Extracts of Waste from Poplar Wood Processing Alleviate Experimental Dextran Sulfate-Induced Colitis by Ameliorating Oxidative Stress, Inhibiting the Th1/Th17 Response and Inducing Apoptosis in Inflammatory Lymphocytes
Abstract
:1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Animals
2.3. Preparation and Analysis of the Extract of Poplar Sawdust (PS)and Poplar Leaves (PL)
2.4. Cell Viability and Apoptosis Assays
2.5. Induction and Assessment of Colitis
2.6. Analysis of Helper T Cell (Th) Subsets in Splenic Lymphocytes
2.7. Quantitative RT-PCR
2.8. Western Blot Analysis
2.9. Histological Analysis
2.10. Molecular Docking Analysis
2.11. Statistical Analysis
3. Results
3.1. The Ethyl Acetate Extracts from the Ethanol Extract of PS and PL Showed Excellent Anti-Inflammatory Effects
3.2. PSE and PLE Ameliorate the Pathological Changes of DSS-Induced Colitis in Mice
3.3. PSE and PLE Inhibit Oxidative Stress in the Colon of DSS-Induced Colitis Mice
3.4. PSE and PLE Enhance Antioxidant Capacity in Mice through the Activation of ERK/Nrf2 Pathway
3.5. PSE and PLE Regulate Cytokine Profiles in the Spleen of Colitis Mice
3.6. PSE and PLE Down-Regulate the Phosphorylation of STAT1, STAT3 and p65 in the Model of Inflammation
3.7. PSE and PLE Inhibit Proliferation of Activated Lymphocytes through Induction of Apoptosis
3.8. PSE and PLE May Induce Lymphocyte Apoptosis and Ameliorate Inflammation through Activation of STING-TBK1 Pathway
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Hou, Y.; Wang, L.; Yi, D.; Ding, B.; Chen, X.; Wang, Q.; Zhu, H.; Liu, Y.; Yin, Y.; Gong, J.; et al. Dietary supplementation with tributyrin alleviates intestinal injury in piglets challenged with intrarectal administration of acetic acid. Br. J. Nutr. 2014, 111, 1748–1758. [Google Scholar] [CrossRef] [Green Version]
- Choi, J.H.; Chung, K.S.; Jin, B.R.; Cheon, S.Y.; Nugroho, A.; Roh, S.S.; An, H.J. Anti-inflammatory effects of an ethanol extract of Aster glehni via inhibition of NF-κB activation in mice with DSS-induced colitis. Food Funct. 2017, 8, 2611–2620. [Google Scholar] [CrossRef] [PubMed]
- Bao, X.; Feng, Z.; Yao, J.; Li, T.; Yin, Y. Roles of dietary amino acids and their metabolites in pathogenesis of inflammatory bowel disease. Mediat. Inflamm. 2017, 2017, 6869259. [Google Scholar] [CrossRef]
- Tinh, N.T.T.; Sitolo, G.C.; Yamamoto, Y.; Suzuki, T. Citrus limon peel powder reduces intestinal barrier defects and inflammation in a colitic murine experimental model. Foods 2021, 10, 2. [Google Scholar] [CrossRef]
- Zou, Y.; Lin, J.; Li, W.; Wu, Z.; He, Z.; Huang, G.; Wang, J.; Ye, C.; Cheng, X.; Ding, C.; et al. Huangqin-tang ameliorates dextran sodium sulphate-induced colitis by regulating intestinal epithelial cell homeostasis, inflammation and immune response. Sci. Rep. 2016, 6, 39299. [Google Scholar] [CrossRef]
