Eleven Crucial Pesticides Appear to Regulate Key Genes That Link MPTP Mechanism to Cause Parkinson’s Disease through the Selective Degeneration of Dopamine Neurons
Abstract
:1. Introduction
2. Materials and Methods
2.1. Text Mining and Pesticide Structure Collection
2.2. Receptors of Dopaminergic Neurons and Structure Modeling
2.3. Molecular Docking
2.4. Receptor Network Analysis Differential Genes in the Network
2.5. Participant Recruitment
2.6. Pesticide Analysis for Samples Classification
2.7. Sample Processing and Gene Expression Analysis
2.8. Statistical Analysis
3. Results
3.1. Data Retrieval
3.2. Structure Modeling and Molecular Docking
3.3. Pesticide–Receptor Protein Network
3.4. Regulatory Pathway and Protein Prioritization
3.5. Pesticide Detection Using GC-MS and Validation of Biomarkers
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Tran, J.; Anastacio, H.; Bardy, C. Genetic predispositions of Parkinson’s disease revealed in patient-derived brain cells. NPJ Parkinson’s Dis. 2020, 6, 8. [Google Scholar] [CrossRef] [Green Version]
- Yuan, X.; Tian, Y.; Liu, C.; Zhang, Z. Environmental factors in Parkinson’s disease: New insights into the molecular mechanisms. Toxicol. Lett. 2022, 356, 1–10. [Google Scholar] [CrossRef]
- DeMaagd, G.; Philip, A. Parkinson’s disease and its management: Part 1: Disease entity, risk factors, pathophysiology, clinical presentation, and diagnosis. Pharm. Ther. 2015, 40, 504. [Google Scholar]
- Kishore Kumar, S.N.; Deepthy, J.; Saraswathi, U.; Thangarajeswari, M.; YogeshKanna, S.; Ezhil, P.; Kalaiselvi, P. Morindacitrifolia mitigates rotenone-induced striatal neuronal loss in male Sprague-Dawley rats by preventing mitochondrial pathway of intrinsic apoptosis. Redox Rep. 2017, 22, 418–429. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mustapha, M.; Mat Taib, C.N. MPTP-induced mouse model of Parkinson’s disease: A promising direction of therapeutic strategies. Bosn. J. Basic Med. Sci. 2021, 21, 422–433. [Google Scholar] [PubMed]
- Verma, A.; Kommaddi, R.P.; Gnanabharathi, B.; Hirsch, E.C.; Ravindranath, V. Genes critical for development and differentiation of dopaminergic neurons are downregulated in Parkinson’s disease. J. Neural. Transm. 2023, 130, 495–512. [Google Scholar] [CrossRef]
- Rudenok, M.M.; Shadrina, M.I.; Filatova, E.V.; Rybolovlev, I.N.; Nesterov, M.S.; Abaimov, D.A.; Ageldinov, R.A.; Kolacheva, A.A.; Ugrumov, M.V.; Slominsky, P.A.; et al. Expression Analysis of Genes Involved in Transport Processes in Mice with MPTP-Induced Model of Parkinson’s Disease. Life 2022, 12, 751. [Google Scholar] [CrossRef] [PubMed]
- Vellingiri, B.; Chandrasekhar, M.; Sabari, S.S.; Gopalakrishnan, A.V.; Narayanasamy, A.; Venkatesan, D.; Iyer, M.; Kesari, K.; Dey, A. Neurotoxicity of pesticides–A link to neurodegeneration. Ecotoxicol. Environ. Saf. 2022, 243, 113972. [Google Scholar] [CrossRef]
- Benmoyal-Segal, L.; Soreq, L.; Ben-Shaul, Y.; Ben-Ari, S.; Ben-Moshe, T.; Aviel, S.; Bergman, H.; Soreq, H. Adaptive alternative splicing correlates with less environmental risk of parkinsonism. Neurodegener. Dis. 2012, 9, 87–98. [Google Scholar] [CrossRef]
