Bacillus amyloliquefaciens SC06 Induced AKT–FOXO Signaling Pathway-Mediated Autophagy to Alleviate Oxidative Stress in IPEC-J2 Cells
Abstract
:1. Introduction
2. Materials and Methods
2.1. BaSC06 Bacterial Strain Preparation
2.2. IPEC-J2 Cell Culture
2.3. Establishing Oxidative Stress Model in IPEC-J2 Cells
2.4. ROS Generation Analysis
2.5. Detection of Antioxidant Capacities
2.6. Apoptosis Cell Analysis by TUNEL Assay
2.7. Annexin V-FITC/PI Apoptosis Assay
2.8. Detection of Caspase-3 Activity
2.9. FOXO3a siRNA and Transfection
2.10. Western Blotting
2.11. Immunofluorescence Analysis
2.12. RNA Extractions and Quantitative Real-Time PCR (qPCR) Analysis
2.13. RNA Extraction and RNA-Seq Analysis
2.14. Statistical Analysis
3. Results
3.1. Establishment of Oxidative Stress Model Induced by Diquat in IPEC-J2 Cells
3.2. BaSC06 Alleviated Oxidative Stress Induced by DQ in IPEC-J2 Cells
3.3. BaSC06 Alleviated Oxidative Stress-Induced Apoptosis in IPEC-J2 Cells
3.4. BaSC06 Triggered Autophagy during Oxidative Stress in IPEC-J2 Cells
3.5. KEGG Pathway Analysis of DEGs
3.6. BaSC06 Can Regulate the Transcriptional Activity of FOXO3 Transcription Factor in IPEC-J2 Cells
3.7. BaSC06 Mediated Autophagy by the AKT–FOXO Signaling Pathway Independent of mTOR
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Qiao, Y.; Sun, J.; Ding, Y.; Le, G.; Shi, Y. Alterations of the gut microbiota in high-fat diet mice is strongly linked to oxidative stress. Appl. Microbiol. Biotechnol. 2012, 97, 1689–1697. [Google Scholar] [CrossRef] [PubMed]
- Diaz-Ochoa, V.E.; Lam, D.; Lee, C.S.; Klaus, S.; Behnsen, J.; Liu, J.Z.; Chim, N.; Nuccio, S.-P.; Rathi, S.G.; Mastroianni, J.R.; et al. Salmonella Mitigates Oxidative Stress and Thrives in the Inflamed Gut by Evading Calprotectin-Mediated Manganese Sequestration. Cell Host Microbe 2016, 19, 814–825. [Google Scholar] [CrossRef] [PubMed]
- Artis, D. Epithelial-cell recognition of commensal bacteria and maintenance of immune homeostasis in the gut. Nat. Rev. Immunol. 2008, 8, 411–420. [Google Scholar] [CrossRef] [PubMed]
- Brosnahan, A.J.; Brown, D.R. Porcine IPEC-J2 intestinal epithelial cells in microbiological investigations. Vet. Microbiol. 2012, 156, 229–237. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- McOrist, S.; Jasni, S.; Mackie, R.; Berschneider, H.; Rowland, A.; Lawson, G. Entry of the bacterium ileal symbiont intracellularis into cultured enterocytes and its subsequent release. Res. Vet. Sci. 1995, 59, 255–260. [Google Scholar] [CrossRef]
- Cai, X.; Chen, X.; Wang, X.; Xu, C.; Guo, Q.; Zhu, L.; Zhu, S.; Xu, J. Pre-protective effect of lipoic acid on injury induced by H2O2 in IPEC-J2 cells. Mol. Cell. Biochem. 2013, 378, 73–81. [Google Scholar] [CrossRef]
- Zhu, J.; Yin, X.; Yu, H.; Zhao, L.; Sabour, P.; Gong, J. Involvement of Quorum Sensing and Heat-Stable Enterotoxin a in Cell Damage Caused by a Porcine Enterotoxigenic Escherichia coli Strain. Infect. Immun. 2011, 79, 1688–1695. [Google Scholar] [CrossRef] [Green Version]
