Next Article in Journal
The Multi-Branch Deep-Learning-Based Approach to Heart Dysfunction Classification
Next Article in Special Issue
A Metagenomic and Colorimetric Analysis of the Biological Recolonization Occurring at the “Largo da Porta Férrea” Statues (Coimbra UNESCO World Heritage Site), After Cleaning Interventions
Previous Article in Journal
Pedagogical Qualities of Artificial Intelligence-Assisted Teaching: An Exploratory Analysis of a Personal Tutor in a Voluntary Business Higher-Education Course
Previous Article in Special Issue
Microbial Diversity of Biodeteriorated Limestone Cultural Heritage Assets Identified Using Molecular Approaches—A Literature Review
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Applied Sciences
Volume 15
Issue 15
10.3390/app15158762
applsci-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
Correction published on 31 October 2025, see Appl. Sci. 2025, 15(21), 11630.
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Preventive Diagnosis of Biological Colonization and Salt-Related Decay on the Frescoes of the “Oratorio dell’Annunziata” (Riofreddo, Latium, Italy) to Improve Conservation Plans

by
Flavia Bartoli
1,
Annalaura Casanova Municchia
1,*,
Marco Tescari
2,
Ilaria Ciccone
3,
Paolo Rosati
4,
Alessandro Lazzara
3 and
Maria Catrambone
1
1
Institute of Heritage Science (ISPC), National Research Center (CNR), SP35d, 9, Montelibretti, 00010 Rome, Italy
2
Biology Laboratory, Supporto ALES S.p.A. c/o Istituto Centrale per il Restauro (ICR), Via di S. Michele, 25, 00153 Rome, Italy
3
Department of Science, Roma Tre University, Viale G. Marconi 446, 00146 Rome, Italy
4
Archeo&Arte3D, DigiLab, Sapienza University of Rome, Via Dei Volsci 122, 00185 Rome, Italy
*
Author to whom correspondence should be addressed.
Appl. Sci. 2025, 15(15), 8762; https://doi.org/10.3390/app15158762
Submission received: 8 July 2025 / Revised: 31 July 2025 / Accepted: 6 August 2025 / Published: 7 August 2025 / Corrected: 31 October 2025
(This article belongs to the Special Issue Application of Biology to Cultural Heritage III)
Browse Figures
Versions Notes

Abstract

The frescoed Annunziata Oratory chapel in Riofreddo (Italy), a unique testimony to the pontificate of Martin V, sheds light on the trade routes of Ninfa in the first half of the 15th century. Despite having undergone several restorations in the past (the most recent in the 2010s), the Oratory presents serious conservation issues. At first glance, there are no evident signs of biological colonization; rather, the most obvious damage is attributed to detachments and saline efflorescence. Biological colonization at several points was identified using various diagnostic field and laboratory techniques such as ATPase point analysis, field stereoscopy in visible and UV light, culture-based and molecular approaches, Raman spectroscopy, and SEM analysis, biological colonization at several points was identified. The characterization of salt efflorescence was carried out using ion chromatography analysis. The presence of bacteria, fungi and algae, which are also linked to saline efflorescence, was observed. A clear correlation between the biological colonization and salt efflorescence composition was highlighted by our results, as well as the potential sources of microorganisms and salts via the capillary rise of groundwater. This early diagnostic approach regarding the presence of lithobionts and salt efflorescence demonstrates the complex interplay between environmental factors and microbial colonization, which can lead to biodeterioration processes.

Graphical Abstract

1. Introduction

In conservation science, fresco deterioration is a well-documented and extensively studied issue [1,2,3,4,5,6,7,8,9]. The main conservation challenges affecting fresco paintings are largely attributable to their intrinsic material properties, such as the composition and thickness of the mortar layers (i.e., “arriccio” and plaster) and the chemical nature of the pigments [1,2,10,11].
Deterioration phenomena in monuments typically involve both structural and superficial alterations and often manifest at the interface between the substrate and surface materials, occurring across the macro-, meso- and microscales. These processes can result from physical, chemical or biological factors, which are influenced by microclimatic conditions, the overall conservation state of the environment, and the properties of the substrate.
Among these, salt crystallization is recognized as one of the most aggressive degradation processes affecting porous stone materials at cultural heritage sites. The growth of salt crystals generates internal mechanical stress, leading to several visible deterioration effects, including surface flaking, cracking, layer detachment, pigment alteration, efflorescence, sub-efflorescence and crust formation on the surface. These mechanisms can induce an irreversible loss of the original material [12,13]. Salts may be present due to the original construction materials or may originate from external sources, including groundwater transported via capillary rise, depending on the pore size distribution and wetting behavior of the materials. Additionally, airborne pollution, such as particulate matter, marine aerosols, and atmospheric contaminants, can deposit on the surfaces and progressively penetrate into the porous matrix [14,15,16].
In addition to their direct mechanical and chemical effects, soluble salts may also promote the colonization of specific biodeteriogenic microorganisms, including bacteria, fungi, and algae [17]. Therefore, the quantitative determination of both anions and cations is critical for assessing the chemical degradation risk and for understanding and preventing microbially induced deterioration [18].
The scientific literature reports several data on the main biodeterioration phenomena, detailing their characterization and primary composition. Bacterial genera of the phylum Actinomycetota, Bacillota and Pseudomonadota, and fungi classes including Sordariomycetes and Eurotiomycetes, are among the most frequently encountered. Despite being typically sheltered in indoor environments, mural paintings can also host photoautotrophic organisms. In fact, cyanobacteria (e.g., Cyanophyceae) and green algae (e.g., Trebouxiophyceae and diatoms) have been documented under certain conditions [9,19,20,21,22,23,24,25,26,27,28,29].
As previously noted [30,31], microbial communities colonizing frescoes often display slow metabolic activity and may remain dormant for extended periods. Nevertheless, their biodeteriorative potential—including biomineralization, secretion of chelating or acidic compounds, and mechanical penetration by hyphae—remains a significant risk to the material integrity of artworks [20,31,32].
This study aimed to identify biological colonization affecting frescoes that are not visible to the naked eye and to assess the potential correlation between characterized salt efflorescence and microbial growth on the painted surfaces of the Annunziata Oratory (Riofreddo, Italy), through a multidisciplinary diagnostic campaign. The investigation began with non-invasive in situ analyses conducted with the support of MOLAB, the mobile laboratory of the E-RIHS research infrastructure (https://www.e-rihs.it/en/laboratori-mobili/, accessed 30 March 2025), to determine the main lithobionts and soluble salts involved aimed to a correct conservation strategy.