- Freire, C.; Koifman, S. Pesticide exposure and Parkinson’s disease: Epidemiological evidence of association. Neurotoxicology 2012, 33, 947–971. [Google Scholar] [CrossRef]
- Tsai, Y.H.; Lein, P.J. Mechanisms of organophosphate neurotoxicity. Curr. Opin. Toxicol. 2021, 26, 49–60. [Google Scholar] [CrossRef]
- Rai, S.N.; Dilnashin, H.; Birla, H.; Singh, S.S.; Zahra, W.; Rathore, A.S.; Singh, B.K.; Singh, S.P. The Role of PI3K/Akt and ERK in Neurodegenerative Disorders. Neurotox. Res. 2019, 35, 775–795. [Google Scholar] [CrossRef]
- Nakano, N.; Matsuda, S.; Ichimura, M.; Minami, A.; Ogino, M.; Murai, T.; Kitagishi, Y. PI3K/AKT signaling mediated by G protein-coupled receptors is involved in neurodegenerative Parkinson’s disease. Int. J. Mol. Med. 2017, 39, 253–260. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Desale, S.E.; Chidambaram, H.; Chinnathambi, S. G-protein coupled receptor, PI3K and Rho signaling pathways regulate the cascades of Tau and amyloid-β in Alzheimer’s disease. Mol. Biomed. 2021, 2, 17. [Google Scholar] [CrossRef] [PubMed]
- Somvanshi, P.R.; Venkatesh, K.V. A conceptual review on systems biology in health and diseases: From biological networks to modern therapeutics. Syst. Synth. Biol. 2014, 8, 99–116. [Google Scholar] [CrossRef] [Green Version]
- Mayer, B. Using systems biology to evaluate targets and mechanism of action of drugs for diabetes comorbidities. Diabetologia 2016, 59, 2503–2506. [Google Scholar] [CrossRef] [Green Version]
- Waterhouse, A.; Bertoni, M.; Bienert, S.; Studer, G.; Tauriello, G.; Gumienny, R.; Heer, F.T.; de Beer, T.A.; Rempfer, C.; Bordoli, L.; et al. SWISS-MODEL: Homology modelling of protein structures and complexes. Nucleic Acids Res. 2018, 46, W296–W303. [Google Scholar] [CrossRef] [Green Version]
- Sobolev, O.V.; Afonine, P.V.; Moriarty, N.W.; Hekkelman, M.L.; Joosten, R.P.; Perrakis, A.; Adams, P.D. A Global Ramachandran Score Identifies Protein Structures with Unlikely Stereochemistry. Structure 2020, 28, 1249–1258. [Google Scholar] [CrossRef] [PubMed]
- Kirubhanand, C.; Merciline Leonora, J.; Anitha, S.; Sangeetha, R.; Nachammai, K.T.; Langeswaran, K.; Gowtham Kumar, S. Targeting potential receptor molecules in non-small cell lung cancer (NSCLC) using in-silico approaches. Front. Mol. Biosci. 2023, 10, 1124563. [Google Scholar] [CrossRef] [PubMed]
- Pandi, S.; Kulanthaivel, L.; Subbaraj, G.K.; Rajaram, S.; Subramanian, S. Screening of Potential Breast Cancer Inhibitors through Molecular Docking and Molecular Dynamics Simulation. Biomed. Res. Int. 2022, 2022, 3338549. [Google Scholar] [CrossRef] [PubMed]
- Du, J.; Li, M.; Yuan, Z.; Guo, M.; Song, J.; Xie, X.; Chen, Y. A decision analysis model for KEGG pathway analysis. BMC Bioinform. 2016, 17, 1–2. [Google Scholar] [CrossRef] [Green Version]
- Li, W.; Zhang, Y.; Wang, Y.; Rong, Z.; Liu, C.; Miao, H.; Chen, H.; He, Y.; He, W.; Chen, L. Candidate gene prioritization for chronic obstructive pulmonary disease using expression information in protein-protein interaction networks. BMC Pulm. Med. 2021, 21, 280. [Google Scholar] [CrossRef] [PubMed]
