l-Arginine Alleviates LPS-Induced Oxidative Stress and Apoptosis via Activating SIRT1-AKT-Nrf2 and SIRT1-FOXO3a Signaling Pathways in C2C12 Myotube Cells
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cell Culture and Treatment
2.2. Cell Viability
2.3. Intracellular ROS
2.4. Measurement of Antioxidant-Related Enzyme Activities
2.5. JC-1 Staining
2.6. Determination of Cell Apoptosis
2.7. Quantitative Real-Time PCR (qRT-PCR)
2.8. Nuclear and Cytoplasmic Extraction
2.9. Western Blotting
2.10. Statistical Analysis
3. Results
3.1. l-Arg Attenuated LPS-Mediated Cytotoxicity in Myotube Cells
3.2. l-Arg Mitigated LPS-Induced Oxidative Stress in Myotube Cells
3.3. l-Arg Mitigated LPS-Induced Apoptosis in Myotube Cells
3.4. l-Arg Increased the Expression Levels of SIRT1 in Myotube Cells
3.5. l-Arg Alleviated LPS-Induced Myotube Cells Oxidative Stress through SIRT1
3.6. l-Arg Alleviated LPS-Induced Myotube Cells Apoptosis by SIRT1
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Fanzani, A.; Conraads, V.M.; Penna, F.; Martinet, W. Molecular and cellular mechanisms of skeletal muscle atrophy: An update. J. Cachex Sarcopenia Muscle 2012, 3, 163–179. [Google Scholar] [CrossRef]
- Afzali, A.M.; Müntefering, T.; Wiendl, H.; Meuth, S.G.; Ruck, T. Skeletal muscle cells actively shape (auto) immune responses. Autoimmun. Rev. 2018, 17, 518–529. [Google Scholar] [CrossRef] [PubMed]
- Borges, R.C.; Barbeiro, H.V.; Barbeiro, D.F.; Soriano, F.G. Muscle degradation, vitamin D and systemic inflammation in hospitalized septic patients. J. Crit. Care 2020, 56, 125–131. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.; Liu, R.; Dai, Z.; Wu, H.; Lin, M.; Tian, F.; Gao, Z.; Zhao, X.; Sun, Y.; Pu, X. Effect of Shenfu injection on lipopolysaccharide (LPS)-induced septic shock in rabbits. J. Ethnopharmacol. 2019, 234, 36–43. [Google Scholar] [CrossRef] [PubMed]
- Shi, J.; Zhao, Y.; Wang, Y.; Gao, W.; Ding, J.; Li, P.; Hu, L.; Shao, F. Inflammatory caspases are innate immune receptors for intracellular LPS. Nature 2014, 514, 187–192. [Google Scholar] [CrossRef] [PubMed]
- Gou, Z.; Jiang, S.; Zheng, C.; Tian, Z.; Lin, X. Equol inhibits LPS-induced oxidative stress and enhances the immune response in chicken HD11 macrophages. Cell. Physiol. Biochem. 2015, 36, 611–621. [Google Scholar] [CrossRef] [PubMed]
- Plotnikov, E.Y.; Brezgunova, A.A.; Pevzner, I.B.; Zorova, L.D.; Manskikh, V.N.; Popkov, V.A.; Silachev, D.N.; Zorov, D.B. Mechanisms of LPS-induced acute kidney injury in neonatal and adult rats. Antioxidants 2018, 7, 105. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zorov, D.B.; Juhaszova, M.; Sollott, S.J. Mitochondrial reactive oxygen species (ROS) and ROS-induced ROS release. Physiol. Rev. 2014, 94, 909–950. [Google Scholar] [CrossRef] [Green Version]