2. Materials and Methods

2.1. “Oratorio dell’Annunziata” Chapel

The Oratory of the Annunziata in Riofreddo, built in the early 15th century in eastern Lazio (Figure 1 and Figure 2a), preserves one of the few surviving fresco cycles from that period in this region. Commissioned by Antonio Colonna around 1422, the frescoes belong to the broader artistic revival promoted by Pope Martin V Colonna (1417–1431).
The iconographic program includes the Annunciation (behind the altar), the Crucifixion (above the entrance), Christ in glory with Evangelists and Doctors of the Church (in the vault), and painted draperies on the side walls (Figure 2b). The authorship of the frescoes remains debated. Scholars such as Ramadori [33] and Di Calisto [34] suggest attributions ranging from an anonymous Roman painter to Arcangelo di Cola da Camerino, a follower of Gentile da Fabriano, or an International Gothic artist. The generic term “Master of Riofreddo” is commonly used. In 2002, Paolo D’Achille [35] proposed attributing the frescoes to artists close to Pietro di Domenico, who was known for frescoes in the Roman church of Sant’Agnese fuori le mura. Furthermore, Bruno Toscano (1988) [36] included the Oratory in his studies on the artistic geography of trade routes near Ninfa in the 15th century [37].
Despite restorations in 1901–1903, the 1940s, 1970s, and the 2010s, the chapel now faces serious conservation issues due to rising damp. Its proximity to a river and changes in the last century to the road are also important factors.

2.2. Non-Invasive Field Investigations

To preliminarily assess the presence and spatial distribution of biological colonization on painted surfaces, a suite of non-invasive diagnostic techniques was applied in situ. The investigative approach integrated adenosine triphosphate (ATP) bioluminescence measurements with USB-portable digital microscopy operating under both visible and ultraviolet (UV) illumination. The combined use of these methodologies was used for the identification of areas exhibiting potential biological activity, which were subsequently selected for targeted sampling aimed at salt efflorescence characterization and microbiological analysis.

2.2.1. Portable Digital Microscopy Under Visible and UV Light

Microscopic surface examination was performed using a USB-portable digital microscope (Dino-Lite Edge Digital Microscope AM4115T-CFVW, Dino-Lite Europe/IDCP B.V., Almere, The Netherlands) with a magnification setting of 50×. The device is equipped with both white-light and 365 nm UV illumination sources. The latter excitation wavelength is known to induce autofluorescence used to biological structures due to the characteristic emission spectra of these compounds. Field observations were conducted on areas exhibiting different alteration/deterioration patterns observed in the field during the measurements.

2.2.2. ATP Bioluminescence Measurements

The ATP (adenosine triphosphate), a key molecule in all living organisms that provides energy for cell metabolism with an amount that is related to biomass, was measured. Its measurement does not distinguish between the different types of microbes. ATP was measured in relative light units (RLU) using a bioluminometer (3M™ Clean-Trace™ NG Luminometer, 3M Italia Srl Pioltello (MI)) and its specific swabs (3M Clean-Trace Surface3M™, 3M Italia Srl Pioltello (MI)) [38]. For each sampling point, a standardized analyzed area of 4 cm2 was defined to obtain comparable data, and the read values were expressed as RLU/cm2. Measurements were conducted following preliminary microscopic observations, targeting areas exhibiting distinct surface alteration features—namely, salt efflorescence, red spots, white turf-like encrustations, pink discoloration, as well as dark green, light green, and black pigmentation (Table 1). A measurement was also performed on a control area, affected by salt efflorescence, that did not exhibit visible signs of biological colonization (Ss). The selected ATP measurement sites are shown in Figure 2c and Table 1 and are labelled as “S”.

2.2.3. Samples Collection

Samples (“S”) were collected from all areas previously analyzed by ATP measurements (Table 1). A total of fifteen samples were obtained from different areas of the fresco (Figure 2), with the aim of characterizing both biological colonization and salt composition (Table S1). At sampling points 4, 5, and 6, duplicate samples—designated “a” and “b”—were collected to distinguish between zones exhibiting both salt efflorescence and pink discoloration and those exhibiting only salt efflorescence. Specifically, sample “a” was taken from the area showing both pink discoloration and salt efflorescence, while sample “b” was collected from the adjacent area showing only salt efflorescence. Only ion chromatography analysis was performed on duplicate “b” samples. In addition, a sample of pure salt efflorescence (labelled Ss) was collected from the fresco surface as control both for ATP measurements and characterized by ion chromatography analysis. The samples were collected in selected areas using a sterile swab, and a few samples were obtained from the surface using a lancet by gently scratching the surface to collect the powder of biological colonization and salts. Small samples were collected at the sampling point where surface detachment was identified; small samples were collected.

2.3. Laboratory Investigations

To investigate the biotic component associated with the painted surfaces and its potential relationship with salt efflorescence, a combination of microscopic, culture-based, and molecular techniques was employed. Given the exploratory nature of this study and the need to obtain viable isolates for further characterization, a culture-dependent approach was prioritized. Not all samples were investigated using the same analytical techniques (see Table S1), as the choice of method depended on the nature of the sample and the specific objectives of the analysis. This selective approach was adopted to achieve either morphological or molecular characterization—or both—depending on the relevance and condition of each sample.