- Paszti-Gere, E.; Csibrik-Nemeth, E.; Szeker, K.; Csizinszky, R.; Jakab, C.; Galfi, P. Acute Oxidative Stress Affects IL-8 and TNF-α Expression in IPEC-J2 Porcine Epithelial Cells. Inflammation 2011, 35, 994–1004. [Google Scholar] [CrossRef]
- Scherz-Shouval, R.; Elazar, Z. ROS, mitochondria and the regulation of autophagy. Trends Cell Biol. 2007, 17, 422–427. [Google Scholar] [CrossRef]
- Das, G.; Shravage, B.; Baehrecke, E.H. Regulation and Function of Autophagy during Cell Survival and Cell Death. Cold Spring Harb. Perspect. Biol. 2012, 4, a008813. [Google Scholar] [CrossRef] [Green Version]
- Chowdhury, I.; Tharakan, B.; Bhat, G.K. Current concepts in apoptosis: The physiological suicide program revisited. Cell. Mol. Biol. Lett. 2006, 11, 506–525. [Google Scholar] [CrossRef]
- Yoshimori, T. Autophagy: A regulated bulk degradation process inside cells. Biochem. Biophys. Res. Commun. 2003, 313, 453–458. [Google Scholar] [CrossRef] [PubMed]
- Jiang, X.; Gu, S.; Liu, D.; Zhao, L.; Xia, S.; He, X.; Chen, H.; Ge, J. Lactobacillus brevis 23017 Relieves Mercury Toxicity in the Colon by Modulation of Oxidative Stress and Inflammation Through the Interplay of MAPK and NF-κB Signaling Cascades. Front. Microbiol. 2018, 9, 2425. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Guo, Y.; Chen, H.; Wei, H.; Wan, C. Potential of Lactobacillus plantarum ZDY2013 and Bifidobacterium bifidum WBIN03 in relieving colitis by gut microbiota, immune, and anti-oxidative stress. Can. J. Microbiol. 2018, 64, 327–337. [Google Scholar] [CrossRef] [PubMed]
- de Souza, M.; Baptista, A.A.S.; Valdiviezo, M.J.; Justino, L.; Menck-Costa, M.F.; Ferraz, C.R.; da Gloria, E.M.; Verri, W.A.; Bracarense, A.P.F. Lactobacillus spp. reduces morphological changes and oxidative stress induced by deoxynivalenol on the intestine and liver of broilers. Toxicon 2020, 185, 203–212. [Google Scholar] [CrossRef]
- Ai, Q.; Xu, H.; Mai, K.; Xu, W.; Wang, J.; Zhang, W. Effects of dietary supplementation of Bacillus subtilis and fructooligosaccharide on growth performance, survival, non-specific immune response and disease resistance of juvenile large yellow croaker, Larimichthys crocea. Aquaculture 2011, 317, 155–161. [Google Scholar] [CrossRef]
- Li, X.; Qiang, L.; Xu, C.; Liu. Effects of Supplementation of Fructooligosaccharide and/or Bacillus Subtilis to Diets on Performance and on Intestinal Microflora in Broilers. Arch. Anim. Breed. 2008, 51, 64–70. [Google Scholar] [CrossRef] [Green Version]
- Shang, X.; Yu, P.; Yin, Y.; Zhang, Y.; Lu, Y.; Mao, Q.; Li, Y. Effect of selenium-rich Bacillus subtilis against mercury-induced intestinal damage repair and oxidative stress in common carp. Comp. Biochem. Physiol. Part C Toxicol. Pharmacol. 2020, 239, 108851. [Google Scholar] [CrossRef]