- Lobo, V.; Patil, A.; Phatak, A.; Chandra, N. Free radicals, antioxidants and functional foods: Impact on human health. Pharmacogn. Rev. 2010, 4, 118. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, B.; Wu, C.; Chen, Z.; Zheng, P.; Liu, Y.; Xiong, J.; Xu, J.; Li, P.; Al Mamun, A.; Ye, L. DL-3-n-butylphthalide ameliorates diabetes-associated cognitive decline by enhancing PI3K/Akt signaling and suppressing oxidative stress. Acta Pharmacol. Sin. 2021, 42, 347–360. [Google Scholar] [CrossRef] [PubMed]
- Lu, J.; Huang, Q.; Zhang, D.; Lan, T.; Zhang, Y.; Tang, X.; Xu, P.; Zhao, D.; Cong, D.; Zhao, D. The protective effect of DiDang Tang against AlCl3-Induced oxidative stress and apoptosis in PC12 cells through the activation of SIRT1-mediated Akt/Nrf2/HO-1 pathway. Front. Pharmacol. 2020, 11, 466. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lu, C.; Yang, Y.; Li, C.; Liu, K.; Lii, C.; Chen, H. Andrographolide inhibits TNFα-induced ICAM-1 expression via suppression of NADPH oxidase activation and induction of HO-1 and GCLM expression through the PI3K/Akt/Nrf2 and PI3K/Akt/AP-1 pathways in human endothelial cells. Biochem. Pharmacol. 2014, 91, 40–50. [Google Scholar] [CrossRef]
- Simon, H.; Haj-Yehia, A.; Levi-Schaffer, F. Role of reactive oxygen species (ROS) in apoptosis induction. Apoptosis 2000, 5, 415–418. [Google Scholar] [CrossRef] [PubMed]
- Skurk, C.; Izumiya, Y.; Maatz, H.; Razeghi, P.; Shiojima, I.; Sandri, M.; Sato, K.; Zeng, L.; Schiekofer, S.; Pimentel, D. The FOXO3a transcription factor regulates cardiac myocyte size downstream of AKT signaling. J. Biol. Chem. 2005, 280, 20814–20823. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fan, J.; Yang, X.; Li, J.; Shu, Z.; Dai, J.; Liu, X.; Li, B.; Jia, S.; Kou, X.; Yang, Y. Spermidine coupled with exercise rescues skeletal muscle atrophy from D-gal-induced aging rats through enhanced autophagy and reduced apoptosis via AMPK-FOXO3a signal pathway. Oncotarget 2017, 8, 17475. [Google Scholar] [CrossRef] [Green Version]
- Luo, L.; Lu, A.; Wang, Y.; Hong, A.; Chen, Y.; Hu, J.; Li, X.; Qin, Z. Chronic resistance training activates autophagy and reduces apoptosis of muscle cells by modulating IGF-1 and its receptors, Akt/mTOR and Akt/FOXO3a signaling in aged rats. Exp. Gerontol. 2013, 48, 427–436. [Google Scholar] [CrossRef] [PubMed]
- Vaquero, A.; Scher, M.; Lee, D.; Erdjument-Bromage, H.; Tempst, P.; Reinberg, D. Human SirT1 interacts with histone H1 and promotes formation of facultative heterochromatin. Mol. Cell 2004, 16, 93–105. [Google Scholar] [CrossRef] [PubMed]
- Ma, R.; Liang, W.; Sun, Q.; Qiu, X.; Lin, Y.; Ge, X.; Jueraitetibaike, K.; Xie, M.; Zhou, J.; Huang, X. Sirt1/Nrf2 pathway is involved in oocyte aging by regulating Cyclin B1. Aging 2018, 10, 2991. [Google Scholar] [CrossRef] [PubMed]