2.3.1. Optical and Scanning Electron Microscope

The alteration phenomena identified as “dark green (S3, S7), red spots (S10), and light green (S11)” (see Table 1) were recognized through morphological analysis performed using an optical microscope with a 100× oil immersion objective (Olympus BX41, Olympus Corporation, Tokyo, Japan), equipped with a Zeiss digital camera (Carl ZeissCo., Oberkochen, Germany), following the procedures described in UNI 10923 [39] and applying the analytical keys provided by Guiry and Guiry [40]. Additional observations were performed using a stereomicroscope Zeiss Axio Zoom V16 (Carl ZeissCo., Oberkochen, Germany) equipped with a Zeiss Axiocam 503 color camera (Carl Zeiss Co., Oberkochen, Germany). To investigate the morphological details at higher resolution, SEM analyses were conducted on fractured samples: S6a, S7, S9, S10, and S11. All samples were sputter-coated with gold under vacuum using a K550 unit (Emitech Technologies Ltd., Kent, UK) and subsequently observed with a scanning electron microscope SEM Philips 505 (Philips, Rochester, NY, USA).

2.3.2. Isolation of Bacterial and Fungal Strains

Four different culture media were used for cultivation analysis, two for photosynthetic microorganisms and two for heterotrophic microorganisms: BG-11 and Bold Basal Medium (BBM) (Sigma-Aldrich, Merck S.p.A., Milan Italy), Tryptic Soy Broth Agar (TSA), and Reasoner’s 2A agar (R2A). Considering that surface patinas are exposed to atmospheric oxygen, inoculated plates were incubated aerobically at room temperature for 30 days. Culture-based analysis was performed on the alteration phenomena identified as “white turf (S2, S8), pink discoloration (S4a, S5a, S6a), dark green (S3), and light green (S11)” (see Table 1).
Molecular identification of each bacterial isolate (S4a, S5a, S6a) was performed as previously described [41]. The 16S rRNA full-length gene was amplified with primer pairs 27f (5′ AGAGTTTGATCMTGGCTCAG 3′) and 1492 r (5′ CGGTTACCTTGTTACGACTT 3′). The Forward and Reverse sequences obtained from the amplicons of each 16S rRNA gene were manually merged, resulting in approximately 1400 nucleotide (nt) length sequences. BLASTn [42] was used on the NCBI RefSeq database to identify the closest relative species for each isolate and to determine the number of variable sites within their 16S rRNA sequences. Molecular identification of fungal isolates (S2 and S8) was performed as previously described [43]. To amplify the ITS barcode region, the universal primers ITS4 (5′-TCCTC CGCTTATTGATATGC-3′)/ITS5 (5′-GGAAGTAAAAGTCGTAACAAGG-3′) were used. PCR reactions were performed using BioMix (BioLine, Luckenwalde, Germany). In each 25 μL reaction solution, 5 pmol of each primer and approximately 40 ng of template DNA were added. Amplifications were carried out using MyCycler™ Thermal Cycler (Bio-Rad Laboratories, Munich, Germany), applying the following protocols: (ITS) initial denaturation step for 3 min at 95 °C, 35 cycles of 95 °C for 30 s, annealing at 55 °C for 30 s, extension at 72 °C for 32 s, followed by a final extension at 72 °C for 5 min. Sequences were performed by Macrogen (Milan, Italy) and assembled using ChromasPro v.1.41 (Technelysium, Southport, Queensland, Australia). Similar searches were performed using BLASTn (NCBI, National Center for Biotechnology Information), excluding from the comparison “uncultured/environmental sample sequences” and referring mainly to CBS collection strains, preferably to ex-type strains.
The accession number (s) for our nucleotide sequences have been provided by GenBank: for pink alteration (S6a) PV466827 (isolate 1); PV466828 (isolate 2); PV466829 (isolate 3); PV466830 (isolate 4); PV466831 (isolate 5); PV466832 (isolate 6); white turf alteration PV470090 (isolate A); PV47009 (isolate B); PV470092 (isolate C).

2.3.3. Raman Spectroscopy

Raman spectroscopy was employed to identify pigments produced by isolated colonies (S6a—isolates 1, 3, and 5), as well as directly on micro-samples (S5a, S6a, S7, S10, S11) collected from green or pink-stained areas. Raman spectra were acquired using a B&W Tek micro-Raman spectrometer (Newark, DE, USA), equipped with a 785 nm laser source (nominal power 300 mW). The backscattered light was dispersed by an 830 lines/mm grating, and the Raman signal was detected by a silicon CCD sensor thermoelectrically cooled to −5 °C. The nominal spectral resolution is approximately 5 cm−1. Spectral acquisitions in the range of 1500–3200 cm−1 were performed using 20× and 40× objectives. For each sampled point, 50 accumulations were collected, with integration times ranging from 3 to 10 s, depending on the response and structure of the individual sample. The laser power was optimized for each examined specimen to optimize the signal while avoiding sample degradation. All measurements were collected after automatic subtraction, referred to as “dark,” to remove any interference from the instrument, substrate, or external light sources. Origin software 8.5 (OriginLab Corporation, Northampton, MA, USA) was used for treatment analyses, including baseline correction and smoothing.

2.3.4. Ion Chromatography Analysis

Prior to the analysis, the samples were dried in an oven at 60 °C for 24 h and then weighed using a Sartorius microbalance. The samples were placed in 20 mL vials containing 5, 10, or 20 mL (depending on the weight of the sample) of deionized water and shaken for 1 h to ensure the complete extraction of ionic compounds. The resulting solution was filtered using a 0.45 μm filter and analyzed via ion chromatography (IC). The analysis was performed using an ICS1000 Thermo-Fisher instrument (Sunnyvale, CA, USA). Cations, Na+ (sodium), NH4+ (ammonium), K+ (potassium), Mg2+ (magnesium), and Ca2+ (calcium) were determined using column ION PAC CS12A-4 mm, pre-column ION PAC CG12A-4mm, and CSRS-ULTRA-4mm suppressor. Methane sulfonic acid in isocratic mode was used as the eluent (20 mM, flow rate of 1.2 mL/min). Anions, F− (fluorine), Cl− (chloride), NO2− (nitrite), NO3− (nitrate), SO42− (sulphate), C2O42− (oxalate), and PO43− (phosphate) were determined using column AS11-4 mm, pre-column AG11-4 mm, and ASRS-ULTRA 4 mm suppressor. Potassium hydroxide, generated by ECG40 EGC II KOH Thermo-Fisher in gradient mode (from 10 to 60 mM), was used as the eluent. All samples (S1–S11, S4b, S5b, S6b and Ss) were investigated with respect to their specific alteration phenomenology (Table S1).

