Genome-Wide Transcriptome Profiling, Characterization, and Functional Identification of NAC Transcription Factors in Sorghum under Salt Stress
Abstract
:1. Introduction
2. Materials and Methods
2.1. Plant Materials, Growth Conditions, and Treatments
2.2. Seedling Growth Analysis
2.3. Physio-Biochemical Responses and Ion Profiling
2.4. Biochemical Studies
2.4.1. Ascorbate-Glutathione Pool
2.4.2. Protein Concentration
2.4.3. Antioxidant Molecules
2.4.4. Compatible Osmolytes
2.4.5. Oxidative Stress Markers
2.5. RNA Library Construction and Illumina Sequencing
2.6. Analysis of Sequencing Data and DEG Estimation
2.7. Differential Expression Analysis
2.8. KEGG Pathway Analysis and GO Annotation of DEGs
2.9. Analysis of Networks between DEGs
2.10. Phylogenetic Analysis, Protein Characteristics, and Gene Structure
2.11. Validation of DEGs Using Quantitative Real-Time PCR (qPCR)
3. Results
3.1. Phenotypic and Morphological Variability in Sorghum under Salt Stress
3.2. Trends in Physiological Characteristics
3.3. Ion Dynamics under Salt Stress
3.4. Antioxidative Enzymes
3.5. Non-Enzymatic Oxidants
3.6. Compatible Solutes
3.7. Oxidative Stress Markers
3.8. Transcriptome Assembly and Statistics
3.9. Differential Gene Expression Analysis
3.10. Comparative Co-Expression Analysis of DEGs
3.11. Functional Classification of DEGs, GO Analysis, and Similarity Search
3.12. DEGs Network Analysis
3.13. Phylogenetic Tree, Structure and Motif Analysis of SbNAC1 TFs
3.14. DEGs Playing Role under Salinity
3.14.1. Differentially Expressed Genes Encoding TFs
3.14.2. Ion Transporters
3.14.3. Photosynthesis
3.14.4. Oxidative Stress
3.14.5. Compatible Solutes
3.15. Validation of the Differential Gene Expression Analysis
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Punia, H.; Tokas, J.; Bhadu, S.; Mohanty, A.K.; Rawat, P.; Malik, A. Satpal Proteome dynamics and transcriptome profiling in sorghum [Sorghum bicolor (L.) Moench] under salt stress. 3 Biotech 2020, 10, 412. [Google Scholar] [CrossRef]
- Corwin, D.L.; Scudiero, E. Review of soil salinity assessment for agriculture across multiple scales using proximal and/or remote sensors. In Advances in Agronomy; Elsevier: Amsterdam, The Netherlands, 2019; Volume 158, pp. 1–130. ISBN 0065-2113. [Google Scholar]
- Punia, H.; Tokas, J.; Malik, A.; Satpal; Sangwan, S. Characterization of phenolic compounds and antioxidant activity in sorghum [Sorghum bicolor (L.) Moench] grains. Cereal Res. Commun. 2021. [Google Scholar] [CrossRef]
- Malik, A.; Mor, V.S.; Tokas, J.; Punia, H.; Malik, S.; Malik, K.; Sangwan, S.; Tomar, S.; Singh, P.; Singh, N. Biostimulant-Treated Seedlings under Sustainable Agriculture: A Global Perspective Facing Climate Change. Agronomy 2020, 11, 14. [Google Scholar] [CrossRef]
- Punia, H.; Tokas, J.; Malik, A.; Singh, S.; Phogat, D.S.; Bhuker, A.; Mor, V.S.; Rani, A.; Sheokand, R.N. Discerning morpho-physiological and quality traits contributing to salinity tolerance acquisition in sorghum [Sorghum bicolor (L.) Moench]. S. Afr. J. Bot. 2021, 140, 409–418. [Google Scholar] [CrossRef]