- Zhao, L.; Zhang, Y.; Liu, G.; Hao, S.; Wang, C.; Wang, Y. Black rice anthocyanin-rich extract and rosmarinic acid, alone and in combination, protect against DSS-induced colitis in mice. Food Funct. 2018, 9, 2796–2808. [Google Scholar] [CrossRef]
- Xiao, H.T.; Wen, B.; Shen, X.C.; Bian, Z.X. Potential of plant-sourced phenols for inflammatory bowel disease. Curr. Med. Chem. 2018, 25, 5191–5217. [Google Scholar] [CrossRef]
- López-García, G.; Cilla, A.; Barberá, R.; Alegría, A.; Recio, M.C. Effect of a milk-based fruit beverage Enriched with plant sterols and/or galactooligosaccharides in a murine chronic colitis model. Foods 2019, 8, 4. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rehill, B.J.; Whitham, T.G.; Martinsen, G.D.; Schweitzer, J.A.; Bailey, J.K.; Lindroth, R.L. Developmental trajectories in cottonwood phytochemistry. J. Chem. Ecol. 2006, 32, 2269–2285. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Si, C.L.; Shen, T.; Jiang, Y.Y.; Wu, L.; Yu, G.J.; Ren, X.D.; Xu, G.H.; Hu, W.C. Antioxidant properties and neuroprotective effects of isocampneoside II on hydrogen peroxide-induced oxidative injury in PC12 cells. Food Chem. Toxicol. 2013, 59, 145–152. [Google Scholar] [CrossRef]
- Cheenpracha, S.; Park, E.J.; Yoshida, W.Y.; Barit, C.; Wall, M.; Pezzuto, J.M.; Chang, L.C. Potential anti-inflammatory phenolic glycosides from the medicinal plant Moringa oleifera fruits. Bioorg. Med. Chem. 2010, 18, 6598–6602. [Google Scholar] [CrossRef]
- Kumar, M.; Rawat, P.; Khan, M.F.; Tamarkar, A.K.; Srivastava, A.K.; Arya, K.R.; Maurya, R. Phenolic glycosides from Dodecadenia grandiflora and their glucose-6-phosphatase inhibitory activity. Fitoterapia 2010, 81, 475–479. [Google Scholar] [CrossRef] [PubMed]
- Firashathulla, S.; Inamdar, M.N.; Rafiq, M.; Viswanatha, G.L.; Kumar, L.M.S.; Babu, U.V.; Ramakrishnan, S.; Paramesh, R. IM-133N—A useful herbal combination for eradicating disease-triggering pathogens in mice via immunotherapeutic mechanisms. J. Pharmacopunct. 2016, 19, 21–27. [Google Scholar]
- Zhang, X.; Thuong, P.T.; Min, B.S.; Ngoc, T.M.; Hung, T.M.; Lee, I.S.; Na, M.; Seong, Y.H.; Song, K.S.; Bae, K. Phenolic glycosides with antioxidant activity from the stem bark of Populus davidiana. J. Nat. Prod. 2006, 69, 1370–1373. [Google Scholar] [CrossRef]
- Bonifácio-Lopes, T.; Boas, A.A.V.; Coscueta, E.R.; Costa, E.M.; Silva, S.; Campos, D.; Teixeira, J.A.; Pintado, M. Bioactive extracts from brewer's spent grain. Food Funct. 2020, 11, 8963–8977. [Google Scholar] [CrossRef] [PubMed]
- Pacheco, M.T.; Vezza, T.; Diez-Echave, P.; Utrilla, P.; Villamiel, M.; Moreno, F.J. Anti-inflammatory bowel effect of industrial orange by-products in DSS-treated mice. Food Funct. 2018, 9, 4888–4896. [Google Scholar] [CrossRef] [Green Version]
- Choleva, M.; Boulougouri, V.; Panara, A.; Panagopoulou, E.; Chiou, A.; Thomaidis, N.S.; Antonopoulou, S.; Fragopoulou, E. Evaluation of anti-platelet activity of grape pomace extracts. Food Funct. 2019, 10, 8069–8080. [Google Scholar] [CrossRef] [PubMed]