3. Results

3.1. Characterization of Biological Colonization

As summarized in Table 1, the bioluminometric survey revealed varying ranges of ATP values corresponding to the different alteration patterns identified during field observations using the USB-portable microscope (Figure 3).
The control sample (Ss), composed of only salt efflorescence with no visible biological colonization, exhibited an ATP value of 97 RLU/cm2 and was used as the baseline reference.
Higher ATP values, starting from 2026 RLU/cm2, were recorded in samples associated with visible alteration phenomena, including salt efflorescence (S2, S8), pink discoloration (S5a, S6a), light green areas (S11), hard black spots (S9), and dark green areas (S3, S7). These findings indicate a significant biological colonization linked to the observed alteration patterns. Conversely, moderately elevated ATP values, ranging from 238 to 476 RLU/cm2, were found in samples S4 and S10, suggesting a limited degree of biological activity. The ATP values in sample S1 were comparable to those in the control (Ss), confirming the absence of detectable biological contamination.
Notably, no evident microbial growth was detected in sample S5a using culture-based methods, whereas optical microscopy revealed no microbial structures in samples S7 and S9. Nevertheless, scanning electron microscopy (SEM) analyses conducted on S6a, S7, and S9 revealed morphological features of extracellular polymeric substances (EPS) on the surface of the samples (Figure 4(a1,b1,c1)), suggesting microbial metabolic activity. However, morphological and molecular analyses of the samples exhibiting the highest ATP values (ranging from 8019 to 30,542 RLU/cm2) enabled the identification of a diverse set of microorganisms associated with distinct alteration patterns (Figure 3). These included Fungi (Ascomycota) in S2 and S8, Bacteria (Proteobacteria, Actinobacteria, Bacillota and Pseudomonadota) in S6a, and green algae (Chlorophyta) in S11 (Table 1).
The alteration phenomenon known as “white turf” (S2, S8) was found to be caused by an extensive colonization of Parengyodontium album, a chemoorganotrophic fungal species that relies on environmental nutrients for its development. This species is ubiquitous and is frequently detected on monuments, such as churches, cathedrals, and monasteries [44].
The formation of a pink patina (S4, S5, S6) was recognized using the field stereomicroscope. The pink alteration (S6a) shows a wide composition of soil bacterial strains, commonly associated with the rhizosphere of higher plants [45,46,47,48,49]. Notably, these microorganisms have also been reported on various wall paintings [50,51,52,53,54].
In detail, in S6a isolate number 1, the presence of Rhizobium tropici, a nitrogen-fixing Gram-negative bacterium, which can establish symbiosis is here recognized in free-living form [45]. In S6a isolate number 2 Micrococcus yunnanensis and M. aloeverae species are reclassified as later heterotypic synonyms of Micrococcus luteus, a Gram-positive coccus that is catalase-positive, oxidase-variable, and strictly aerobic [55], forming yellow colonies with tolerance to NaCl of 6–8% and 5–12% (w/v), respectively. In S6a isolate number 3, Priestia megaterium strains have a cell width greater than 1 μm and can undergo sporulation. It is particularly interesting due to its unusual physiology, useful enzymes and products, and its wide range of ecological habitats [56]. In S6a isolate number 4, Microbacterium flavescens is Gram-positive, non-motile, soil aerobe bacterium, forming pale yellow colonies, and showing a tolerance to 5–10% of NaCl [57]. In S6a isolate number 5, Arthrobacter parietis cells are Gram-positive, short rods and cocci (diameter 0.8–1 μm) occurring in pairs or clusters. They are non-motile and do not form endospores. Colonies are yellow–orange, round with entire margins, of low convexity, opaque, and smooth. The optimal temperature for growth is 22–30 °C. Growth occurs in a medium with 15% NaCl [54].
Finally, the closest relative of isolate number 6 is Noviherbaspirillum suwonense. However, due to the low sequence identity (98.36%), the bacterium may belong to the genus Noviherbaspirillum but may represent a previously uncharacterized species. N. suwonense is a Gram-negative bacterium, aerobic, motile, mesophilic, and forms rod-shaped cells. It was isolated from air samples collected in Suwon, Republic of Korea. The colonies on R2A agar were convex, circular, and pale orange with entire margins. Growth occurs at 2% NaCl [58].
The samples from S11 showed a light green alteration phenotype, and the morphological analysis by optical microscope identified the presence of Chlorella sp. Additionally, optical images of the fractured samples suggest an endolithic growth (Figure 4(d1)), whereas epilithic growth is visible where the painting layer is detached. Moreover, although the cultural approach on BBM and BG-11 agar did not yield results, changing the culture conditions (by exposing the Petri dishes for 48 h in a dark condition) allowed a wide pink colonization to grow. Their molecular identification is ongoing. This result was further confirmed by SEM analysis (Figure 4(d4)), in which the presence of bacterial cells was visible.
The Raman analysis of cultures from the isolated colonies corresponding to S6a isolation numbers (3), (5) and S11, characterized by a pink color, has revealed bands with features typical of carotenoids, with characteristic bands corresponding to C=C stretching around 1520 cm−1, C−C stretching near 1150 cm−1, and C=CH bending near 1000 cm−1 [59].
Carotenoids, present both in prokaryotes and eukaryotes, represent a diverse group of compounds that are produced as metabolic by-products in various microorganisms and are distinguished by a polyene skeletal backbone [60]. Among these, β-carotene is frequently detected in many microbial species. The Raman bands (Figure 5A) obtained on isolated colonies S6a (3) and (5) show peaks at 1527, 1157, and 1104 cm−1 associable to β-carotene, although the presence of a carotenoid mixture cannot be excluded [59]. No spectrum was detected in the measurements performed on the isolated colonies corresponding to S6a number (1). In the case of isolated cultures S11 (found in the green sample as a potential satellite bacterium), a different carotenoid, associable with bacterioruberin, is shown by the Raman band (Figure 5A). Bacterioruberin is distinguished from β-carotene by the length of its conjugated chain. Specifically, the conjugated isoprenoid chain of bacterioruberin is composed of 13 C=C units (compared to 11 in β-carotene) [59,61]. This difference is noted in the Raman spectrum, where the peak at 1506 cm−1 is attributed to the C=C stretching band of bacterioruberin, and the bands at 1151 and 1003 cm−1are assigned to the C–C and C–CH stretches, respectively (Figure 5A). Bacterioruberin is a red-orange xanthophyll pigment responsible for the coloration observed in halophilic organisms and is considered a key carotenoid in halophilic archaea [59,62].
Raman analysis directly performed on samples S6a, S7 and S5a, where the presence of an EPS matrix was pointed out by the SEM analysis, particularly in samples S6a and S7 (Figure 4(a1,b1)) reveals bands that could be associated with the macromolecular constituents of the biofilms (Figure 5B). Biofilms are communities of microorganisms embedded in a matrix composed of extracellular polymeric substances (EPS) [22]. In addition to water, which is the major component of the biofilm matrix, EPS are primarily composed of biopolymers such as polysaccharides, proteins, glycoproteins, nucleic acids, lipids, and phospholipids [63]. The Raman results (Figure 5B) show a stretching band, in the symmetric COO−, at 1416 cm−1, a shoulder band associated with the glycosidic ring breathing mode at 1096 cm−1, carboxylate stretching vibrations (symmetric stretching or C–O single bond stretching vibration) at 1300 cm−1, asymmetric carboxylate stretching vibrations at 1497 and 1647 cm−1, and skeletal C–C, C–O stretching, and C–C–H, C–C–O bending modes at 941, 863, and 801 cm−1. These bands (labelled in Figure 5 as “P”) suggest the presence of polysaccharide compounds [63,64]. Such compounds can be neutral macromolecules, such as cellulose and dextran, although the majority are polyanionic due to the presence of uronic acids (e.g., alginate and xanthan), acetyl groups (e.g., xanthan and gellan), or ketal-linked pyruvate (e.g., xanthan) [63]. Moreover, the spectra also reveal the presence of calcite with characteristic vibrational modes at 1087 cm−1 (C–O asymmetric stretching), 712 cm−1 (C–O symmetric stretching), and 282 cm−1 (out-of-plane bending) [65], as well as gypsum, with the strongest Raman band at 1009 cm−1 (symmetric stretch vibration mode of the SO4 tetrahedra), the peak at 1143 cm−1 (asymmetric stretch vibration mode), and the doublet at 416 cm−1 and 495 cm−1 (symmetric bending) [66]. Otherwise, no Raman bands associated with polysaccharide compounds were detected in the measurement performed on sample S10.