- Kaur, H.; Sirhindi, G.; Bhardwaj, R.; Alyemeni, M.N.; Siddique, K.H.M.; Ahmad, P. 28-homobrassinolide regulates antioxidant enzyme activities and gene expression in response to salt-and temperature-induced oxidative stress in Brassica juncea. Sci. Rep. 2018, 8, 1–13. [Google Scholar] [CrossRef]
- Ahmad, P.; Abdel Latef, A.A.; Hashem, A.; Abd_Allah, E.F.; Gucel, S.; Tran, L.-S.P. Nitric oxide mitigates salt stress by regulating levels of osmolytes and antioxidant enzymes in chickpea. Front. Plant Sci. 2016, 7, 347. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kohli, S.K.; Khanna, K.; Bhardwaj, R.; Abd_Allah, E.F.; Ahmad, P.; Corpas, F.J. Assessment of subcellular ROS and NO metabolism in higher plants: Multifunctional signaling molecules. Antioxidants 2019, 8, 641. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ahmad, P.; Tripathi, D.K.; Deshmukh, R.; Pratap Singh, V.; Corpas, F.J. Revisiting the role of ROS and RNS in plants under changing environment. Environ. Exp. Bot. 2019, 161. [Google Scholar] [CrossRef]
- Ahmad, P.; Jaleel, C.A.; Salem, M.A.; Nabi, G.; Sharma, S. Roles of enzymatic and nonenzymatic antioxidants in plants during abiotic stress. Crit. Rev. Biotechnol. 2010, 30, 161–175. [Google Scholar] [CrossRef] [PubMed]
- Himani, B.S.; Tokas, J. Variation in structural carbohydrates of forage sorghum [Sorghum bicolor (L.) Moench] under saline conditions. Forage Res 2019, 45, 123–127. [Google Scholar]
- De Rossi, S.; Di Marco, G.; Bruno, L.; Gismondi, A.; Canini, A. Investigating the drought and salinity effect on the redox components of Sulla Coronaria (L.) Medik. Antioxidants 2021, 10, 1048. [Google Scholar] [CrossRef]
- Tokas, J.; Punia, H.; Malik, A.; Sangwan, S.; Devi, S.; Malik, S. Growth performance, nutritional status, forage yield and photosynthetic use efficiency of sorghum [Sorghum bicolor (L.) Moench] under salt stress. Range Manag. Agrofor. 2021, 42, 59–70. [Google Scholar]
- Hossain, M.S.; Dietz, K.-J. Tuning of redox regulatory mechanisms, reactive oxygen species and redox homeostasis under salinity stress. Front. Plant Sci. 2016, 7, 548. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hossain, M.S.; ElSayed, A.I.; Moore, M.; Dietz, K.-J. Redox and reactive oxygen species network in acclimation for salinity tolerance in sugar beet. J. Exp. Bot. 2017, 68, 1283–1298. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Amin, I.; Rasool, S.; Mir, M.A.; Wani, W.; Masoodi, K.Z.; Ahmad, P. Ion homeostasis for salinity tolerance in plants: A molecular approach. Physiol. Plant. 2021, 171, 578–594. [Google Scholar] [CrossRef] [PubMed]
- Seki, M.; Kamei, A.; Yamaguchi-Shinozaki, K.; Shinozaki, K. Molecular responses to drought, salinity and frost: Common and different paths for plant protection. Curr. Opin. Biotechnol. 2003, 14, 194–199. [Google Scholar] [CrossRef]
- Ahanger, M.A.; Alyemeni, M.N.; Wijaya, L.; Alamri, S.A.; Alam, P.; Ashraf, M.; Ahmad, P. Potential of exogenously sourced kinetin in protecting Solanum lycopersicum from NaCl-induced oxidative stress through up-regulation of the antioxidant system, ascorbate-glutathione cycle and glyoxalase system. PLoS ONE 2018, 13, e0202175. [Google Scholar] [CrossRef]