- Peng, S.; Wei, P.; Lu, Q.; Liu, R.; Ding, Y.; Zhang, J. Beneficial effects of poplar buds on hyperglycemia, dyslipidemia, oxidative stress, and inflammation in streptozotocin-induced type-2 diabetes. J. Immunol. Res. 2018, 2018, 7245956. [Google Scholar] [CrossRef] [Green Version]
- Jeong, Y.E.; Lee, M.Y. Anti-Inflammatory activity of Populus deltoides leaf extract via modulating NF-κB and p38/JNK pathways. Int. J. Mol. Sci. 2018, 19, 3746. [Google Scholar] [CrossRef] [Green Version]
- Zhou, J.; Yang, Y.; Wang, Y.L.; Zhao, Y.; Ye, W.J.; Deng, S.Y.; Lang, J.Y.; Lu, S. Enhancer of zeste homolog 2 contributes to apoptosis by inactivating janus kinase 2/ signal transducer and activator of transcription signaling in inflammatory bowel disease. World J. Gastroenterol. 2021, 27, 3073–3084. [Google Scholar] [CrossRef] [PubMed]
- Pobłocka-Olech, L.; Głód, D.; Jesionek, A.; Łuczkiewicz, M.; Krauze-Baranowska, M. Studies on the polyphenolic composition and the antioxidant properties of the leaves of poplar (Populus spp.) various species and hybrids. Chem. Biodivers. 2021, 18, e2100227. [Google Scholar] [CrossRef]
- Xiao, H.T.; Peng, J.; Wen, B.; Hu, D.D.; Hu, X.P.; Shen, X.C.; Liu, Z.G.; He, Z.D.; Bian, Z.X. Indigo naturalis suppresses colonic oxidative stress and Th1/Th17 responses of DSS-Induced colitis in mice. Oxid. Med. Cell Longev. 2019, 2019, 9480945. [Google Scholar] [CrossRef]
- Rana, M.N.; Lu, J.; Xue, E.; Ruan, J.; Liu, Y.; Zhang, L.; Dhar, R.; Li, Y.; Hu, Z.; Zhou, J.; et al. PDE9 inhibitor PF-04447943 attenuates DSS-Induced colitis by suppressing oxidative stress, inflammation, and regulating T-cell polarization. Front. Pharmacol. 2021, 12, 643215. [Google Scholar] [CrossRef]
- Peng, J.; Lu, J.W.; Lee, C.H.; Lee, H.S.; Chu, Y.H.; Ho, Y.J.; Liu, F.C.; Huang, C.J.; Wu, C.C.; Wang, C.C. Cardamonin attenuates inflammation and oxidative stress in interleukin-1β-stimulated osteoarthritis chondrocyte through the Nrf2 pathway. Antioxidants 2021, 10, 6. [Google Scholar] [CrossRef] [PubMed]
- Tang, K.T.; Lin, C.C.; Lin, S.C.; Wang, J.H.; Tsai, S.W. Kurarinone attenuates collagen-induced arthritis in mice by inhibiting Th1/Th17 cell responses and oxidative stress. Int. J. Mol. Sci. 2021, 22, 8. [Google Scholar] [CrossRef] [PubMed]
- Tao, F.; Qian, C.; Guo, W.; Luo, Q.; Xu, Q.; Sun, Y. Inhibition of Th1/Th17 responses via suppression of STAT1 and STAT3 activation contributes to the amelioration of murine experimental colitis by a natural flavonoid glucoside icariin. Biochem. Pharmacol. 2013, 85, 798–807. [Google Scholar] [CrossRef] [PubMed]
- Hsia, H.C.; Hutti, J.E.; Baldwin, A.S. Cytosolic DNA promotes signal transducer and activator of transcription 3 (STAT3) phosphorylation by TANK-binding Kinase 1 (TBK1) to restrain STAT3 activity. J. Biol. Chem. 2017, 292, 5405–5417. [Google Scholar] [CrossRef] [Green Version]
