Anti-Sarcopenic Obesity Effects of Lonicera caerulea Extract in High-Fat Diet-Fed Mice
Abstract
:1. Introduction
2. Materials and Methods
2.1. Preparation and HPLC Analysis of HB Extract
2.2. Animals and Treatment
2.3. Biochemical Assays
2.4. Histological Assay
2.5. Micro-Computed Tomography (Micro-CT) and Muscle Strength
2.6. Real-Time PCR Analysis
2.7. Statistical Analysis
3. Results
3.1. Detection of C3G Contents in Raw HB and HB Extract
3.2. Effects of HB on Body Weights and Serum Biochemical Parameters
3.3. Effects of HB on Fat Accumulation by Micro-CT Analysis
3.4. Effects of HB on Antioxidant Enzymes
3.5. Effects of HB on Muscle Mass by Micro-CT Analysis
3.6. Effects of HB on Muscle Mass and Expression Levels of Atrophy Related Genes
3.7. Effects of HB on Growth Related Genes Expression
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Bai, C.H.; Alizargar, J.; Peng, C.Y.; Wu, J.P. Combination of exercise training and resveratrol attenuates obese sarcopenia in skeletal muscle atrophy. Chin. J. Physiol. 2020, 63, 101–112. [Google Scholar] [CrossRef]
- Boucher, J.; Kleinridders, A.; Kahn, C.R. Insulin receptor signaling in normal and insulin-resistant states. Cold Spring Harb. Perspect. Biol. 2014, 6, a009191. [Google Scholar] [CrossRef] [Green Version]
- Crunkhorn, S.; Dearie, F.; Mantzoros, C.; Gami, H.; da Silva, W.S.; Espinoza, D.; Faucette, R.; Barry, K.; Bianco, A.C.; Patti, M.E. Peroxisome proliferator activator receptor gamma coactivator-1 expression is reduced in obesity: Potential pathogenic role of saturated fatty acids and p38 mitogen-activated protein kinase activation. J. Biol. Chem. 2007, 282, 15439–15450. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Onishi, S.; Ishino, M.; Kitazawa, H.; Yoto, A.; Shimba, Y.; Mochizuki, Y.; Unno, K.; Meguro, S.; Tokimitsu, I.; Miura, S. Green tea extracts ameliorate high-fat diet-induced muscle atrophy in senescence-accelerated mouse prone-8 mice. PLoS ONE 2018, 13, e0195753. [Google Scholar] [CrossRef] [PubMed]
- Sparks, L.M.; Xie, H.; Koza, R.A.; Mynatt, R.; Hulver, M.W.; Bray, G.A.; Smith, S.R. A high-fat diet coordinately downregulates genes required for mitochondrial oxidative phosphorylation in skeletal muscle. Diabetes 2005, 54, 1926–1933. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wannamethee, S.G.; Atkins, J.L. Muscle loss and obesity: The health implications of sarcopenia and sarcopenic obesity. Proc. Nutr. Soc. 2015, 74, 405–412. [Google Scholar] [CrossRef]
- Kohara, K. Sarcopenic obesity in aging population: Current status and future directions for research. Endocrine 2014, 45, 15–25. [Google Scholar] [CrossRef] [PubMed]
- Guo, A.Y.; Leung, K.S.; Siu, P.M.; Qin, J.H.; Chow, S.K.; Qin, L.; Li, C.Y.; Cheung, W.H. Muscle mass, structural and functional investigations of senescence-accelerated mouse P8 (SAMP8). Exp. Anim. 2015, 64, 425–433. [Google Scholar] [CrossRef] [Green Version]