- Srivastava, A.; Rai, S.; Kumar Sonker, A.; Karsauliya, K.; Pandey, C.P.; Singh, S.P. Simultaneous determination of multiclass pesticide residues in human plasma using a mini QuEChERS method. Anal. Bioanal. Chem. 2017, 409, 3757–3765. [Google Scholar] [CrossRef] [PubMed]
- Hassan, S.S.; Akram, M.; King, E.C.; Dockrell, H.M.; Cliff, J.M. PD-1, PD-L1 and PD-L2 gene expression on T-cells and natural killer cells declines in conjunction with a reduction in PD-1 protein during the intensive phase of tuberculosis treatment. PLoS ONE 2015, 10, e0137646. [Google Scholar] [CrossRef] [PubMed]
- Langston, J.W. The MPTP story. J. Parkinsons Dis. 2017, 7, 11–19. [Google Scholar] [CrossRef] [Green Version]
- Oda, W.; Fujita, Y.; Baba, K.; Mochizuki, H.; Niwa, H.; Yamashita, T. Inhibition of repulsive guidance molecule-a protects dopaminergic neurons in a mouse model of Parkinson’s disease. Cell Death Dis. 2021, 12, 181. [Google Scholar] [CrossRef]
- Pépin, É.; Jalinier, T.; Lemieux, G.L.; Massicotte, G.; Cyr, M. Sphingosine-1-phosphate receptors modulators decrease signs of neuroinflammation and prevent Parkinson’s disease symptoms in the 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine mouse model. Front. Pharmacol. 2020, 11, 77. [Google Scholar] [CrossRef] [Green Version]
- Soreq, L.; Bergman, H.; Israel, Z.; Soreq, H. Overlapping molecular signatures in Parkinson’s patients’ leukocytes before and after treatment and in mouse model brain regions. CNS Neurol. Disord. Drug Targets 2013, 8, 1086–1093. [Google Scholar] [CrossRef]
- Sukumaran, P.; Sun, Y.; Antonson, N.; Singh, B.B. Dopaminergic neurotoxins induce cell death by attenuating NF-κB-mediated regulation of TRPC1 expression and autophagy. FASEB J. 2018, 32, 1640–1652. [Google Scholar] [CrossRef] [Green Version]
- Meredith, G.E.; Rademacher, D.J. MPTP mouse models of Parkinson’s disease: An update. J. Parkinsons Dis. 2011, 1, 19–33. [Google Scholar] [CrossRef] [Green Version]
- Miyazaki, I.; Isooka, N.; Imafuku, F.; Sun, J.; Kikuoka, R.; Furukawa, C.; Asanuma, M. Chronic Systemic Exposure to Low-Dose Rotenone Induced Central and Peripheral Neuropathology and Motor Deficits in Mice: Reproducible Animal Model of Parkinson’s Disease. Int. J. Mol. Sci. 2020, 21, 3254. [Google Scholar] [CrossRef] [PubMed]
- Marchetti, B. Wnt/β-catenin signaling pathway governs a full program for dopaminergic neuron survival, neurorescue and regeneration in the MPTP mouse model of Parkinson’s disease. Int. J. Mol. Sci. 2018, 19, 3743. [Google Scholar] [CrossRef] [Green Version]
- Westphal, M.; Panza, P.; Kastenhuber, E.; Wehrle, J.; Driever, W. Wnt/β-catenin signaling promotes neurogenesis in the diencephalospinal dopaminergic system of embryonic zebrafish. Sci. Rep. 2022, 12, 1030. [Google Scholar] [CrossRef]
- Testa, N.; Caniglia, S.; Morale, M.C. A Wnt1 regulated Frizzled-1/b-Catenin signaling pathway as a candidate regulatory circuit controlling mesencephalic dopaminergic neuron-astrocyte crosstalk. Mol. Neurodegener. 2011, 6, 1–29. [Google Scholar]
- Chen, M.; Peng, L.; Gong, P.; Zheng, X.; Sun, T.; Zhang, X.; Huo, J. Baicalein Induces Mitochondrial Autophagy to Prevent Parkinson’s Disease in Rats via miR-30b and the SIRT1/AMPK/mTOR Pathway. Front. Neurol. 2022, 12, 2548. [Google Scholar] [CrossRef] [PubMed]