- Lin, Y.-S.; Saputra, F.; Chen, Y.-C.; Hu, S.-Y. Dietary administration of Bacillus amyloliquefaciens R8 reduces hepatic oxidative stress and enhances nutrient metabolism and immunity against Aeromonas hydrophila and Streptococcus agalactiae in zebrafish (Danio rerio). Fish Shellfish Immunol. 2018, 86, 410–419. [Google Scholar] [CrossRef]
- Jia, R.; Sadiq, F.A.; Liu, W.; Cao, L.; Shen, Z. Protective effects of Bacillus subtilis ASAG 216 on growth performance, antioxidant capacity, gut microbiota and tissues residues of weaned piglets fed deoxynivalenol contaminated diets. Food Chem. Toxicol. 2021, 148, 111962. [Google Scholar] [CrossRef]
- Diao, Y.; Xin, Y.; Zhou, Y.; Li, N.; Pan, X.; Qi, S.; Qi, Z.; Xu, Y.; Luo, L.; Wan, H.; et al. Extracellular polysaccharide from Bacillus sp. strain LBP32 prevents LPS-induced inflammation in RAW 264.7 macrophages by inhibiting NF-κB and MAPKs activation and ROS production. Int. Immunopharmacol. 2013, 18, 12–19. [Google Scholar] [CrossRef] [PubMed]
- Bai, K.; Huang, Q.; Zhang, J.; He, J.; Zhang, L.; Wang, T. Supplemental effects of probiotic Bacillus subtilis fmbJ on growth performance, antioxidant capacity, and meat quality of broiler chickens. Poult. Sci. 2017, 96, 74–82. [Google Scholar] [CrossRef]
- Liang, Z.; Yuan, Z.; Guo, J.; Wu, J.; Yi, J.; Deng, J.; Shan, Y. Ganoderma lucidum Polysaccharides Prevent Palmitic Acid-Evoked Apoptosis and Autophagy in Intestinal Porcine Epithelial Cell Line via Restoration of Mitochondrial Function and Regulation of MAPK and AMPK/Akt/mTOR Signaling Pathway. Int. J. Mol. Sci. 2019, 20, 478. [Google Scholar] [CrossRef] [Green Version]
- Nunes, T.; Bernardazzi, C.; De Souza, H.S. Cell Death and Inflammatory Bowel Diseases: Apoptosis, Necrosis, and Autophagy in the Intestinal Epithelium. BioMed Res. Int. 2014, 2014. [Google Scholar] [CrossRef]
- El-Din, S.H.S.; Salem, M.; El-Lakkany, N.; Hammam, O.; Nasr, S.; Okasha, H.; Ahmed, L.; Saleh, S.; Botros, S. Early intervention with probiotics and metformin alleviates liver injury in NAFLD rats via targeting gut microbiota dysbiosis and p-AKT/mTOR/LC-3II pathways. Hum. Exp. Toxicol. 2021, 40, 1496–1509. [Google Scholar] [CrossRef]
- Cui, Y.; Liu, L.; Dou, X.; Wang, C.; Zhang, W.; Gao, K.; Liu, J.; Wang, H. Lactobacillus reuteri ZJ617 maintains intestinal integrity via regulating tight junction, autophagy and apoptosis in mice challenged with lipopolysaccharide. Oncotarget 2017, 8, 77489–77499. [Google Scholar] [CrossRef]
- Wu, Y.; Wang, B.; Xu, H.; Tang, L.; Li, Y.; Gong, L.; Wang, Y.; Li, W. Probiotic Bacillus Attenuates Oxidative Stress- Induced Intestinal Injury via p38-Mediated Autophagy. Front. Microbiol. 2019, 10, 2185. [Google Scholar] [CrossRef]
- Chalubinski, M.; Wojdan, K.; Gorzelak-Pabiś, P.; Borowiec, M.; Broncel, M. The effect of oxidized cholesterol on barrier functions and IL-10 mRNA expression in human intestinal epithelium co-cultured with dendritic cells in the transwell system. Food Chem. Toxicol. 2014, 69, 289–293. [Google Scholar] [CrossRef]