- Barrs, H.D.; Weatherley, P.E. A re-examination of the relative turgidity technique for estimating water deficits in leaves. Aust. J. Biol. Sci. 1962, 15, 413–428. [Google Scholar] [CrossRef] [Green Version]
- Sullivan, C.Y. Selection for drought and heat tolerance in grain sorghum. In Stress Physiology in Crop Plants; John Wiley and Sons: New York, NY, USA, 1979. [Google Scholar]
- Beauchamp, C.; Fridovich, I. Superoxide dismutase: Improved assays and an assay applicable to acrylamide gels. Anal. Biochem. 1971, 44, 276–287. [Google Scholar] [CrossRef]
- Aebi, H. Catalase in vitro. Methods Enzymol. 1984, 105, 121–126. [Google Scholar]
- Shannon, L.M.; Kay, E.; Lew, J.Y. Peroxidase isozymes from horseradish roots I. Isolation and physical properties. J. Biol. Chem. 1966, 241, 2166–2172. [Google Scholar] [CrossRef]
- Nakano, Y.; Asada, K. Hydrogen peroxide is scavenged by ascorbate-specific peroxidase in spinach chloroplasts. Plant Cell Physiol. 1981, 22, 867–880. [Google Scholar]
- Nagalakshmi, N.; Prasad, M.N. V Responses of glutathione cycle enzymes and glutathione metabolism to copper stress in Scenedesmus bijugatus. Plant Sci. 2001, 160, 291–299. [Google Scholar] [CrossRef]
- Halliwell, B.; Foyer, C.H. Properties and physiological function of a glutathione reductase purified from spinach leaves by affinity chromatography. Planta 1978, 139, 9–17. [Google Scholar] [CrossRef]
- Lowry, O.H.; Rosebrough, N.J.; Farr, A.L.; Randall, R.J. Protein measurement with the Folin phenol reagent. J. Biol. Chem. 1951, 193, 265–275. [Google Scholar] [CrossRef]
- Mukherjee, S.P.; Choudhuri, M.A. Implications of water stress-induced changes in the levels of endogenous ascorbic acid and hydrogen peroxide in Vigna seedlings. Physiol. Plant 1983, 58, 166–170. [Google Scholar] [CrossRef]
- Smith, I.K. Stimulation of glutathione synthesis in photorespiring plants by catalase inhibitors. Plant Physiol. 1985, 79, 1044–1047. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bates, L.S.; Waldren, R.P.; Teare, I.D. Rapid determination of free proline for water-stress studies. Plant Soil 1973, 39, 205–207. [Google Scholar] [CrossRef]
- Greive, C.M.; Grattan, S.R. Rapid assay for determination of water-soluble quaternary amino compounds. Plant Soil 1983, 70, 303–307. [Google Scholar] [CrossRef]
- Heath, R.L.; Packer, L. Photoperoxidation in isolated chloroplasts: II. Role of electron transfer. Arch. Biochem. Biophys. 1968, 125, 850–857. [Google Scholar] [CrossRef]
- Sinha, A.K. Colorimetric assay of catalase. Anal. Biochem. 1972, 47, 389–394. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2− ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Délano-Frier, J.P.; Avilés-Arnaut, H.; Casarrubias-Castillo, K.; Casique-Arroyo, G.; Castrillón-Arbeláez, P.A.; Herrera-Estrella, L.; Massange-Sánchez, J.; Martínez-Gallardo, N.A.; Parra-Cota, F.I.; Vargas-Ortiz, E. Transcriptomic analysis of grain amaranth (Amaranthus hypochondriacus) using 454 pyrosequencing: Comparison with A. tuberculatus, expression profiling in stems and in response to biotic and abiotic stress. BMC Genom. 2011, 12, 1–18. [Google Scholar] [CrossRef] [Green Version]