- Zhao, X.; Liu, Y.; Zhu, G.; Liang, Y.; Liu, B.; Wu, Y.; Han, M.; Sun, W.; Han, Y.; Chen, G. SIRT1 downregulation mediated Manganese-induced neuronal apoptosis through activation of FOXO3a-Bim/PUMA axis. Sci. Total Environ. 2019, 646, 1047–1055. [Google Scholar] [CrossRef]
- Duan, J.; Cui, J.; Zheng, H.; Xi, M.; Guo, C.; Weng, Y.; Yin, Y.; Wei, G.; Cao, J.; Wang, Y. Aralia taibaiensis protects against I/R-induced brain cell injury through the Akt/SIRT1/FOXO3a pathway. Oxid. Med. Cell. Longev. 2019, 2019, 7609765. [Google Scholar] [CrossRef] [Green Version]
- Nieves, C., Jr.; Langkamp-Henken, B. Arginine and immunity: A unique perspective. Biomed. Pharmacother. 2002, 56, 471–482. [Google Scholar] [CrossRef]
- De Castro Barbosa, T.; Jiang, L.Q.; Zierath, J.R.; Nunes, M.T. L-arginine enhances glucose and lipid metabolism in rat L6 myotubes via the NO/c-GMP pathway. Metabolism 2013, 62, 79–89. [Google Scholar] [CrossRef]
- Qiu, Y.; Yang, X.; Wang, L.; Gao, K.; Jiang, Z. L-arginine inhibited inflammatory response and oxidative stress induced by lipopolysaccharide via arginase-1 signaling in IPEC-J2 cells. Int. J. Mol. Sci. 2019, 20, 1800. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Flynn, N.E.; Meininger, C.J.; Haynes, T.E.; Wu, G. The metabolic basis of arginine nutrition and pharmacotherapy. Biomed. Pharmacother. 2002, 56, 427–438. [Google Scholar] [CrossRef]
- Zhang, H.; Peng, A.; Yu, Y.; Guo, S.; Wang, M.; Wang, H. L-arginine protects ovine intestinal epithelial cells from lipopolysaccharide-induced apoptosis through alleviating oxidative stress. J. Agric. Food Chem. 2019, 67, 1683–1690. [Google Scholar] [CrossRef]
- Zhang, Y.F.; Yang, J.Y.; Meng, X.P.; Nie, N.; Tang, M.C.; Yang, X.L. L-arginine protects mouse Leydig cells against T-2 toxin-induced apoptosis in vitro. Toxicol. Ind. Health 2020, 36, 1031–1038. [Google Scholar] [CrossRef] [PubMed]
- Greene, J.M.; Feugang, J.M.; Pfeiffer, K.E.; Stokes, J.V.; Bowers, S.D.; Ryan, P.L. L-arginine enhances cell proliferation and reduces apoptosis in human endometrial RL95-2 cells. Reprod. Biol. Endocrinol. 2013, 11, 15. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, X.; Guo, Y.; Jia, G.; Liu, G.; Zhao, H.; Huang, Z. Arginine promotes skeletal muscle fiber type transformation from fast-twitch to slow-twitch via Sirt1/AMPK pathway. J. Nutr. Biochem. 2018, 61, 155–162. [Google Scholar] [CrossRef] [PubMed]
- Zhang, M.; Li, Y.; Guo, Y.; Xu, J. Arginine regulates NLRP3 inflammasome activation through SIRT1 in vascular endothelial cells. Inflammation 2021, 44, 1370–1380. [Google Scholar] [CrossRef]
- Alcendor, R.R.; Gao, S.; Zhai, P.; Zablocki, D.; Holle, E.; Yu, X.; Tian, B.; Wagner, T.; Vatner, S.F.; Sadoshima, J. Sirt1 regulates aging and resistance to oxidative stress in the heart. Circ. Res. 2007, 100, 1512–1521. [Google Scholar] [CrossRef] [PubMed]