- Xiao, K.; Jiao, L.; Cao, S.; Song, Z.; Hu, C.; Han, X. Whey protein concentrate enhances intestinal integrity and influences transforming growth factor-β1 and mitogen-activated protein kinase signalling pathways in piglets after lipopolysaccharide challenge. Br. J. Nutr. 2016, 115, 984–993. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jones, G.M.; Vale, J.A. Mechanisms of Toxicity, Clinical Features, and Management of Diquat Poisoning: A Review. J. Toxicol. Clin. Toxicol. 2000, 38, 123–128. [Google Scholar] [CrossRef] [PubMed]
- Daitoku, H.; Sakamaki, J.-I.; Fukamizu, A. Regulation of FoxO transcription factors by acetylation and protein–protein interactions. Biochim. et Biophys. Acta (BBA)-Bioenerg. 2011, 1813, 1954–1960. [Google Scholar] [CrossRef] [Green Version]
- Abdollahi, M.; Ranjbar, A.; Shadnia, S.; Nikfar, S.; Rezaie, A. Pesticides and oxidative stress: A review. Med. Sci. Monit. 2004, 10, RA141–RA147. [Google Scholar]
- Lv, M.; Yu, B.; Mao, X.B.; Zheng, P.; He, J.; Chen, D.W. Responses of growth performance and tryptophan metabolism to oxidative stress induced by diquat in weaned pigs. Animal 2012, 6, 928–934. [Google Scholar] [CrossRef]
- Lu, T.; Piao, X.; Zhang, Q.; Wang, D.; Kim, S.W. Protective effects of Forsythia suspensa extract against oxidative stress induced by diquat in rats. Food Chem. Toxicol. 2010, 48, 764–770. [Google Scholar] [CrossRef]
- Wu, K.C.; Zhang, Y.; Klaassen, C.D. Nrf2 protects against diquat-induced liver and lung injury. Free Radic. Res. 2012, 46, 1220–1229. [Google Scholar] [CrossRef]
- Xu, C.; Guo, Y.; Qiao, L.; Ma, L.; Cheng, Y.; Roman, A. Biogenic Synthesis of Novel Functionalized Selenium Nanoparticles by Lactobacillus casei ATCC 393 and Its Protective Effects on Intestinal Barrier Dysfunction Caused by Enterotoxigenic Escherichia coli K88. Front. Microbiol. 2018, 9, 1129. [Google Scholar] [CrossRef] [Green Version]
- Kang, R.; Li, R.; Dai, P.; Li, Z.; Li, Y.; Li, C. Deoxynivalenol induced apoptosis and inflammation of IPEC-J2 cells by promoting ROS production. Environ. Pollut. 2019, 251, 689–698. [Google Scholar] [CrossRef] [PubMed]
- McCord, J.M.; Edeas, M. SOD, oxidative stress and human pathologies: A brief history and a future vision. Biomed. Pharmacother. 2005, 59, 139–142. [Google Scholar] [CrossRef] [PubMed]
- Yin, J.; Liu, M.; Ren, W.; Duan, J.; Yang, G.; Zhao, Y.; Fang, R.; Chen, L.; Li, T.; Yin, Y. Effects of Dietary Supplementation with Glutamate and Aspartate on Diquat-Induced Oxidative Stress in Piglets. PLoS ONE 2015, 10, e0122893. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cao, S.; Wu, H.; Wang, C.; Zhang, Q.; Jiao, L.; Lin, F.; Hu, C.H. Diquat-induced oxidative stress increases intestinal permeability, impairs mitochondrial function, and triggers mitophagy in piglets1. J. Anim. Sci. 2018, 96, 1795–1805. [Google Scholar] [CrossRef]