- Hamrick, M.W.; Ding, K.H.; Pennington, C.; Chao, Y.J.; Wu, Y.D.; Howard, B.; Immel, D.; Borlongan, C.; McNeil, P.L.; Bollag, W.B.; et al. Age-related loss of muscle mass and bone strength in mice is associated with a decline in physical activity and serum leptin. Bone 2006, 39, 845–853. [Google Scholar] [CrossRef]
- Roseno, S.L.; Davis, P.R.; Bollinger, L.M.; Powell, J.J.; Witczak, C.A.; Brault, J.J. Short-term, high-fat diet accelerates disuse atrophy and protein degradation in a muscle-specific manner in mice. Nutr. Metab. 2015, 12, 39. [Google Scholar] [CrossRef] [Green Version]
- Bilodeau, P.A.; Coyne, E.S.; Wing, S.S. The ubiquitin proteasome system in atrophying skeletal muscle: Roles and regulation. Am. J. Physiol. Cell Physiol. 2016, 311, C392–C403. [Google Scholar] [CrossRef] [Green Version]
- Goldberg, A.L. Probing the proteasome pathway. Nat. Biotechnol. 2000, 18, 494–496. [Google Scholar] [CrossRef]
- Lecker, S.H.; Jagoe, R.T.; Gilbert, A.; Gomes, M.; Baracos, V.; Bailey, J.; Price, S.R.; Mitch, W.E.; Goldberg, A.L. Multiple types of skeletal muscle atrophy involve a common program of changes in gene expression. FASEB J. 2004, 18, 39–51. [Google Scholar] [CrossRef] [PubMed]
- Kitada, M.; Ogura, Y.; Monno, I.; Koya, D. Sirtuins and Type 2 Diabetes: Role in Inflammation, Oxidative Stress, and Mitochondrial Function. Front. Endocrinol. 2019, 10, 187. [Google Scholar] [CrossRef] [Green Version]
- Kim, J.W.; Lee, Y.S.; Seol, D.J.; Cho, I.J.; Ku, S.K.; Choi, J.S.; Lee, H.J. Anti-obesity and fatty liver-preventing activities of Lonicera caerulea in high-fat diet-fed mice. Int. J. Mol. Med. 2018, 42, 3047–3064. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wu, S.; Hu, R.; Nakano, H.; Chen, K.; Liu, M.; He, X.; Zhang, H.; He, J.; Hou, D.X. Modulation of Gut Microbiota by Lonicera caerulea L. Berry Polyphenols in a Mouse Model of Fatty Liver Induced by High Fat Diet. Molecules 2018, 23, 3213. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, B.; Cheng, Z.; Sun, X.; Si, X.; Gong, E.; Wang, Y.; Tian, J.; Shu, C.; Ma, F.; Li, D.; et al. Lonicera caerulea L. Polyphenols Alleviate Oxidative Stress-Induced Intestinal Environment Imbalance and Lipopolysaccharide-Induced Liver Injury in HFD-Fed Rats by Regulating the Nrf2/HO-1/NQO1 and MAPK Pathways. Mol. Nutr. Food Res. 2020, 64, e1901315. [Google Scholar] [CrossRef] [PubMed]
- Golba, M.; Sokol-Letowska, A.; Kucharska, A.Z. Health Properties and Composition of Honeysuckle Berry Lonicera caerulea L. An Update on Recent Studies. Molecules 2020, 25, 749. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Park, M.; Yoo, J.H.; Lee, Y.S.; Lee, H.J. Lonicera caerulea Extract Attenuates Non-Alcoholic Fatty Liver Disease in Free Fatty Acid-Induced HepG2 Hepatocytes and in High Fat Diet-Fed Mice. Nutrients 2019, 11, 494. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lee, Y.S.; Cho, I.J.; Kim, J.W.; Lee, S.K.; Ku, S.K.; Lee, H.J. Evaluation of in vitro anti-oxidant and anti-inflammatory activities of Korean and Chinese Lonicera caerulea. Nutr. Res. Pract. 2018, 12, 486–493. [Google Scholar] [CrossRef] [PubMed]