3.2. Characterization of Soluble Ions

The results of the determination of anions and cations, expressed as w% (percentage of weight of each ion with respect to the total dry mass of the sample), are listed in Table 2.
The percentage of soluble ions in the samples exhibited significant variation, with an average of 20% and maximum and minimum values of 70% and 3.1%, respectively, for S3 and S6b. The composition of the samples also demonstrated considerable heterogeneity. The sum of SO42− and Ca2+ (calcium) in numerous samples represented the major components of soluble ions, up to 97% for S3 and S11.
The average concentration of calcium was 7.2%, ranging from 0.65% to 22% in S4a and S3, respectively. SO42− showed an average concentration of 11% with a maximum in S3 (47%) and a minimum of 0.19% (S1). Cl− was present in all samples with an average of 1.0%, ranging from 2.7% to 0.18%, observed in S6a and S11, respectively. Na+ was also present in all samples, with an average of 0.35%, ranging from 0.090 to 0.83% observed in S10 and S4a, respectively. NO2− was present in only two samples: S8 and S11. NO3− was present in all samples with an average of 0.23%, ranging from 0.81% to 0.093%, observed for S1 and S6b, respectively. The concentrations of Mg2+ and K+ were notably low in all samples, as were the concentrations of C2O42− and PO43−. The concentration of oxalate was extremely low, and it was not detected in all samples. The highest level was found at sample point S9, measuring 0.056%. F− was present only in five sampling points (S7–S11) with a maximum in S9 (0.69%).
The results of the determination of anions and cations were converted to μEq to establish the ionic balance (Figure 6a). Ioni c balance was calculated by subtracting the total quantity of cations from the total quantity of anions, all measured in μEq. A negative balance indicates a deficiency in one or more anions, that may not have been analyzed. Assuming electro-neutrality in the solution, this deficiency was attributed to unmeasured carbonate and bicarbonate [67]. The presence of carbonate as calcite was also detected by Raman analysis.
The graph presented in Figure 6b demonstrates that the trends of calcium and sulphate are perfectly synchronized across all samples examined, suggesting that calcium sulphate (CaSO4, gypsum) was the primary component of the samples, as reported in other studies [68]. Furthermore, a comparison between sodium and chloride ions revealed a strong correlation (Figure 6c).
The analysis performed on a sample of pure salt efflorescence (labelled Ss) indicated that the sample was primarily composed of sodium and sulphate, thereby identified as Na2SO4 (sodium sulphate). This salt exists in two primary forms: thenardite (Na2SO4) and mirabilite (Na2SO4·10H2O). Under specific environmental conditions [69], the latter undergoes a volume increase of up to 400% [70], potentially leading to material damage.