- Parchman, T.L.; Geist, K.S.; Grahnen, J.A.; Benkman, C.W.; Buerkle, C.A. Transcriptome sequencing in an ecologically important tree species: Assembly, annotation, and marker discovery. BMC Genom. 2010, 11, 1–16. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Punia, H.; Tokas, J.; Malik, A.; Rani, A.; Gupta, P.; Kumari, A.; Mor, V.S.; Bhuker, A.; Kumar, S. Solar Radiation and Nitrogen Use Efficiency for Sustainable Agriculture. In Resources Use Efficiency in Agriculture; Springer: Berlin/Heidelberg, Germany, 2020; pp. 177–212. [Google Scholar]
- Almodares, A.; Hadi, M.R.; Dosti, B. Effects of salt stress on germination percentage and seedling growth in sweet sorghum cultivars. J. Biol. Sci. 2007, 7, 1492–1495. [Google Scholar] [CrossRef] [Green Version]
- Singh, J.; Singh, V.; Sharma, P.C. Elucidating the role of osmotic, ionic and major salt responsive transcript components towards salinity tolerance in contrasting chickpea (Cicer arietinum L.) genotypes. Physiol. Mol. Biol. Plants 2018, 24, 441–453. [Google Scholar] [CrossRef]
- Shabala, S.; Cuin, T.A. Potassium transport and plant salt tolerance. Physiol. Plant. 2008, 133, 651–669. [Google Scholar] [CrossRef] [PubMed]
- Krishnamurthy, P.; Ranathunge, K.; Franke, R.; Prakash, H.S.; Schreiber, L.; Mathew, M.K. The role of root apoplastic transport barriers in salt tolerance of rice (Oryza sativa L.). Planta 2009, 230, 119–134. [Google Scholar] [CrossRef]
- Yang, Z.; Li, J.-L.; Liu, L.-N.; Xie, Q.; Sui, N. Photosynthetic regulation under salt stress and salt-tolerance mechanism of sweet sorghum. Front. Plant Sci. 2020, 10, 1722. [Google Scholar] [CrossRef]
- Reddy, I.N.B.L.; Kim, S.-M.; Kim, B.-K.; Yoon, I.-S.; Kwon, T.-R. Identification of rice accessions associated with K+/Na+ ratio and salt tolerance based on physiological and molecular responses. Rice Sci. 2017, 24, 360–364. [Google Scholar] [CrossRef]
- Ashraf, U.; Kanu, A.S.; Mo, Z.; Hussain, S.; Anjum, S.A.; Khan, I.; Abbas, R.N.; Tang, X. Lead toxicity in rice: Effects, mechanisms, and mitigation strategies—A mini review. Environ. Sci. Pollut. Res. 2015, 22, 18318–18332. [Google Scholar] [CrossRef]
- Acosta-Motos, J.R.; Ortuño, M.F.; Bernal-Vicente, A.; Diaz-Vivancos, P.; Sanchez-Blanco, M.J.; Hernandez, J.A. Plant responses to salt stress: Adaptive mechanisms. Agronomy 2017, 7, 18. [Google Scholar] [CrossRef] [Green Version]
- Lee, Y.-P.; Kim, S.-H.; Bang, J.-W.; Lee, H.-S.; Kwak, S.-S.; Kwon, S.-Y. Enhanced tolerance to oxidative stress in transgenic tobacco plants expressing three antioxidant enzymes in chloroplasts. Plant Cell Rep. 2007, 26, 591–598. [Google Scholar] [CrossRef] [Green Version]
- BHATTACHARJEE, S.; Mukherjee, A.K. Heat and salinity induced oxidative stress and changes in protein profile in Amaranthus lividus L. Indian J. Plant Physiol. 2006, 11, 41–47. [Google Scholar]