- Jiang, J.; Zuo, Y.; Gu, Z. Rapamycin protects the mitochondria against oxidative stress and apoptosis in a rat model of Parkinson’s disease. Int. J. Mol. Med. 2013, 31, 825–832. [Google Scholar] [CrossRef] [Green Version]
- Garza-Lombó, C.; Schroder, A.; Reyes-Reyes, E.M.; Franco, R. mTOR/AMPK signaling in the brain: Cell metabolism, proteostasis and survival. Curr. Opin. Toxicol. 2018, 8, 102–110. [Google Scholar] [CrossRef]
- Dominy, J.E.; Puigserver, P. Mitochondrial biogenesis through activation of nuclear signaling proteins. Cold Spring Harb. Perspect. Biol. 2013, 5, a015008. [Google Scholar] [CrossRef] [Green Version]
- Liu, J.; Xiao, Q.; Xiao, J.; Niu, C.; Li, Y.; Zhang, X.; Zhou, Z.; Shu, G.; Yin, G. Wnt/β-catenin signalling: Function, biological mechanisms, and therapeutic opportunities. Signal Transduct. Target Ther. 2022, 7, 3. [Google Scholar] [CrossRef]
- Wang, Y.; Pan, J.; Zhang, Y.; Li, X.; Zhang, Z.; Wang, P.; Qin, Z.; Li, J. Wnt and Notch signaling pathways in calcium phosphate-enhanced osteogenic differentiation: A pilot study. J. Biomed Mater. Res. B Appl. Biomater. 2019, 107, 149–160. [Google Scholar] [CrossRef] [Green Version]
- Surmeier, D.J.; Schumacker, P.T. Calcium, bioenergetics, and neuronal vulnerability in Parkinson’s disease. J. Biol. Chem. 2013, 288, 10736–10741. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- De, A. Wnt/Ca2+ signaling pathway: A brief overview. Acta Biochim. Biophys. Sin. 2011, 43, 745–756. [Google Scholar]
- Augustine, G.J.; Santamaria, F.; Tanaka, K. Local calcium signaling in neurons. Neuron 2003, 40, 331–346. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zaichick, S.V.; McGrath, K.M.; Caraveo, G. The role of Ca2+ signaling in Parkinson’s disease. Dis. Model Mech. 2017, 10, 519–535. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rivero-Ríos, P.; Gómez-Suaga, P.; Fdez, E.; Hilfiker, S. Upstream deregulation of calcium signaling in Parkinson’s disease. Front. Mol. Neurosci. 2014, 17, 53. [Google Scholar]
- Ha, T.Y.; Choi, Y.R.; Noh, H.R.; Cha, S.H.; Kim, J.B.; Park, S.M. Age-related increase in caveolin-1 expression facilitates cell-to-cell transmission of α-synuclein in neurons. Mol. Brain 2021, 14, 122. [Google Scholar] [CrossRef]
- Zschocke, J.; Manthey, D.; Bayatti, N.; van der Burg, B.; Goodenough, S.; Behl, C. Estrogen receptor alpha-mediated silencing of caveolin gene expression in neuronal cells. J. Biol. Chem. 2002, 277, 38772–38780. [Google Scholar] [CrossRef] [Green Version]
- Boulware, M.I.; Kordasiewicz, H.; Mermelstein, P.G. Caveolin proteins are essential for distinct effects of membrane estrogen receptors in neurons. J. Neurosci. 2007, 27, 9941–9950. [Google Scholar] [CrossRef] [Green Version]
- Li, Y.; Yang, H.; He, T.; Zhang, L.; Liu, C. Post-translational modification of Cav1. 2 and its role in neurodegenerative diseases. Front. Pharmacol. 2022, 12, 775087. [Google Scholar] [CrossRef]
- Sanyal, J.; Ahmed, S.S.; Ng, H.K.; Naiya, T.; Ghosh, E.; Banerjee, T.K.; Lakshmi, J.; Guha, G.; Rao, V.R. Metallomic Biomarkers in Cerebrospinal fluid and Serum in patients with Parkinson’s disease in Indian population. Sci. Rep. 2016, 6, 35097. [Google Scholar] [CrossRef] [Green Version]