- Roh, E.; Choi, K.M. Health Consequences of Sarcopenic Obesity: A Narrative Review. Front. Endocrinol. 2020, 11, 332. [Google Scholar] [CrossRef] [PubMed]
- Minami, M.; Nakamura, M.; Makino, T. Effect of Lonicera caerulea var. emphyllocalyx Extracts on Murine Streptococcus pyogenes Infection by Modulating Immune System. Biomed. Res. Int. 2019, 2019, 1797930. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sharma, A.; Lee, H.J. Lonicera caerulea: An updated account of its phytoconstituents and health-promoting activities. Trends Food Sci. Tech. 2021, 107, 130–149. [Google Scholar] [CrossRef]
- Raudone, L.; Liaudanskas, M.; Vilkickyte, G.; Kviklys, D.; Zvikas, V.; Viskelis, J.; Viskelis, P. Phenolic Profiles, Antioxidant Activity and Phenotypic Characterization of Lonicera caerulea L. Berries, Cultivated in Lithuania. Antioxidants 2021, 10, 115. [Google Scholar] [CrossRef] [PubMed]
- Chaovanalikit, A.; Thompson, M.M.; Wrolstad, R.E. Characterization and quantification of anthocyanins and polyphenolics in bluehHoneysuckle (Lonicera caerulea L.). J. Agric. Food Chem. 2004, 52, 848–852. [Google Scholar] [CrossRef] [PubMed]
- Bass, J.J.; Kazi, A.A.; Deane, C.S.; Nakhuda, A.; Ashcroft, S.P.; Brook, M.S.; Wilkinson, D.J.; Phillips, B.E.; Philp, A.; Tarum, J.; et al. The mechanisms of skeletal muscle atrophy in response to transient knockdown of the vitamin D receptor in vivo. J. Physiol. 2021, 599, 963–979. [Google Scholar] [CrossRef] [PubMed]
- Leng, P.; Itamura, H.; Yamamura, H.; Deng, X.M. Anthocyanin accumulation in apple and peach shoots during cold acclimation. Sci. Hortic. 2000, 83, 43–50. [Google Scholar] [CrossRef]
- Liu, Q.; Sun, Y.; Fei, Z.; Yang, Z.; Duan, K.; Zi, J.; Cui, Q.; Yu, M.; Xiong, W. Leptin promotes fatty acid oxidation and OXPHOS via the c-Myc/PGC-1 pathway in cancer cells. Acta Biochim. Biophys. Sin. 2019, 51, 707–714. [Google Scholar] [CrossRef]
- Barrios-Correa, A.A.; Estrada, J.A.; Contreras, I. Leptin Signaling in the Control of Metabolism and Appetite: Lessons from Animal Models. J. Mol. Neurosci. 2018, 66, 390–402. [Google Scholar] [CrossRef]
- Xu, Y.; Wang, N.; Tan, H.Y.; Li, S.; Zhang, C.; Zhang, Z.; Feng, Y. Panax notoginseng saponins modulate the gut microbiota to promote thermogenesis and beige adipocyte reconstruction via leptin-mediated AMPKalpha/STAT3 signaling in diet-induced obesity. Theranostics 2020, 10, 11302–11323. [Google Scholar] [CrossRef]
- Lee, J.H.; Moon, J.M.; Kim, Y.H.; Lee, B.; Choi, S.Y.; Song, B.J.; Kim, D.K.; Lee, Y.M. Effect of Enzymatic Treatment of Chrysanthemum indicum Linne Extracts on Lipid Accumulation and Adipogenesis in High-Fat-Diet-Induced Obese Male Mice. Nutrients 2019, 11, 269. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Colak, E.; Pap, D. The role of oxidative stress in the development of obesity and obesity-related metabolic disorders. J. Med. Biochem. 2021, 40, 1–9. [Google Scholar] [CrossRef] [PubMed]