- AbdElgawad, H.; Zinta, G.; Hegab, M.M.; Pandey, R.; Asard, H.; Abuelsoud, W. High salinity induces different oxidative stress and antioxidant responses in maize seedlings organs. Front. Plant Sci. 2016, 7, 276. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sairam, R.K.; Rao, K.V.; Srivastava, G.C. Differential response of wheat genotypes to long term salinity stress in relation to oxidative stress, antioxidant activity and osmolyte concentration. Plant Sci. 2002, 163, 1037–1046. [Google Scholar] [CrossRef]
- Gill, S.S.; Anjum, N.A.; Hasanuzzaman, M.; Gill, R.; Trivedi, D.K.; Ahmad, I.; Pereira, E.; Tuteja, N. Glutathione and glutathione reductase: A boon in disguise for plant abiotic stress defense operations. Plant Physiol. Biochem. 2013, 70, 204–212. [Google Scholar] [CrossRef]
- Qureshi, M.I.; Abdin, M.Z.; Ahmad, J.; Iqbal, M. Effect of long-term salinity on cellular antioxidants, compatible solute and fatty acid profile of Sweet Annie (Artemisia annua L.). Phytochemistry 2013, 95, 215–223. [Google Scholar] [CrossRef]
- Anjum, S.A.; Xie, X.; Wang, L.; Saleem, M.F.; Man, C.; Lei, W. Morphological, physiological and biochemical responses of plants to drought stress. Afr. J. Agric. Res. 2011, 6, 2026–2032. [Google Scholar]
- Matysik, J.; Alia; Bhalu, B.; Mohanty, P. Molecular mechanisms of quenching of reactive oxygen species by proline under stress in plants. Curr. Sci. 2002, 525–532. [Google Scholar]
- Arafa, A.A.; Khafagy, M.A.; El-Banna, M.F. The effect of glycinebetaine or ascorbic acid on the salt-stress induced damages in sorghum plant cells. Int. J. Bot. 2007, 3, 251–259. [Google Scholar] [CrossRef]
- Murata, N.; Mohanty, P.S.; Hayashi, H.; Papageorgiou, G.C. Glycinebetaine stabilizes the association of extrinsic proteins with the photosynthetic oxygen-evolving complex. FEBS Lett. 1992, 296, 187–189. [Google Scholar] [CrossRef] [Green Version]
- Saneoka, H.; Ishiguro, S.; Moghaieb, R.E.A. Effect of salinity and abscisic acid on accumulation of glycinebetaine and betaine aldehyde dehydrogenase mRNA in Sorghum leaves (Sorghum bicolor). J. Plant Physiol. 2001, 158, 853–859. [Google Scholar] [CrossRef]
- Punia, H.; Madan, S.; Malik, A.; Sethi, S.K. Stability analysis for quality attributes in durum wheat (Triticum durum L) genotypes. Bangladesh J. Bot. 2019, 48, 967–972. [Google Scholar] [CrossRef]
- Forghani, A.H.; Almodares, A.; Ehsanpour, A.A. The role of gibberellic acid and paclobutrazol on oxidative stress responses induced by in vitro salt stress in sweet sorghum. Russ. J. Plant Physiol. 2020, 67, 555–563. [Google Scholar] [CrossRef]
- Reddy, P.S.; Jogeswar, G.; Rasineni, G.K.; Maheswari, M.; Reddy, A.R.; Varshney, R.K.; Kishor, P.B.K. Proline over-accumulation alleviates salt stress and protects photosynthetic and antioxidant enzyme activities in transgenic sorghum [Sorghum bicolor (L.) Moench]. Plant Physiol. Biochem. 2015, 94, 104–113. [Google Scholar] [CrossRef] [Green Version]