- Alston, C.L.; Rocha, M.C.; Lax, N.Z.; Turnbull, D.M.; Taylor, R.W. The genetics and pathology of mitochondrial disease. J. Pathol. 2017, 241, 236–250. [Google Scholar] [CrossRef] [PubMed]
- Kmita, K.; Wirth, C.; Warnau, J.; Guerrero-Castillo, S.; Hunte, C.; Hummer, G.; Kaila, V.R.; Zwicker, K.; Brandt, U.; Zickermann, V. Accessory NUMM (NDUFS6) subunit harbors a Zn-binding site and is essential for biogenesis of mitochon-drial complex I. Proc. Natl. Acad. Sci. USA 2015, 112, 5685–5690. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kirby, D.M.; Salemi, R.; Sugiana, C.; Ohtake, A.; Parry, L.; Bell, K.M.; Kirk, E.P.; Boneh, A.; Taylor, R.W.; Dahl, H.H.; et al. NDUFS6 mutations are a novel cause of lethal neonatal mitochondrial complex I deficiency. J. Clin. Investig. 2004, 114, 837–845. [Google Scholar] [CrossRef]
- Chinta, S.J.; Andersen, J.K. Nitrosylation and nitration of mitochondrial complex I in Parkinson’s disease. Free Radic. Res. 2011, 45, 53–58. [Google Scholar] [CrossRef] [PubMed]
GENE (NCBI Accession) | Forward Primer | Reverse Primer | Amplicon Size (Base Pair) |
---|---|---|---|
CTNNB1 (XM_054345317) | CACAAGCAGAGTGCTGAAGGTG | GATTCCTGAGAGTCCAAAGACAG | 146 |
NDUFS6 (NM_004553) | GTTCAGACAGCACCACCACT | CACCAGGAATACCCTTCGCA | 124 |
CAV1 (NM_001172897) | AAGGGACACACAGTTTTGACG | TTGGCACCAGGAAAATTAAAA | 372 |
GAPDH (NM_001289745) | AAGGTGAAGGTCGGAGTCAA | ACATGTAAACCATGTAGTTGAGGT | 133 |
Gene Symbol | Gene Name Expansion |
---|---|
ABL1 | ABL proto-oncogene 1, non-receptor tyrosine kinase |
ACVR1B | Activin a receptor type 1b |
APP | Amyloid beta precursor protein |
ARAP1 | ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1 |
BAG6 | BAG cochaperone 6 |
CAV1 | Caveolin 1 |
CDC37 | Cell division cycle 37, HSP90 cochaperone |
CDC42 | Cell division cycle 42 |
CDK14 | Cyclin dependent kinase 14 |
CHGB | ChromograninB |
CHN1 | Chimerin 1 |
CSNK1A1 | Casein kinase 1 alpha 1 |
CTNNB1 | Catenin beta 1 |
CTSK | CathepsinK |
EP300 | E1A binding protein p300 |
FGF1 | Fibroblast growth factor 1 |
FGF18 | Fibroblast growth factor 18 |
FGF5 | Fibroblast growth factor 5 |
FGFR2 | Fibroblast growth factor receptor 2 |
GTF3C1 | General transcription factor IIIC subunit 1 |
HNRNPL | Heterogeneous nuclear ribonucleoprotein L |
IGSF1 | Immunoglobulin superfamily member 1 |
IKBKB | Inhibitor of nuclear factor kappa B kinase subunit beta |
INHBA | Inhibinsubunit beta A |
LGALS8 | Galectin 8 |
LMO3 | LIM domain only 3 |
MAP3K7 | Mitogen-activated protein kinase kinasekinase 7 |
NCOA1 | Nuclear receptor coactivator 1 |
NDUFS6 | NADH:ubiquinoneoxidoreductase subunit S6 |
NFKB1 | Nuclear factor kappa B subunit 1 |
PEG10 | Paternally expressed 10 |
PLEKHB1 | Pleckstrinhomology domain containing B1 |
PPP3CC | Protein phosphatase 3 catalytic subunit gamma |
PTBP1 | Polypyrimidine tract binding protein 1 |
RAB6B | RAB6B, member RAS oncogene family |
RAN | RAN, member RAS oncogene family |
RASL12 | RAS like family 12 |
SH2B1 | SH2B adaptor protein 1 |
SHC1 | SHC adaptor protein 1 |
GUSBP14 | GUSB pseudogene 14 |
SMAD2 | SMAD family member 2 |
SRPK2 | SRSF protein kinase 2 |