- Gusti, A.M.T.; Qusti, S.Y.; Alshammari, E.M.; Toraih, E.A.; Fawzy, M.S. Antioxidants-Related Superoxide Dismutase (SOD), Catalase (CAT), Glutathione Peroxidase (GPX), Glutathione-S-Transferase (GST), and Nitric Oxide Synthase (NOS) Gene Variants Analysis in an Obese Population: A Preliminary Case-Control Study. Antioxidants 2021, 10, 595. [Google Scholar] [CrossRef] [PubMed]
- Le, N.H.; Kim, C.S.; Park, T.; Park, J.H.; Sung, M.K.; Lee, D.G.; Hong, S.M.; Choe, S.Y.; Goto, T.; Kawada, T.; et al. Quercetin protects against obesity-induced skeletal muscle inflammation and atrophy. Mediat. Inflamm. 2014, 2014, 834294. [Google Scholar] [CrossRef] [PubMed]
- Prado, C.M.; Wells, J.C.; Smith, S.R.; Stephan, B.C.; Siervo, M. Sarcopenic obesity: A Critical appraisal of the current evidence. Clin. Nutr. 2012, 31, 583–601. [Google Scholar] [CrossRef]
- Chang, H.C.; Guarente, L. SIRT1 and other sirtuins in metabolism. Trends Endocrinol. Metab. 2014, 25, 138–145. [Google Scholar] [CrossRef]
- Cheng, C.F.; Ku, H.C.; Lin, H. PGC-1alpha as a Pivotal Factor in Lipid and Metabolic Regulation. Int. J. Mol. Sci. 2018, 19, 3447. [Google Scholar] [CrossRef] [Green Version]
Genes | Accession Number | Forward Primer (5′–3′) | Reverse Primer (5′–3′) |
---|---|---|---|
Sod1 | NM_011434.2 | GTGATTGGGATTGCGCAGTA | TGGTTTGAGGGTAGCAGATGAGT |
Gpx1 | U13705.1 | GAAGAACTTGGGCCATTTGG | TCTCGCCTGGCTCCTGTTT |
Cat | NM_009804.2 | TGAGAAGCCTAAGAACGCAA | CCCTTCGCAGCCATGTG |
MuRF1 | NM_001039048.2 | GACAGTCGCATTTCAAAGCA | AGGGATTCGCAGCCTGGAAG |
Atrogin1 | NM_026346.3 | CAGCTTCGTGAGCGACCTC | GGCAGTCGAGAAGTCCAGTC |
Ppargc1a | NM_008904.2 | ATGTGTCGCCTTCTTGCTCT | ATCTACTGCCTGGGGACCTT |
Sirt1 | NM_019812.3 | GCTGACGACTTCGACGACG | TCGGTCAACAGGAGGTTGTCT |
Actb | NM_007393.5 | CCACAGCTGAGAGGGAAATC | AAGGAAGGCTGGAAAAGAGC |
Rn18s | NR_003278.3 | AGCCTGAGAAACGGCTACC | TCCCAAGATCCAACTACGAG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lee, Y.-S.; Park, E.-J.; Kim, S.-M.; Kim, J.-Y.; Lee, H.-J. Anti-Sarcopenic Obesity Effects of Lonicera caerulea Extract in High-Fat Diet-Fed Mice. Antioxidants 2021, 10, 1633. https://doi.org/10.3390/antiox10101633
Lee Y-S, Park E-J, Kim S-M, Kim J-Y, Lee H-J. Anti-Sarcopenic Obesity Effects of Lonicera caerulea Extract in High-Fat Diet-Fed Mice. Antioxidants. 2021; 10(10):1633. https://doi.org/10.3390/antiox10101633
Chicago/Turabian StyleLee, You-Suk, Eun-Jung Park, Sung-Min Kim, Jong-Yeon Kim, and Hae-Jeung Lee. 2021. "Anti-Sarcopenic Obesity Effects of Lonicera caerulea Extract in High-Fat Diet-Fed Mice" Antioxidants 10, no. 10: 1633. https://doi.org/10.3390/antiox10101633
APA StyleLee, Y.-S., Park, E.-J., Kim, S.-M., Kim, J.-Y., & Lee, H.-J. (2021). Anti-Sarcopenic Obesity Effects of Lonicera caerulea Extract in High-Fat Diet-Fed Mice. Antioxidants, 10(10), 1633. https://doi.org/10.3390/antiox10101633