- Sies, H.; Jones, D.P. Reactive oxygen species (ROS) as pleiotropic physiological signalling agents. Nat. Rev. Mol. Cell Biol. 2020, 21, 363–383. [Google Scholar] [CrossRef]
- Guha, M.; Mackman, N. LPS induction of gene expression in human monocytes. Cell. Signal. 2001, 13, 85–94. [Google Scholar] [CrossRef]
- Liang, M.; Wang, Z.; Li, H.; Cai, L.; Pan, J.; He, H.; Wu, Q.; Tang, Y.; Ma, J.; Yang, L. L-arginine induces antioxidant response to prevent oxidative stress via stimulation of glutathione synthesis and activation of Nrf2 pathway. Food Chem. Toxicol. 2018, 115, 315–328. [Google Scholar] [CrossRef] [PubMed]
- Gong, L.; Zhang, X.; Qiu, K.; He, L.; Wang, Y.; Yin, J. Arginine promotes myogenic differentiation and myotube formation through the elevation of cytoplasmic calcium concentration. Anim. Nutr. 2021, 7, 1115–1123. [Google Scholar] [CrossRef] [PubMed]
- Long, H.D.; Lira, V.A.; Soltow, Q.A.; Betters, J.L.; Sellman, J.E.; Criswell, D.S. Arginine supplementation induces myoblast fusion via augmentation of nitric oxide production. J. Muscle Res. Cell Motil. 2006, 27, 577–584. [Google Scholar] [CrossRef]
- Meininger, C.J.; Wu, G. Regulation of endothelial cell proliferation by nitric oxide. Method. Enzymol. 2002, 352, 280–295. [Google Scholar]
- Shang, K.; Zhang, J.; Amna, T.; Yang, J.; Cheng, X.; Zhang, C.; Hwang, I. Attenuation of cellular toxicity by calpain inhibitor induced by bacterial endotoxin: A mechanistic study using muscle precursor cells as a model system. Mol. Biol. Rep. 2015, 42, 1281–1288. [Google Scholar] [CrossRef] [PubMed]
- Liu, S.; Adewole, D.; Yu, L.; Sid, V.; Wang, B.; Karmin, O.; Yang, C. Rutin attenuates inflammatory responses induced by lipopolysaccharide in an in vitro mouse muscle cell (C2C12) model. Poultry Sci. 2019, 98, 2756–2764. [Google Scholar] [CrossRef] [PubMed]
- Kozakowska, M.; Pietraszek-Gremplewicz, K.; Jozkowicz, A.; Dulak, J. The role of oxidative stress in skeletal muscle injury and regeneration: Focus on antioxidant enzymes. J. Muscle Res. Cell Motil. 2015, 36, 377–393. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pirinccioglu, A.G.; Gökalp, D.; Pirinccioglu, M.; Kizil, G.; Kizil, M. Malondialdehyde (MDA) and protein carbonyl (PCO) levels as biomarkers of oxidative stress in subjects with familial hypercholesterolemia. Clin. Biochem. 2010, 43, 1220–1224. [Google Scholar] [CrossRef] [PubMed]
- Vucetic, M.; Stancic, A.; Otasevic, V.; Jankovic, A.; Korac, A.; Markelic, M.; Velickovic, K.; Golic, I.; Buzadzic, B.; Storey, K.B. The impact of cold acclimation and hibernation on antioxidant defenses in the ground squirrel (Spermophilus citellus): An update. Free Radic. Biol. Med. 2013, 65, 916–924. [Google Scholar] [CrossRef]
- Gao, Y.; Dong, C.; Yin, J.; Shen, J.; Tian, J.; Li, C. Neuroprotective effect of fucoidan on H2O2-induced apoptosis in PC12 cells via activation of PI3K/Akt pathway. Cell. Mol. Neurobiol. 2012, 32, 523–529. [Google Scholar] [CrossRef]