3.3. Comparative Evaluation Alteration-Salt Composition

Principal Component Analysis (PCA) revealed that three principal components accounted for over 70% of the total variance. Figure 7 presents the PCA biplot, which illustrates the distribution of the samples in relation to the analyzed ionic components and alteration phenomenology. The first principal component accounted for 35.59% of the total variance, whereas the second PCA explained 22.53% of the total variance.
On the x axis (PC1), a correlation was observed between Na+ and Cl− in the PCA plot. This strong association suggests the presence of sodium chloride, as confirmed by ion chromatography analysis, which is a common salt responsible for the degradation of fresco surfaces. The significant correlation between Ca2+ and SO42− indicates the potential formation of gypsum (CaSO4·2H2O), a well-documented degradation process in frescoes. This conclusion was supported by ion chromatography analysis. The clustering of Ca2+, Mg2+, and PO43− suggests a shared geochemical behavior. The negative correlation between Cl− and Ca2+/Mg2+ implies that sodium chloride sources are independent of calcium- and magnesium-rich mineral phases. A moderate correlation was observed between NO3− and PO43−, whereas a strong correlation was identified between C2O42− and NO2− and F−. K+ appeared to be relatively independent of other ions. Considering the samples distribution two group were identify, a group formed by S11 (Light Green), S8 (White Turf) and S9 (Hard Black) correlated C2O42− and NO2− and F− and a second group formed by S4–S6 (“a” and “b”), representative of pink patinas, which was strongly correlated with NaCl.
On the y axis (PC2) a correlation related to the sampling area can be observed. In the upper section of the graph S7–S11 were associated in a cluster in relation to their position in the right side of the altar. In this way S2 results far from S8, even if have the same microorganisms composition, resulting in different areas of the frescos (Figure 2c). S1–S3 samples were clustered in the low section of the graph being all sampled in the left area of the frescos. S4–S6 samples were clustered separately in relation to their placement underside the altar.

4. Discussion

The biological colonization affecting the frescoes in the “Oratorio dell’Annunziata” is not immediately apparent at first glance. However, our diagnostic approach revealed the widespread presence of lithobionts on the fresco surfaces and established a correlation with the occurrence of salt efflorescence. Fieldwork, which involved the use of a bioluminometer in conjunction with stereomicroscopic observations, led us to investigate areas that did not initially show biological colonization. In this context, what initially appeared to be only a salt efflorescence in the form of white turf was identified as biological colonization primarily formed by P. album, a fungus known to be associated with various deterioration problems in cultural heritage sites.
Moreover, our approach allows us to identify the main microorganisms responsible for biodeterioration problems, paving the way for future preventive conservation strategies and sustainable restoration interventions. This preliminary assessment of biodeterioration issues represents the first step toward developing an ecological study of the microclimatic conditions affecting the fresco and further investigating the variables contributing to its deterioration through non-invasive instrumental techniques.

4.1. Correlation of Lithobionts with Salt Efflorescence

The presence of P. album is well documented and strongly correlated with soluble salt efflorescence [44,71,72]. Additionally, P. album has been isolated from calcium salts such as oxalate, carbonate, and chloride [44,73,74]. This organism is known for its ability to produce various extracellular enzymes, such as protease, alpha-amylase, esterase, phosphatase, lipase, and chitinase. The functionality of these enzymes under high salinity conditions may account for the successful colonization of monuments affected by salt crystallization [44].
Our PCA results indicated an association between the white turf and NO3− and NO2− (Figure 7). Indeed, the correlation between C2O42− and NO2− may indicate organic matter degradation or microbial activity. Oxalate is often associated with biological processes [75], whereas nitrite is an intermediate in the nitrogen cycle, particularly under reducing conditions [76]. Moreover, fluoride is known to have antimicrobial properties. The source of this ion can be attributed to the capillary rise of groundwater rich in dissolved salts from the ground. The primary contributors to fluoride contamination in soil are industrial effluents, natural weathering of rocks, and atmospheric deposition [77].
The occurrence of a pink discoloration in area S6 is strongly associated with the development of a complex halophilic bacterial community, consistent with previous observations in salt-affected heritage environments [78,79,80,81,82]. These pinkish areas exhibited low CaSO4 and high NaCl content, which, according to ion chromatography data, accounted for up to 72% of the total soluble salts (S4a Figure 6b,c and Figure 7). The origin of these salts can be attributed to multiple sources, including the capillary rise of groundwater through porous wall structures and subsequent evaporation-driven crystallization, as well as anthropogenic inputs such as the seasonal application of road deicing salts [83]. The microbial strains identified in these areas consistently exhibit halophilic adaptations, particularly to NaCl, as reported in similar studies [45,48,54,55,56,58]. Most of these taxa are commonly found in soil ecosystems, especially within rhizosphere communities of higher plants [45,46,47,48,49], suggesting a likely pathway of colonization via water infiltration processes. Such infiltration mechanisms have been previously recognized as effective vectors for microbial transport in porous substrates [84,85,86], wherein cells may be transported by both the convection of aqueous-phase organisms and the generation of new aqueous phases. An analogous scenario was reported by Diaz-Herraiz [87], where rhizospheric microbial communities from the surrounding environment were conveyed into the chamber of an Etruscan tomb, re-establishing microbial colonization on painted surfaces post-cleaning. These findings corroborate the hypothesis that environmental water fluxes and salt dynamics act synergistically to facilitate microbial persistence and recolonization on wall paintings.