- Hernández, J.A.; Barba-Espín, G.; Clemente-Moreno, M.J.; Díaz-Vivancos, P. Plant responses to salinity through an antioxidative metabolism and proteomic point of view. In Stress Signaling in Plants: Genomics and Proteomics Perspective; Springer: Berlin/Heidelberg, Germany, 2017; Volume 2, pp. 173–200. [Google Scholar]
- Shinde, H.; Tanaka, K.; Dudhate, A.; Tsugama, D.; Mine, Y.; Kamiya, T.; Gupta, S.K.; Liu, S.; Takano, T. Comparative de novo transcriptomic profiling of the salinity stress responsiveness in contrasting pearl millet lines. Environ. Exp. Bot. 2018, 155, 619–627. [Google Scholar] [CrossRef]
- Mansuri, R.M.; Shobbar, Z.-S.; Jelodar, N.B.; Ghaffari, M.R.; Nematzadeh, G.-A.; Asari, S. Dissecting molecular mechanisms underlying salt tolerance in rice: A comparative transcriptional profiling of the contrasting genotypes. Rice 2019, 12, 1–13. [Google Scholar] [CrossRef] [PubMed]
- Li, M.; Zhang, K.; Sun, Y.; Cui, H.; Cao, S.; Yan, L.; Xu, M. Growth, physiology, and transcriptional analysis of two contrasting Carex rigescens genotypes under salt stress reveals salt-tolerance mechanisms. J. Plant Physiol. 2018, 229, 77–88. [Google Scholar] [CrossRef]
- Apse, M.P.; Blumwald, E. Engineering salt tolerance in plants. Curr. Opin. Biotechnol. 2002, 13, 146–150. [Google Scholar] [CrossRef]
- Zhulidov, P.A.; Bogdanova, E.A.; Shcheglov, A.S.; Vagner, L.L.; Khaspekov, G.L.; Kozhemyako, V.B.; Matz, M.V.; Meleshkevitch, E.; Moroz, L.L.; Lukyanov, S.A. Simple cDNA normalization using kamchatka crab duplex-specific nuclease. Nucleic Acids Res. 2004, 32, e37. [Google Scholar] [CrossRef]
- Bedre, R.; Mangu, V.R.; Srivastava, S.; Sanchez, L.E.; Baisakh, N. Transcriptome analysis of smooth cordgrass (Spartina alterniflora Loisel), a monocot halophyte, reveals candidate genes involved in its adaptation to salinity. BMC Genom. 2016, 17, 1–18. [Google Scholar] [CrossRef] [Green Version]
- Kasuga, M.; Liu, Q.; Miura, S.; Yamaguchi-Shinozaki, K.; Shinozaki, K. Improving plant drought, salt, and freezing tolerance by gene transfer of a single stress-inducible transcription factor. Nat. Biotechnol. 1999, 17, 287–291. [Google Scholar] [CrossRef]
- Gu, C.; Xu, S.; Wang, Z.; Liu, L.; Zhang, Y.; Deng, Y.; Huang, S. De novo sequencing, assembly, and analysis of Iris lactea var. chinensis roots’ transcriptome in response to salt stress. Plant Physiol. Biochem. 2018, 125, 1–12. [Google Scholar] [CrossRef] [PubMed]
- Baisakh, N.; Subudhi, P.K.; Varadwaj, P. Primary responses to salt stress in a halophyte, smooth cordgrass (Spartina alterniflora Loisel.). Funct. Integr. Genom. 2008, 8, 287–300. [Google Scholar] [CrossRef] [PubMed]
- Lv, X.; Jin, Y.; Wang, Y. De novo transcriptome assembly and identification of salt-responsive genes in sugar beet M14. Comput. Biol. Chem. 2018, 75, 1–10. [Google Scholar] [CrossRef] [PubMed]