- Ma, J.; Li, S.; Zhu, L.; Guo, S.; Yi, X.; Cui, T.; He, Y.; Chang, Y.; Liu, B.; Li, C. Baicalein protects human vitiligo melanocytes from oxidative stress through activation of NF-E2-related factor2 (Nrf2) signaling pathway. Free Radic. Biol. Med. 2018, 129, 492–503. [Google Scholar] [CrossRef] [PubMed]
- Cui, L.; Zhou, Q.; Zheng, X.; Sun, B.; Zhao, S. Mitoquinone attenuates vascular calcification by suppressing oxidative stress and reducing apoptosis of vascular smooth muscle cells via the Keap1/Nrf2 pathway. Free Radic. Biol. Med. 2020, 161, 23–31. [Google Scholar] [CrossRef]
- Taguchi, K.; Motohashi, H.; Yamamoto, M. Molecular mechanisms of the Keap1-Nrf2 pathway in stress response and cancer evolution. Genes Cells 2011, 16, 123–140. [Google Scholar] [CrossRef]
- Lu, M.C.; Ji, J.A.; Jiang, Z.Y.; You, Q.D. The Keap1-Nrf2-ARE pathway as a potential preventive and therapeutic target: An update. Med. Res. Rev. 2016, 36, 924–963. [Google Scholar] [CrossRef] [PubMed]
- Motohashi, H.; Yamamoto, M. Nrf2-Keap1 defines a physiologically important stress response mechanism. Trends Mol. Med. 2004, 10, 549–557. [Google Scholar] [CrossRef] [PubMed]
- Nakaso, K.; Yano, H.; Fukuhara, Y.; Takeshima, T.; Wada-Isoe, K.; Nakashima, K. PI3K is a key molecule in the Nrf2-mediated regulation of antioxidative proteins by hemin in human neuroblastoma cells. FEBS Lett. 2003, 546, 181–184. [Google Scholar] [CrossRef] [Green Version]
- Zhuang, Y.; Wu, H.; Wang, X.; He, J.; He, S.; Yin, Y. Resveratrol attenuates oxidative stress-induced intestinal barrier injury through PI3K/Akt-mediated Nrf2 signaling pathway. Oxid. Med. Cell. Longev. 2019, 2019, 7591840. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hung, C.H.; Cheng, S.S.; Cheung, Y.; Wuwongse, S.; Zhang, N.Q.; Ho, Y.; Lee, S.M.; Chang, R.C. A reciprocal relationship between reactive oxygen species and mitochondrial dynamics in neurodegeneration. Redox Biol. 2018, 14, 7–19. [Google Scholar] [CrossRef]
- Yee, C.; Yang, W.; Hekimi, S. The intrinsic apoptosis pathway mediates the pro-longevity response to mitochondrial ROS in C. elegans. Cell 2014, 157, 897–909. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kluck, R.M.; Bossy-Wetzel, E.; Green, D.R.; Newmeyer, D.D. The release of cytochrome c from mitochondria: A primary site for Bcl-2 regulation of apoptosis. Science 1997, 275, 1132–1136. [Google Scholar] [CrossRef] [Green Version]
- Suzuki, M.; Youle, R.J.; Tjandra, N. Structure of Bax: Coregulation of dimer formation and intracellular localization. Cell 2000, 103, 645–654. [Google Scholar] [CrossRef] [Green Version]