4.2. Potential Biodeteriorative Effect

The possible implications of the detected microbial communities on substrate deterioration deserve careful consideration. Initially, discoloration is observed, manifesting as white, yellow, and pink hues, accompanied by the formation of an exopolysaccharide (EPS) matrix corresponding to the dark green and hard black alteration phenomena. R. tropici is particularly known for its substantial EPS production; however, several aspects of this organism’s growth and EPS production remain inadequately characterized, particularly about the influence of environmental factors on EPS synthesis [88]. Similarly, M. yunnanensis, M. aloeverae, P. megaterium, M. flavescens, A. parietis, and N. suwonense produce varying amounts of EPS, depending on their specific environmental conditions. In this study, EPS was also detected by Raman spectroscopy (Figure 5B) in correspondence with sample S6a (where R. tropici was detected), as well as in samples S5a and S7, further supporting the observed findings. It is well documented that salts present in the substrata, in contact with microorganisms, can enhance EPS production [22]. Additionally, it has been demonstrated that the combination of salts and microorganisms, (e.g., moderately halophilic bacteria) amplifies the deterioration effect, producing a more significant impact than the action of either factor [22]. The detection of EPS is particularly important in the context of conservation treatment, especially in biocide applications. The presence of an EPS matrix can compromise the effectiveness of such treatments [89], highlighting the necessity of considering this factor in conservation strategies. Finally, although R. tropici is a nitrogen-fixing bacterium, it also exhibits carbon metabolism, producing enzymes in free-living cells that oxidize carbon compounds of various origins [90]. Additionally, the Micrococcus genus is known for its proteolytic and fibrolytic properties [51], whereas P. megaterium has been isolated from loamy or calcareous soils and described as a carbonatogenic strain capable of precipitating CaCO3 [53,91,92]. Further investigations are essential to assess the specific chemical or physical deterioration activities arising from their metabolic processes and growth patterns. The current literature provides limited information, primarily focusing on the identification of microbial colonizers rather than their potential role in biodeterioration. Furthermore, Actinobacteria are known to harbor antimicrobial-resistant genes (ARGs) [93], and recent studies have indicated that Actinobacteria and Proteobacteria contribute, on average, to approximately 40% of antimicrobial resistance carrying contigs (ACCs) in stone monuments [94]. Additionally, some bacterial strains exhibit antifungal properties, suggesting that in the context of direct conservation treatments, it is crucial to carefully evaluate the chemical properties of biocides and the spectrum of efficacy against the selected microbial communities. This approach will help mitigate the risk of selecting resistant bacterial strains or encouraging fungal spread [28,82].
However, it is important asses that in recent years, halophilic microorganisms and their salt-tolerant enzymes have demonstrated considerable potential in the conservation and restoration of cultural heritage, especially for cleaning mural paintings and other stone artworks. In this regard, a system utilizing microorganisms or biocatalysts that can operate across a broad spectrum of salinities may provide an ideal solution for removing unwanted inorganic or organic materials from the surfaces of historical monuments and wall paintings [95]. Moreover, EPS can enable biofilm cells to withstand higher concentrations of biocides. The EPS matrix hinders or blocks biocides from reaching the target microorganisms within the biofilm by limiting diffusion and/or through chemical interactions with the EPS components. In such scenarios, a system based on microorganisms or biocatalysts capable of functioning across a wide range of salinities could offer an optimal solution for removing unwanted inorganic compounds (e.g., nitrates and sulphates) or organic matter (e.g., protein residues, oils, and waxes) from the surfaces of wall paintings and historical monuments [95].
Chlorella, a green alga well known as a biodeteriogen of calcareous surfaces [94,96,97,98,99,100], has also garnered interest due to certain strains exhibiting halotolerance [101]. In our study, the cultural approach and morphological analysis of the green light alteration attributed to this alga suggest the possible presence of satellite bacteria [102] responsible for the observed pink discoloration. Raman analysis performed on the culture where the pink coloration (S5) appeared reveal the presence of bacterioruberin, a key carotenoid in halophilic bacteria [59]. The detection of bacterioruberin further supports the notion that the observed pink discoloration is associated with halophilic bacteria that thrive in salt-rich environments. However, it is important to note that Raman spectroscopy does not allow for the identification of the specific species detected, as the same carotenoid can be synthesized by multiple species. Therefore, linking the pigment to a particular species necessitates the integration of culture-independent microbial community analysis with Raman spectroscopy-based pigment identification [61]. According to Borisova et al. [102], in algae-bacteria communities, algae typically dominate, comprising 70–99% of the total biomass and playing a cenosis-forming role. As autotrophic organisms, algae release dissolved organic compounds, creating an ecological niche in which specific bacterial populations can develop. The two unaltered samples, S1 and S10, which lacked biodeteriogens, exhibited low weight percentages of soluble ions. In sample S1, a small percentage of SO42− was detected (Table 2. The interaction between soluble salts and bacteria is complex, with results depending on the bacterial species, salt concentration, and environmental conditions. Some salts may hinder and inhibit bacterial growth, whereas others can support bacterial survival and facilitate essential functions. Our results highlight the importance of preventive diagnosis, as it forms the foundation of a comprehensive and effective conservation plan.

5. Conclusions

This study, through the integration of field observations and laboratory-based analyses, has demonstrated the presence of a non-visible biological colonization. Moreover, it highlighted a clear correlation between biological colonization and the chemical composition of salt efflorescence affecting the wall painting of the “Oratorio dell’Annunziata”. The use of a bioluminometer in this way demonstrated a good skill of this instrument as mandatory tools to investigation of not clear biodeterioration problems, such as the presence of Parengyodontium album in areas affected by the so-called “white turf” alteration. The pink discoloration was attributed to a consortium of halophilic bacteria soil-derived. Additionally, microscopic investigation confirmed the presence of Chlorella sp. growing as casmo-endolithic in the fresco. These findings emphasize the critical role of early-stage diagnosis in identifying biological presence and their correlation with chemical deterioration processes, which is essential for the development of effective and targeted preventive or sustainable conservation strategies.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/app15158762/s1, Table S1. Investigated areas and the type of analysis performed on samples.

Author Contributions

Conceptualization, A.C.M., F.B. and M.C.; methodology, A.C.M., F.B., I.C., A.L., M.T. and M.C.; validation A.C.M., F.B., I.C., M.T. and M.C.; formal analysis, A.C.M., F.B. and M.C.; investigation, A.C.M., F.B., I.C., A.L., M.T. and M.C.; data curation, A.C.M., F.B. and M.C.; writing—original draft preparation, A.C.M., F.B., M.C. and P.R.; writing—review and editing, A.C.M., F.B. and M.C.; visualization, A.C.M., F.B. and M.C.; supervision, A.C.M., F.B., M.C. and P.R. All authors have read and agreed to the published version of the manuscript.

Funding

The MOLAB diagnostic campaign has been supported by E-RIHS, European Research Infrastructure for Heritage Science (financial support by MUR, Ministero dell’Università e della Ricerca, FOE E-RIHS IT and PON Ricerca e Innovazione 2014–2020, CCI: 2014IT16M2OP005).

Data Availability Statement

The original contributions presented in this study are included in the article. Further inquiries can be directed to the corresponding author.