- Chong, S.J.F.; Low, I.C.C.; Pervaiz, S. Mitochondrial ROS and involvement of Bcl-2 as a mitochondrial ROS regulator. Mitochondrion 2014, 19, 39–48. [Google Scholar] [CrossRef] [PubMed]
- Wu, C.; Fujihara, H.; Yao, J.; Qi, S.; Li, H.; Shimoji, K.; Baba, H. Different Expression Patterns of Bcl-2, Bcl-xl, and Bax Proteins After Sublethal Forebrain Ischemia in C57Black/Crj6 Mouse Striatum. Stroke 2003, 34, 1803–1808. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Boulares, H.; Yakovlev, A.; Ivanova, V.; Stoica, B.; Hasan, S.K.; Iyer, S.; Smulson, M. Caspase-3 resistant PARP mutant increases rates of apoptosis in transfected osteosarcoma cells. Faseb J. 1999, 13, A518. [Google Scholar]
- Loh, K.P.; Huang, S.H.; De Silva, R.; Tan, B.K.H.; Zhu, Y.Z. Oxidative Stress: Apoptosis in Neuronal Injury. Curr. Alzheimer Res. 2006, 3, 327–337. [Google Scholar] [CrossRef] [PubMed]
- Galati, S.; Boni, C.; Gerra, M.C.; Lazzaretti, M.; Buschini, A. Autophagy: A Player in response to Oxidative Stress and DNA Damage. Oxid. Med. Cell. Longev. 2019, 2019. [Google Scholar] [CrossRef] [Green Version]
- Singh, S.; Kumar, R.; Garg, G.; Singh, A.K.; Verma, A.K.; Bissoyi, A.; Rizvi, S.I. Spermidine, a caloric restriction mimetic, provides neuroprotection against normal and d-galactose-induced oxidative stress and apoptosis through activation of autophagy in male rats during aging. Biogerontology 2020, 22, 35–47. [Google Scholar] [CrossRef]
- Shi, S.; Tian, T.; Li, Y.; Xiao, D.; Zhang, T.; Gong, P.; Lin, Y. Tetrahedral Framework Nucleic Acid Inhibits Chondrocyte Apoptosis and Oxidative Stress through Activation of Autophagy. ACS Appl. Mater. Interfaces 2020, 12, 56782–56791. [Google Scholar] [CrossRef]
- Li, D.L.; Mao, L.; Gu, Q.; Wei, F.; Gong, Y.-Y. Quercetin protects retina external barrier from oxidative stress injury by promoting autophagy. Cutan. Ocul. Toxicol. 2020, 40, 7–13. [Google Scholar] [CrossRef]
- Mammucari, C.; Milan, G.; Romanello, V.; Masiero, E.; Rudolf, R.; Del Piccolo, P.; Burden, S.J.; Di Lisi, R.; Sandri, C.; Zhao, J.; et al. FoxO3 Controls Autophagy in Skeletal Muscle In Vivo. Cell Metab. 2007, 6, 458–471. [Google Scholar] [CrossRef]
- Cao, D.J.; Jiang, N.; Blagg, A.; Johnstone, J.L.; Gondalia, R.; Oh, M.; Luo, X.; Yang, K.; Shelton, J.M.; Rothermel, B.A.; et al. Mechanical Unloading Activates FoxO3 to Trigger Bnip3-Dependent Cardiomyocyte Atrophy. J. Am. Heart Assoc. 2013, 2, e000016. [Google Scholar] [CrossRef] [Green Version]
- Sengupta, A.; Molkentin, J.; Yutzey, K.E. FoxO Transcription Factors Promote Autophagy in Cardiomyocytes. J. Biol. Chem. 2009, 284, 28319–28331. [Google Scholar] [CrossRef] [Green Version]