- Edlich, F.; Banerjee, S.; Suzuki, M.; Cleland, M.M.; Arnoult, D.; Wang, C.; Neutzner, A.; Tjandra, N.; Youle, R.J. Bcl-xL retrotranslocates Bax from the mitochondria into the cytosol. Cell 2011, 145, 104–116. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Garcia-Saez, A.J. The secrets of the Bcl-2 family. Cell Death Differ. 2012, 19, 1733–1740. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lv, Y.; Zeng, J.; Lu, J.; Zhang, X.; Xu, P.; Su, Y. Porphyromonas gingivalis lipopolysaccharide (Pg-LPS) influences adipocytes injuries through triggering XBP1 and activating mitochondria-mediated apoptosis. Adipocyte 2021, 10, 28–37. [Google Scholar] [CrossRef]
- Dou, C.; Ding, N.; Xing, J.; Zhao, C.; Kang, F.; Hou, T.; Quan, H.; Chen, Y.; Dai, Q.; Luo, F. Dihydroartemisinin attenuates lipopolysaccharide-induced osteoclastogenesis and bone loss via the mitochondria-dependent apoptosis pathway. Cell Death Dis. 2016, 7, e2162. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, H.; Zhao, F.; Peng, A.; Guo, S.; Wang, M.; Elsabagh, M.; Loor, J.J.; Wang, H. L-arginine inhibits apoptosis of ovine intestinal epithelial cells through the L-arginine-nitric oxide pathway. J. Nutr. 2020, 150, 2051–2060. [Google Scholar] [CrossRef]
- Ma, X.; Zhang, Y.; Jiang, D.; Yang, Y.; Wu, G.; Wu, Z. Protective effects of functional amino acids on apoptosis, inflammatory response, and pulmonary fibrosis in lipopolysaccharide-challenged mice. J. Agric. Food Chem. 2019, 67, 4915–4922. [Google Scholar] [CrossRef] [PubMed]
- Seoane, J.; Le, H.; Shen, L.; Anderson, S.A.; Massagué, J. Integration of Smad and forkhead pathways in the control of neuroepithelial and glioblastoma cell proliferation. Cell 2004, 117, 211–223. [Google Scholar] [CrossRef] [Green Version]
- Zhao, J.; Brault, J.J.; Schild, A.; Cao, P.; Sandri, M.; Schiaffino, S.; Lecker, S.H.; Goldberg, A.L. FoxO3 coordinately activates protein degradation by the autophagic/lysosomal and proteasomal pathways in atrophying muscle cells. Cell Metab. 2007, 6, 472–483. [Google Scholar] [CrossRef] [Green Version]
- Zhao, Y.; Li, J.; Jiang, Q.; Zhou, X.; Feng, L.; Liu, Y.; Jiang, W.; Wu, P.; Zhou, J.; Zhao, J. Leucine improved growth performance, muscle growth, and muscle protein deposition through AKT/TOR and AKT/FOXO3a signaling pathways in hybrid catfish Pelteobagrus vachelli × Leiocassis longirostris. Cells 2020, 9, 327. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Brunet, A.; Bonni, A.; Zigmond, M.J.; Lin, M.Z.; Juo, P.; Hu, L.S.; Anderson, M.J.; Arden, K.C.; Blenis, J.; Greenberg, M.E. Akt promotes cell survival by phosphorylating and inhibiting a Forkhead transcription factor. Cell 1999, 96, 857–868. [Google Scholar] [CrossRef] [Green Version]
- Xu, G.; Zhao, J.; Liu, H.; Wang, J.; Lu, W. Melatonin inhibits apoptosis and oxidative stress of mouse leydig cells via a SIRT1-dependent mechanism. Molecules 2019, 24, 3084. [Google Scholar] [CrossRef] [Green Version]