- Guo, S.-M.; Tan, Y.; Chu, H.-J.; Sun, M.-X.; Xing, J.-C. Transcriptome sequencing revealed molecular mechanisms underlying tolerance of Suaeda salsa to saline stress. PLoS ONE 2019, 14, e0219979. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Soren, K.R.; Madugula, P.; Kumar, N.; Barmukh, R.; Sengar, M.S.; Bharadwaj, C.; Sharma, P.C.; Singh, S.; Bhandari, A.; Singh, J. Genetic Dissection and Identification of Candidate Genes for Salinity Tolerance Using Axiom® CicerSNP Array in Chickpea. Int. J. Mol. Sci. 2020, 21, 5058. [Google Scholar] [CrossRef]
- Li, J.; Gao, Z.; Zhou, L.; Li, L.; Zhang, J.; Liu, Y.; Chen, H. Comparative transcriptome analysis reveals K+ transporter gene contributing to salt tolerance in eggplant. BMC Plant Biol. 2019, 19, 1–18. [Google Scholar] [CrossRef]
- Cramer, G.R.; Urano, K.; Delrot, S.; Pezzotti, M.; Shinozaki, K. Effects of abiotic stress on plants: A systems biology perspective. BMC Plant Biol. 2011, 11, 1–14. [Google Scholar] [CrossRef] [Green Version]
- Garg, R.; Shankar, R.; Thakkar, B.; Kudapa, H.; Krishnamurthy, L.; Mantri, N.; Varshney, R.K.; Bhatia, S.; Jain, M. Transcriptome analyses reveal genotype-and developmental stage-specific molecular responses to drought and salinity stresses in chickpea. Sci. Rep. 2016, 6, 1–15. [Google Scholar] [CrossRef] [Green Version]
- Sudhir, P.; Murthy, S.D.S. Effects of salt stress on basic processes of photosynthesis. Photosynthetica 2004, 42, 481–486. [Google Scholar] [CrossRef]
- Wang, K.L.-C.; Li, H.; Ecker, J.R. Ethylene biosynthesis and signaling networks. Plant Cell 2002, 14, S131–S151. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jain, D.; Chattopadhyay, D. Analysis of gene expression in response to water deficit of chickpea (Cicer arietinum L.) varieties differing in drought tolerance. BMC Plant Biol. 2010, 10, 1–14. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Peleg, Z.; Blumwald, E. Hormone balance and abiotic stress tolerance in crop plants. Curr. Opin. Plant Biol. 2011, 14, 290–295. [Google Scholar] [CrossRef] [PubMed]
- Kaashyap, M.; Ford, R.; Kudapa, H.; Jain, M.; Edwards, D.; Varshney, R.; Mantri, N. Differential regulation of genes involved in root morphogenesis and cell wall modification is associated with salinity tolerance in chickpea. Sci. Rep. 2018, 8, 1–19. [Google Scholar] [CrossRef]
- Hussain, R.M.; Ali, M.; Feng, X.; Li, X. The essence of NAC gene family to the cultivation of drought-resistant soybean (Glycine max L. Merr.) cultivars. BMC Plant Biol. 2017, 17, 1–11. [Google Scholar] [CrossRef] [Green Version]
- Wang, H.; Wang, H.; Shao, H.; Tang, X. Recent advances in utilizing transcription factors to improve plant abiotic stress tolerance by transgenic technology. Front. Plant Sci. 2016, 7, 67. [Google Scholar] [CrossRef] [Green Version]
- Ambawat, S.; Sharma, P.; Yadav, N.R.; Yadav, R.C. MYB transcription factor genes as regulators for plant responses: An overview. Physiol. Mol. Biol. Plants 2013, 19, 307–321. [Google Scholar] [CrossRef] [Green Version]
- Demidchik, V. Mechanisms of oxidative stress in plants: From classical chemistry to cell biology. Environ. Exp. Bot. 2015, 109, 212–228. [Google Scholar] [CrossRef]
