTCAGTTCTCT |
p53 | NM_213824.3 | TGTAACCTGCACGTACTCCC | TCGGCCCGTAAATTCCCTTC |
BCL2 | XM_021099593.1 | AGGATAACGGAGGCTGGGATG | CACTTATGGCCCAGATAGGCA |
β-actin | XM_003124280.5 | CTACACCGCTACCAGTTCGC | AGGGTCAGGATGCCTCTCTT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liu, M.; Zhang, Y.; Cao, K.-X.; Yang, R.-G.; Xu, B.-Y.; Zhang, W.-P.; Batonon-Alavo, D.I.; Zhang, S.-J.; Sun, L.-H. Increased Ingestion of Hydroxy-Methionine by Both Sows and Piglets Improves the Ability of the Progeny to Counteract LPS-Induced Hepatic and Splenic Injury with Potential Regulation of TLR4 and NOD Signaling. Antioxidants 2022, 11, 321. https://doi.org/10.3390/antiox11020321
Liu M, Zhang Y, Cao K-X, Yang R-G, Xu B-Y, Zhang W-P, Batonon-Alavo DI, Zhang S-J, Sun L-H. Increased Ingestion of Hydroxy-Methionine by Both Sows and Piglets Improves the Ability of the Progeny to Counteract LPS-Induced Hepatic and Splenic Injury with Potential Regulation of TLR4 and NOD Signaling. Antioxidants. 2022; 11(2):321. https://doi.org/10.3390/antiox11020321
Chicago/Turabian StyleLiu, Meng, Ying Zhang, Ke-Xin Cao, Ren-Gui Yang, Bao-Yang Xu, Wan-Po Zhang, Dolores I. Batonon-Alavo, Shu-Jun Zhang, and Lv-Hui Sun. 2022. "Increased Ingestion of Hydroxy-Methionine by Both Sows and Piglets Improves the Ability of the Progeny to Counteract LPS-Induced Hepatic and Splenic Injury with Potential Regulation of TLR4 and NOD Signaling" Antioxidants 11, no. 2: 321. https://doi.org/10.3390/antiox11020321
APA StyleLiu, M., Zhang, Y., Cao, K.-X., Yang, R.-G., Xu, B.-Y., Zhang, W.-P., Batonon-Alavo, D. I., Zhang, S.-J., & Sun, L.-H. (2022). Increased Ingestion of Hydroxy-Methionine by Both Sows and Piglets Improves the Ability of the Progeny to Counteract LPS-Induced Hepatic and Splenic Injury with Potential Regulation of TLR4 and NOD Signaling. Antioxidants, 11(2), 321. https://doi.org/10.3390/antiox11020321