- Ye, J.; Liu, Z.; Wei, J.; Lu, L.; Huang, Y.; Luo, L.; Xie, H. Protective effect of SIRT1 on toxicity of microglial-derived factors induced by LPS to PC12 cells via the p53-caspase-3-dependent apoptotic pathway. Neurosci. Lett. 2013, 553, 72–77. [Google Scholar] [CrossRef]
- Zhang, H.; Shan, Y.; Wu, Y.; Xu, C.; Yu, X.; Zhao, J.; Yan, J.; Shang, W. Berberine suppresses LPS-induced inflammation through modulating Sirt1/NF-κB signaling pathway in RAW264. 7 cells. Int. Immunopharmacol. 2017, 52, 93–100. [Google Scholar] [CrossRef]
- Guo, T.; Jiang, Z.; Zhou, Y.; Chai, X.; Xiao, X. Shikonin ameliorates LPS-induced cardiac dysfunction by SIRT1-dependent pathways in mice. Front. Physiol. 2020, 11, 1278. [Google Scholar] [CrossRef]
- Zhao, L.; An, R.; Yang, Y.; Yang, X.; Liu, H.; Yue, L.; Li, X.; Lin, Y.; Reiter, R.J.; Qu, Y. Melatonin alleviates brain injury in mice subjected to cecal ligation and puncture via attenuating inflammation, apoptosis, and oxidative stress: The role of SIRT 1 signaling. J. Pineal Res. 2015, 59, 230–239. [Google Scholar] [CrossRef] [PubMed]
- Ohata, Y.; Matsukawa, S.; Moriyama, Y.; Michiue, T.; Morimoto, K.; Sato, Y.; Kuroda, H. Sirtuin inhibitor Ex-527 causes neural tube defects, ventral edema formations, and gastrointestinal malformations in Xenopus laevis embryos. Dev. Growth Differ. 2014, 56, 460–468. [Google Scholar] [CrossRef] [Green Version]
- Xu, G.; Zhao, X.; Fu, J.; Wang, X. Resveratrol increase myocardial Nrf2 expression in type 2 diabetic rats and alleviate myocardial ischemia/reperfusion injury (MIRI). Ann. Palliat. Med. 2019, 8, 565–575. [Google Scholar] [CrossRef]
- Yang, G.; Jin, L.; Zheng, D.; Tang, X.; Yang, J.; Fan, L.; Xie, X. Fucoxanthin alleviates oxidative stress through Akt/Sirt1/FoxO3α signaling to inhibit HG-induced renal fibrosis in GMCs. Mar. Drugs 2019, 17, 702. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sundaresan, N.R.; Pillai, V.B.; Wolfgeher, D.; Samant, S.; Vasudevan, P.; Parekh, V.; Raghuraman, H.; Cunningham, J.M.; Gupta, M.; Gupta, M.P. The deacetylase SIRT1 promotes membrane localization and activation of Akt and PDK1 during tumorigenesis and cardiac hypertrophy. Sci. Signal. 2011, 4, ra46. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tian, G.; Yu, Y.; Deng, H.; Yang, L.; Shi, X.; Yu, B. Empagliflozin alleviates ethanol-induced cardiomyocyte injury through inhibition of mitochondrial apoptosis via a SIRT1/PTEN/Akt pathway. Clin. Exp. Pharmacol. Physiol. 2021, 48, 837–845. [Google Scholar] [CrossRef]
- Danz, E.D.B.; Skramsted, J.; Henry, N.; Bennett, J.A.; Keller, R.S. Resveratrol prevents doxorubicin cardiotoxicity through mitochondrial stabilization and the Sirt1 pathway. Free Radic. Biol. Med. 2009, 46, 1589–1597. [Google Scholar] [CrossRef] [PubMed]
- Chen, T.; Dai, S.; Li, X.; Luo, P.; Zhu, J.; Wang, Y.; Fei, Z.; Jiang, X. Sirt1-Sirt3 axis regulates human blood-brain barrier permeability in response to ischemia. Redox Biol. 2018, 14, 229–236. [Google Scholar] [CrossRef]