- Dey, G.; Bharti, R.; Dhanarajan, G.; Das, S.; Dey, K.K.; Kumar, B.N.P.; Sen, R.; Mandal, M. Marine lipopeptide Iturin A inhibits Akt mediated GSK3β and FoxO3a signaling and triggers apoptosis in breast cancer. Sci. Rep. 2015, 5, 10316. [Google Scholar] [CrossRef] [Green Version]
- Hagenbuchner, J.; Ausserlechner, M.J. Mitochondria and FOXO3: Breath or die. Front. Physiol. 2013, 4, 147. [Google Scholar] [CrossRef] [Green Version]
- Bánréti, Á.; Sass, M.; Graba, Y. The emerging role of acetylation in the regulation of autophagy. Autophagy 2013, 9, 819–829. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Salminen, A.; Kaarniranta, K.; Kauppinen, A. Crosstalk between Oxidative Stress and SIRT1: Impact on the Aging Process. Int. J. Mol. Sci. 2013, 14, 3834–3859. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Brunet, A.; Sweeney, L.B.; Sturgill, J.F.; Chua, K.F.; Greer, P.L.; Lin, Y.; Tran, H.; Ross, S.E.; Mostoslavsky, R.; Cohen, H.Y.; et al. Stress-Dependent Regulation of FOXO Transcription Factors by the SIRT1 Deacetylase. Science 2004, 303, 2011–2015. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- van der Horst, A.; Tertoolen, L.G.J.; de Vries-Smits, L.M.M.; Frye, R.A.; Medema, R.; Burgering, B.M.T. FOXO4 Is Acetylated upon Peroxide Stress and Deacetylated by the Longevity Protein hSir2. J. Biol. Chem. 2004, 279, 28873–28879. [Google Scholar] [CrossRef] [Green Version]
- Sengupta, A.; Molkentin, J.; Paik, J.-H.; DePinho, R.; Yutzey, K.E. FoxO Transcription Factors Promote Cardiomyocyte Survival upon Induction of Oxidative Stress. J. Biol. Chem. 2011, 286, 7468–7478. [Google Scholar] [CrossRef] [Green Version]
- Xiong, S.; Salazar, G.; Patrushev, N.; Alexander, R.W. FoxO1 Mediates an Autofeedback Loop Regulating SIRT1 Expression. J. Biol. Chem. 2011, 286, 5289–5299. [Google Scholar] [CrossRef] [Green Version]
- Yamamoto, T.; Sadoshima, J. Protection of the Heart Against Ischemia/Reperfusion by Silent Information Regulator 1. Trends Cardiovasc. Med. 2011, 21, 27–32. [Google Scholar] [CrossRef] [Green Version]
- Shin, H.R.; Kim, H.; Kim, K.I.; Baek, S.H. Epigenetic and transcriptional regulation of autophagy. Autophagy 2016, 12, 2248–2249. [Google Scholar] [CrossRef] [Green Version]
- Van Der Vos, K.E.; Eliasson, P.; Proikas-Cezanne, T.; Vervoort, S.J.; van Boxtel, R.; Putker, M.; Van Zutphen, I.J.; Mauthe, M.; Zellmer, S.; Pals, C.; et al. Modulation of glutamine metabolism by the PI(3)K–PKB–FOXO network regulates autophagy. Nature 2012, 14, 829–837. [Google Scholar] [CrossRef]
- Momota, H.; Nerio, E.; Holland, E.C. Perifosine Inhibits Multiple Signaling Pathways in Glial Progenitors and Cooperates With Temozolomide to Arrest Cell Proliferation in Gliomas In vivo. Cancer Res. 2005, 65, 7429–7435. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, J.Y.; Duan, Z.B.; Guo, W.J.; Zeng, L.; Wu, Y.D.; Chen, Y.L.; Tai, F.; Wang, Y.F.; Lin, Y.W.; Zhang, Q.; et al. Targeting the BRD4/FOXO3a/CDK6 axis sensitizes AKT inhibition in luminal breast cancer. Nat. Commun. 2018, 9, 5200. [Google Scholar] [CrossRef]