STAT1 | Signal transducer and activator of transcription 1 |
STAT3 | Signal transducer and activator of transcription 3 |
YWHAZ | Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta |
ZXDC | ZXD family zinc finger C |
Sl.No | Molecular Pathway |
---|---|
1 | Sphingolipid signaling pathway |
2 | Phospholipase D signaling pathway |
3 | mTOR signaling pathway |
4 | AMPK signaling pathway |
5 | Longevity regulating pathway |
6 | Notch signaling pathway |
7 | Hedgehog signaling pathway |
8 | Apelin signaling pathway |
9 | GnRH signaling pathway |
10 | Oxytocin signaling pathway |
11 | ErbB signaling pathway |
12 | cAMP signaling pathway |
13 | VEGF signaling pathway |
14 | Insulin signaling pathway |
15 | Estrogen signaling pathway |
16 | Glucagon signaling pathway |
17 | FoxO signaling pathway |
18 | B cell receptor signaling pathway |
19 | TNF signaling pathway |
20 | Adipocytokine signaling pathway |
21 | Relaxin signaling pathway |
22 | Prolactin signaling pathway |
23 | Thyroid hormone signaling pathway |
24 | Calcium signaling pathway |
25 | Wnt signaling pathway |
26 | T cell receptor signaling pathway |
27 | Rap1 signaling pathway |
28 | Chemokine signaling pathway |
29 | Neurotrophin signaling pathway |
30 | MAPK signaling pathway |
31 | Ras signaling pathway |
Clinical Parameters | Pesticide Exposed PD (Group-A: n = 23) | Non-Pesticide Exposed PD (Group-B; n = 25) | Healthy Control (Group-C: n = 21) | Statistical Significance | ||
---|---|---|---|---|---|---|
(Group-A Vs. Group-B) | (Group-A Vs. Group-C) | (Group-B Vs. Group-C) | ||||
Age (Years) | 57 ± 9.8 | 52 ± 4.8 | 53 ± 6.2 | X | X | X |
Gender (M: male, F: female) | M:13; F: 10 | M: 15; F: 10 | M: 11; F: 10 | -- | -- | -- |
Total for parts I–III (items 1–31) | 31.6 ± 2.4 | 30.2 ± 3.1 | X | -- | -- | |
Motor Scale (items 18–31) | 12.9 ±4.1 | 11.8± 5.7 | X | -- | -- | |
Hoehn and Yahr stage | 2.4 ±1.9 | 2.8± 1.2 | X | -- | -- |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Anirudhan, A.; Mattethra, G.C.; Alzahrani, K.J.; Banjer, H.J.; Alzahrani, F.M.; Halawani, I.F.; Patil, S.; Sharma, A.; Paramasivam, P.; Ahmed, S.S.S.J. Eleven Crucial Pesticides Appear to Regulate Key Genes That Link MPTP Mechanism to Cause Parkinson’s Disease through the Selective Degeneration of Dopamine Neurons. Brain Sci. 2023, 13, 1003. https://doi.org/10.3390/brainsci13071003
Anirudhan A, Mattethra GC, Alzahrani KJ, Banjer HJ, Alzahrani FM, Halawani IF, Patil S, Sharma A, Paramasivam P, Ahmed SSSJ. Eleven Crucial Pesticides Appear to Regulate Key Genes That Link MPTP Mechanism to Cause Parkinson’s Disease through the Selective Degeneration of Dopamine Neurons. Brain Sciences. 2023; 13(7):1003. https://doi.org/10.3390/brainsci13071003
Chicago/Turabian StyleAnirudhan, Athira, George Chandy Mattethra, Khalid J. Alzahrani, Hamsa Jameel Banjer, Fuad M. Alzahrani, Ibrahim F. Halawani, Shankargouda Patil, Ashutosh Sharma, Prabu Paramasivam, and Shiek S. S. J. Ahmed. 2023. "Eleven Crucial Pesticides Appear to Regulate Key Genes That Link MPTP Mechanism to Cause Parkinson’s Disease through the Selective Degeneration of Dopamine Neurons" Brain Sciences 13, no. 7: 1003. https://doi.org/10.3390/brainsci13071003