- Zhu, Q.; Man, S.M.; Gurung, P.; Liu, Z.; Vogel, P.; Lamkanfi, M.; Kanneganti, T.D. Cutting edge: STING mediates protection against colorectal tumorigenesis by governing the magnitude of intestinal inflammation. J. Immunol. 2014, 193, 4779–4782. [Google Scholar] [CrossRef]
- Dong, G.; You, M.; Ding, L.; Fan, H.; Liu, F.; Ren, D.; Hou, Y. STING negatively negulates double-stranded DNA-activated JAK1-STAT1 signaling via SHP-1/2 in B cells. Mol. Cells 2015, 38, 441–451. [Google Scholar] [CrossRef] [Green Version]
- Decout, A.; Katz, J.D.; Venkatraman, S.; Ablasser, A. The cGAS-STING pathway as a therapeutic target in inflammatory diseases. Nat. Rev. Immunol. 2021, 9, 548–569. [Google Scholar] [CrossRef]
- Larkin, B.; Ilyukha, V.; Sorokin, M.; Buzdin, A.; Vannier, E.; Poltorak, A. Cutting Edge: Activation of STING in T cells induces type I IFN responses and cell death. J. Immunol. 2017, 199, 397–402. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tang, C.H.; Zundell, J.A.; Ranatunga, S.; Lin, C.; Nefedova, Y.; del Valle, J.R.; Hu, C.C. Agonist-Mediated activation of STING induces apoptosis in malignant B cells. Cancer Res. 2016, 76, 2137–2152. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gulen, M.F.; Koch, U.; Haag, S.M.; Schuler, F.; Apetoh, L.; Villunger, A.; Radtke, F.; Ablasser, A. Signalling strength determines proapoptotic functions of STING. Nat. Commun. 2017, 8, 427. [Google Scholar] [CrossRef]
- Knoop, K.A.; McDonald, K.G.; Kulkarni, D.H.; Newberry, R.D. Antibiotics promote inflammation through the translocation of native commensal colonic bacteria. Gut 2016, 65, 1100–1109. [Google Scholar] [CrossRef] [Green Version]
- Hu, S.; Chen, M.; Wang, Y.; Wang, Z.; Pei, Y.; Fan, R.; Liu, X.; Wang, L.; Zhou, J.; Zheng, S.; et al. mTOR inhibition attenuates dextran sulfate sodium-induced colitis by suppressing T cell proliferation and balancing TH1/TH17/Treg profile. PLoS ONE 2016, 11, e0154564. [Google Scholar] [CrossRef]
- Cui, H.; Cai, Y.; Wang, L.; Jia, B.; Li, J.; Zhao, S.; Chu, X.; Lin, J.; Zhang, X.; Bian, Y.; et al. Berberine regulates Treg/Th17 balance to treat ulcerative colitis through modulating the gut microbiota in the colon. Front. Pharmacol. 2018, 9, 571. [Google Scholar] [CrossRef] [Green Version]
- Xu, Y.; Cai, R.; Zhao, Z.; Zhou, L.; Zhou, Q.; Hassan, S.; Huang, S.; Zhang, M.; Xu, G.; Zou, X. Thiomyristoyl ameliorates colitis by blocking the differentiation of Th17 cells and inhibiting SIRT2-induced metabolic reprogramming. Int. Immunopharmacol. 2021, 90, 107212. [Google Scholar] [CrossRef] [PubMed]
- Han, Y.M.; Koh, J.; Kim, J.H.; Lee, J.; Im, J.P.; Kim, J.S. Astragalin inhibits nuclear factor-κB signaling in human colonic epithelial cells and attenuates experimental colitis in mice. Gut Liver. 2021, 15, 100–108. [Google Scholar] [CrossRef]