- Xu, Y.; Zhou, Y.; Hong, S.; Xia, Z.; Cui, D.; Guo, J.; Xu, H.; Jiang, X. Functional characterization of a wheat NHX antiporter gene TaNHX2 that encodes a K+/H+ exchanger. PLoS ONE 2013, 8, e78098. [Google Scholar] [CrossRef] [PubMed]
- Golldack, D.; Li, C.; Mohan, H.; Probst, N. Tolerance to drought and salt stress in plants: Unraveling the signaling networks. Front. Plant Sci. 2014, 5, 151. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Soil Texture | EC (%) | pH | OC (%) | N (mg/kg Soil) | P (mg/kg Soil) | K (mg/kg Soil) |
---|---|---|---|---|---|---|
Sandy-loam | 0.09 | 7.50 | 0.18 | 86.33 | 3.67 | 165.0 |
Gene Symbol | Accession Number | Forward Primer (5′-3′) | Reverse Primer (5′-3′) |
---|---|---|---|
SbGPX | XM_002454470.2 | CAAGGACCAGGGTTTTGAGA | GAGTGCAAGCAAACTGGACA |
SbLEA3 | GQ494000.1 | CCGTTTGCTTGTTCAGGAGT | CAGCAACGGCGAATTAAACT |
SbP5CS1 | GQ377719.2 | GTCACCAGATGAACGCAAAA | CCTCAACATCGGCTTCATTT |
SbBADH1 | U12195.1 | AGCAGAAGCCTTGGACAAAA | AGCCCAACTACCCCCAATAG |
SbCIPK24 | XM_002438609.2 | TCTCCAGGAGCCAAGTCATT | CAAACCATGGGTCTGCTCTT |
SbSNAC1 | KC253232.1 | GACATGACCACCTCGCACT | GTTGTCCACGATCTCCGACT |
SbNCED3 | EER93751-1 | CGAGAACTTCGTGGTCGTG | CGACGTCTTCTCCTTGTCCA |
SbH+-PPase | GQ469975.1 | GCTACGGCGACTACCTCATC | CCTTCGGAGATAGCGTTCTG |
SbPP2A | XM_002448914.2 | AAAAGGCTGCAGAAACGAAG | GCTTCAATTGGGGCAGATAA |
Sample | Control | 6 dSm−1 | 8 dSm−1 | 10 dSm−1 | 12 dSm−1 |
---|---|---|---|---|---|
Raw reads | 45,567,498 | 41,357,149 | 41,021,478 | 40,148,349 | 40,011,123 |
Processed clean reads | 42,456,356 | 40,156,147 | 38,214,132 | 37,145,784 | 37,014,147 |
Alignment to clustered transcripts (%) | 92.11 | 90.46 | 86.23 | 84.64 | 81.97 |
High quality reads (%) | 90.37 | 85.95 | 83.95 | 83.56 | 80.74 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Punia, H.; Tokas, J.; Malik, A.; Sangwan, S.; Rani, A.; Yashveer, S.; Alansi, S.; Hashim, M.J.; El-Sheikh, M.A. Genome-Wide Transcriptome Profiling, Characterization, and Functional Identification of NAC Transcription Factors in Sorghum under Salt Stress. Antioxidants 2021, 10, 1605. https://doi.org/10.3390/antiox10101605
Punia H, Tokas J, Malik A, Sangwan S, Rani A, Yashveer S, Alansi S, Hashim MJ, El-Sheikh MA. Genome-Wide Transcriptome Profiling, Characterization, and Functional Identification of NAC Transcription Factors in Sorghum under Salt Stress. Antioxidants. 2021; 10(10):1605. https://doi.org/10.3390/antiox10101605
Chicago/Turabian StylePunia, Himani, Jayanti Tokas, Anurag Malik, Sonali Sangwan, Anju Rani, Shikha Yashveer, Saleh Alansi, Maha J. Hashim, and Mohamed A. El-Sheikh. 2021. "Genome-Wide Transcriptome Profiling, Characterization, and Functional Identification of NAC Transcription Factors in Sorghum under Salt Stress" Antioxidants 10, no. 10: 1605. https://doi.org/10.3390/antiox10101605
APA StylePunia, H., Tokas, J., Malik, A., Sangwan, S., Rani, A., Yashveer, S., Alansi, S., Hashim, M. J., & El-Sheikh, M. A. (2021). Genome-Wide Transcriptome Profiling, Characterization, and Functional Identification of NAC Transcription Factors in Sorghum under Salt Stress. Antioxidants, 10(10), 1605. https://doi.org/10.3390/antiox10101605