- Guan, R.; Cai, Z.; Wang, J.; Ding, M.; Li, Z.; Xu, J.; Li, Y.; Li, J.; Yao, H.; Liu, W. Hydrogen sulfide attenuates mitochondrial dysfunction-induced cellular senescence and apoptosis in alveolar epithelial cells by upregulating sirtuin 1. Aging 2019, 11, 11844. [Google Scholar] [CrossRef]








| Gene Name | Sequence (5′-3′) | TM (°C) |
|---|---|---|
| SIRT1 | QF: AGGGAACCTTTGCCTCATCTA | 61.4 |
| QR: ATTGTTGTTTGTTGCTTGGTCTAC | ||
| Akt | QF: TACTCATTCCAGACCCACGACC | 60.4 |
| QR: GCAAGTAGTCCAGGGCAGACAC | ||
| FOXO3a | QF: TGGATGCGTGGACCGACTT | 61.4 |
| QR: CCAGCCCATCATTCAGATTCAT | ||
| Nrf2 | QF: TTTCAACCCGAAGCACGC | 56.9 |
| QR: TTTCACATTGGGATTCACGC | ||
| Keap1 | QF: TGCCCCTGTGGTCAAAGTG | 59.4 |
| QR: GGTTCGGTTACCGTCCTGC | ||
| MnSOD | QF: ACAATCTCAACGCCACCGA | 60.3 |
| QR: CCAGCCTGAACCTTGGACTC | ||
| CAT | QF: CACTGACGAGATGGCACACT | 59.4 |
| QR: TGTGGAGAATCGAACGGCAA | ||
| GSH-px | QF: CAGGAGAATGGCAAGAATGAAG | 56.9 |
| QR: GGAAGGTAAAGAGCGGGTGA | ||
| Bcl-2 | QF: AACCCAATGCCCGCTGT | 60.4 |
| QR: CCTGAAGAGTTCCTCCACCAC | ||
| BAX | QF: TGCTACAGGGTTTCATCCAGG | 58.4 |
| QR: TGCTGTCCAGTTCATCTCCAAT | ||
| Caspase-9 | QF: CCTTCCCAGGTTTTGTCTCC | 60.4 |
| QR: GCTTGTAAGTCCCTTTCGCAG | ||
| Caspase-3 | QF: TGACTGGAAAGCCGAAACTCT | 60.4 |
| QR: GGGACTGGATGAACCACGAC | ||
| β-actin | QF: GATGGTGGGAATGGGTCAGA | 59.0 |
| QR: TCAATGGGGTACTTCAGGGTC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhao, Y.; Jiang, Q.; Zhang, X.; Zhu, X.; Dong, X.; Shen, L.; Zhang, S.; Niu, L.; Chen, L.; Zhang, M.; et al. l-Arginine Alleviates LPS-Induced Oxidative Stress and Apoptosis via Activating SIRT1-AKT-Nrf2 and SIRT1-FOXO3a Signaling Pathways in C2C12 Myotube Cells. Antioxidants 2021, 10, 1957. https://doi.org/10.3390/antiox10121957
Zhao Y, Jiang Q, Zhang X, Zhu X, Dong X, Shen L, Zhang S, Niu L, Chen L, Zhang M, et al. l-Arginine Alleviates LPS-Induced Oxidative Stress and Apoptosis via Activating SIRT1-AKT-Nrf2 and SIRT1-FOXO3a Signaling Pathways in C2C12 Myotube Cells. Antioxidants. 2021; 10(12):1957. https://doi.org/10.3390/antiox10121957
Chicago/Turabian StyleZhao, Ye, Qin Jiang, Xuefei Zhang, Xiaoxiao Zhu, Xia Dong, Linyuan Shen, Shunhua Zhang, Lili Niu, Lei Chen, Ming Zhang, and et al. 2021. "l-Arginine Alleviates LPS-Induced Oxidative Stress and Apoptosis via Activating SIRT1-AKT-Nrf2 and SIRT1-FOXO3a Signaling Pathways in C2C12 Myotube Cells" Antioxidants 10, no. 12: 1957. https://doi.org/10.3390/antiox10121957
APA StyleZhao, Y., Jiang, Q., Zhang, X., Zhu, X., Dong, X., Shen, L., Zhang, S., Niu, L., Chen, L., Zhang, M., Jiang, J., Chen, D., & Zhu, L. (2021). l-Arginine Alleviates LPS-Induced Oxidative Stress and Apoptosis via Activating SIRT1-AKT-Nrf2 and SIRT1-FOXO3a Signaling Pathways in C2C12 Myotube Cells. Antioxidants, 10(12), 1957. https://doi.org/10.3390/antiox10121957