- Chen, X.; Li, M.; Li, D.; Luo, T.; Xie, Y.; Gao, L.; Zhang, Y.; Chen, S.; Li, S.; Huang, G.; et al. Ethanol extract of Pycnoporus sanguineus relieves the dextran sulfate sodium-induced experimental colitis by suppressing helper T cell-mediated inflammation via apoptosis induction. Biomed. Pharmacother. 2020, 127, 110212. [Google Scholar] [CrossRef]
- McBride, D.A.; Kerr, M.D.; Dorn, N.C.; Ogbonna, D.A.; Santos, E.C.; Shah, N.J. Triggers, timescales, and treatments for cytokine-mediated tissue damage. Euro. Med. J. Innov. 2021, 5, 52–62. [Google Scholar]
- Henry, T.; Kirimanjeswara, G.S.; Ruby, T.; Jones, J.W.; Peng, K.; Perret, M.; Ho, L.; Sauer, J.D.; Iwakura, Y.; Metzger, D.W.; et al. Type I IFN signaling constrains IL-17A/F secretion by gammadelta T cells during bacterial infections. J. Immunol. 2010, 184, 3755–3767. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Gene Forward | Gene Accession Number | Reverse |
---|---|---|
nrf2 AACAGAACGGCCCTAAAGCA | AH006764 | TGGGATTCACGCATAGGAGC |
ho-1 CACGCATATACCCGCTACCT | NM_010442 | CCAGAGTGTTCATTCGAGCA |
sOd-1 GTGTCTGTGGGAGTCCAAGG | NM_011434 | CCCCAGTCATAGTGCTGCAA |
gsh-px ACAGTCCACCGTGTATGCCTTC | NM_001329527 | CTCTTCATTCTTGCCATTCTCCTG |
tnf-α TGAACTCGGGGTGATCGGTC | NM_001278601 | AGCCTTGTCCCTTGAAGAGAAC |
inf-γ TGAGTATTGCAAGTTTGAGGTCA | NM_008337 | CGGCAACAGCTGGTGGAC |
il-17a TCGAGAAGATGCTGGTGGGT | NM_010552 | CTCTGTTTAGGCTGCCTGGC |
β-actin TGCTGTCCCTGTATGCCTCT | AY618569 | TTTGATGTCACGCACGATTT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, W.; Zhang, Y.; Cao, J.; Xu, J.; Zhao, L.; Fang, X. Extracts of Waste from Poplar Wood Processing Alleviate Experimental Dextran Sulfate-Induced Colitis by Ameliorating Oxidative Stress, Inhibiting the Th1/Th17 Response and Inducing Apoptosis in Inflammatory Lymphocytes. Antioxidants 2021, 10, 1684. https://doi.org/10.3390/antiox10111684
Wang W, Zhang Y, Cao J, Xu J, Zhao L, Fang X. Extracts of Waste from Poplar Wood Processing Alleviate Experimental Dextran Sulfate-Induced Colitis by Ameliorating Oxidative Stress, Inhibiting the Th1/Th17 Response and Inducing Apoptosis in Inflammatory Lymphocytes. Antioxidants. 2021; 10(11):1684. https://doi.org/10.3390/antiox10111684
Chicago/Turabian StyleWang, Wenjie, Yiwei Zhang, Jiamin Cao, Jiahui Xu, Linguo Zhao, and Xianying Fang. 2021. "Extracts of Waste from Poplar Wood Processing Alleviate Experimental Dextran Sulfate-Induced Colitis by Ameliorating Oxidative Stress, Inhibiting the Th1/Th17 Response and Inducing Apoptosis in Inflammatory Lymphocytes" Antioxidants 10, no. 11: 1684. https://doi.org/10.3390/antiox10111684
APA StyleWang, W., Zhang, Y., Cao, J., Xu, J., Zhao, L., & Fang, X. (2021). Extracts of Waste from Poplar Wood Processing Alleviate Experimental Dextran Sulfate-Induced Colitis by Ameliorating Oxidative Stress, Inhibiting the Th1/Th17 Response and Inducing Apoptosis in Inflammatory Lymphocytes. Antioxidants, 10(11), 1684. https://doi.org/10.3390/antiox10111684