- Nakatogawa, H. Two ubiquitin-like conjugation systems that mediate membrane formation during autophagy. Essays Biochem. 2013, 55, 39–50. [Google Scholar] [CrossRef] [PubMed]
- Romanov, J.; Walczak, M.; Ibiricu, I.; Schüchner, S.; Ogris, E.; Kraft, C.; Martens, S. Mechanism and functions of membrane binding by the Atg5-Atg12/Atg16 complex during autophagosome formation. EMBO J. 2012, 31, 4304–4317. [Google Scholar] [CrossRef]
Gene Name. | Access No. | Sequences | |
---|---|---|---|
Sense(5′-3′) | Antisense(5′-3′) | ||
sscFOXO3a-608 | NM_001135959.1 | CCGGCUGGAAGAACUCUAUTT | AUAGAGUUCUUCCAGCCGGTT |
sscFOXO3a-1115 | NM_001135959.1 | CCGGAACCAUGAAUCUCAATT | UUGAGAUUCAUGGUUCCGGTT |
sscFOXO3a-1928 | NM_001135959.1 | CCCUCAUCUCCACACAGAATT | UUCUGUGUGGAGAUGAGGGTT |
Negative Control | NM_001135959.1 | UUCUCCGAACGUGUCACGUTT | ACGUGACACGUUCGGAGAATT |
Gene | Access No. | Primers Sequence | Length |
---|---|---|---|
GAPDH | NM_001206359.1 | F: CGGAGTGAACGGATTTGGC | 248 |
R: CACCCCATTTGATGTTGGCG | |||
ATG5 | NM_001037152.2 | F: AGTCAACCCTCCAATACCCAG | 299 |
R: TGTGGCCCTCTCTAGGTTTCT | |||
ATG12 | NM_001190282.1 | F: AGGTTGGATACCCGCCTACT | 111 |
R: ACTTGGTTGGAGCAATCT | |||
ATG16L1 | NM_001190272.1 | F: CTGCCAGTCGAACAGGATGA | 166 |
R: AGCGCCTCCCAAAGATATTAGT | |||
ATG8 | NM_001190288.1 | F: CCACCTTCCCACTCAGCTTT | 187 |
R: GTGTATCCTACCTTCCCCGC | |||
ATG14 | XM_001924990.5 | F: GCTTACACTGGACACCGCTA | 125 |
R: CCCCACGGCTTAACCTCTTT | |||
Caspase-8 | NM_001031779.2 | F: CCAGGATTTGCCTCCGGTTA | 108 |
R: GCCAGGTCATCACTGTCCAA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tang, L.; Zeng, Z.; Zhou, Y.; Wang, B.; Zou, P.; Wang, Q.; Ying, J.; Wang, F.; Li, X.; Xu, S.; et al. Bacillus amyloliquefaciens SC06 Induced AKT–FOXO Signaling Pathway-Mediated Autophagy to Alleviate Oxidative Stress in IPEC-J2 Cells. Antioxidants 2021, 10, 1545. https://doi.org/10.3390/antiox10101545
Tang L, Zeng Z, Zhou Y, Wang B, Zou P, Wang Q, Ying J, Wang F, Li X, Xu S, et al. Bacillus amyloliquefaciens SC06 Induced AKT–FOXO Signaling Pathway-Mediated Autophagy to Alleviate Oxidative Stress in IPEC-J2 Cells. Antioxidants. 2021; 10(10):1545. https://doi.org/10.3390/antiox10101545
Chicago/Turabian StyleTang, Li, Zihan Zeng, Yuanhao Zhou, Baikui Wang, Peng Zou, Qi Wang, Jiafu Ying, Fei Wang, Xiang Li, Shujie Xu, and et al. 2021. "Bacillus amyloliquefaciens SC06 Induced AKT–FOXO Signaling Pathway-Mediated Autophagy to Alleviate Oxidative Stress in IPEC-J2 Cells" Antioxidants 10, no. 10: 1545. https://doi.org/10.3390/antiox10101545
APA StyleTang, L., Zeng, Z., Zhou, Y., Wang, B., Zou, P., Wang, Q., Ying, J., Wang, F., Li, X., Xu, S., Zhao, P., & Li, W. (2021). Bacillus amyloliquefaciens SC06 Induced AKT–FOXO Signaling Pathway-Mediated Autophagy to Alleviate Oxidative Stress in IPEC-J2 Cells. Antioxidants, 10(10), 1545. https://doi.org/10.3390/antiox10101545