Acknowledgments

The support of MUR (FOE E-RIHS IT and PON Ricerca e Innovazione 2014–2020, CCI: 2014IT16M2OP005) is acknowledged. Many thanks for the fundamental support of the ORAVIT project to the ‘Soprintendenza Archeologia, Belle Arti e Paesaggio per l’Area Metropolitana di Roma e per la Provincia di Rieti’, and in particular to the Superintendente Arch. Lisa Lambusier, the Funzionario Restauratore Dott.ssa Francesca Dal Maschio, the Funzionario Storico dell’Arte Dott.ssa Paola Lipani, and the Funzionario Architetto Arch. Valentina Milano. Thanks also to Daniela Isola and Daniela Visaggio for help and support in the isolation and molecular analysis for the identification of fungal and bacterial strains.

Conflicts of Interest

The authors declare no conflicts of interest.

Correction Statement

This article has been republished with a minor correction to the Data Availability Statement. This change does not affect the scientific content of the article.

References

  1. Sayre, E.V.; Majewski, L.J., II. Technical Investigation of the Deterioration of the Paintings. Stud. Conserv. 1963, 8, 42–54. [Google Scholar] [CrossRef] [Scilit]
  2. Tintori, L. The State of Conservation of the Frescoes and the Principal Technical Restoration Problems. Stud. Conserv. 1963, 8, 37. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  3. Castellini, P.; Esposito, E.; Paone, N.; Tomasini, E.P. Conservation of frescoes, paintings, and icons: Noninvasive measurement of damage by a laser scanning vibrometer. In Nondestructive Evaluation of Materials and Composites II; Doctor, S.R., Nove, C.A., Baaklini, G.Y., Eds.; SPIE Digital Library: Bellingham, WA, USA, 1998; Volume 3396, pp. 63–73. [Google Scholar]
  4. Arbizzani, R.; Casellato, U.; Fiorin, E.; Nodari, L.; Russo, U.; Vigato, P.A. Decay Markers for the Preventative Conservation and Maintenance of Paintings. J. Cult. Herit. 2004, 5, 167–182. [Google Scholar] [CrossRef]
  5. Merello, P.; García-Diego, F.J.; Zarzo, M. Microclimate monitoring of Ariadne’s house (Pompeii, Italy) for preventive conservation of fresco paintings. Chem. Cent. J. 2012, 6, 145. [Google Scholar] [CrossRef] [Scilit]
  6. Merello, P.; García-Diego, F.-J.; Zarzo, M. Evaluation of Corrective Measures Implemented for the Preventive Conservation of Fresco Paintings in Ariadne’s House (Pompeii, Italy). Chem. Cent. J. 2013, 7, 87. [Google Scholar] [CrossRef] [Scilit]
  7. Pérez, M.C.; García-Diego, F.-J.; Merello, P.; D’Antoni, P.; Fernández-Navajas, A.; Ribera-Lacomba, A.; Ferrazza, L.; Pérez-Miralles, J.; Baró, J.-L.; Merce, P.; et al. Ariadne’s house (Pompeii, Italy) wall paintings: A multidisciplinary study of its present state focused on a future restoration and preventive conservation. Mater. Construcc. 2013, 63, 449–467. [Google Scholar] [CrossRef] [Scilit]
  8. Cuzman, O.A.; Luvidi, L.; Colantonio, C.; Raio, A.; Taiti, S. Biodiversity and Conservation Correlation in the Case of a Roman Fresco Located in a Semi-Confined Environment. Int. Biodeter. Biodegr. 2023, 181, 105605. [Google Scholar] [CrossRef] [Scilit]
  9. Antonelli, F.; Iafrate, S.; Tescari, M.; Giandomenico, M.; Kumbaric, A.; Bartolini, M. The Hypogeous Roman Archeological Museum of Positano: Study of the Evolution of Biological Threaten and Development of Adequate Control Protocols. Microorganisms 2024, 12, 1520. [Google Scholar] [CrossRef] [Scilit]
  10. Lancaster, L.C. Mortars and Plasters—How Mortars Were Made. The Literary Sources. Archaeol. Anthropol. Sci. 2021, 13, 192. [Google Scholar] [CrossRef] [Scilit]
  11. Jiménez-Desmond, D.; Pozo-Antonio, J.S.; Arizzi, A. The Fresco Wall Painting Techniques in the Mediterranean Area from Antiquity to the Present: A Review. J. Cult. Herit. 2023, 66, 166–186. [Google Scholar] [CrossRef] [Scilit]
  12. Afif-Khouri, E.; Lozano-Martínez, A.; Rego, J.I.L.D.; López-Gallego, B.; Forján-Castro, R. Capillary Rise of Soluble Salts and Its Effect on the Degradation of Calcareous Material Used in Historical Monuments. preprints 2024. [Google Scholar] [CrossRef] [Scilit]
  13. Shen, Y.; Linnow, K.; Steiger, M. Crystallization Behavior and Damage Potential of Na2SO4–NaCl Mixtures in Porous Building Materials. Cryst. Growth Des. 2020, 20, 5974–5985. [Google Scholar] [CrossRef] [Scilit]
  14. Broggi, A.; Petrucci, E.; Bracciale, M.P.; Santarelli, M.L. FT-Raman Spectroscopy for Quantitative Analysis of Salt Efflorescences. J. Raman Spectrosc. 2012, 43, 1560–1566. [Google Scholar] [CrossRef] [Scilit]
  15. Baglioni, P.; Giorgi, R.; Chelazzi, D. The Degradation of Wall Paintings and Stone: Specific Ion Effects. COCIS 2016, 23, 66–71. [Google Scholar] [CrossRef] [Scilit]
  16. Yan, Y.; Wang, Y. A Review of Atmospheric Deterioration and Sustainable Conservation of Calcareous Stone in Historical Buildings and Monuments. Sustainability 2024, 16, 10751. [Google Scholar] [CrossRef] [Scilit]
  17. Randazzo, L.; Montana, G.; Alduina, R.; Quatrini, P.; Tsantini, E.; Salemi, B. Flos Tectorii Degradation of Mortars: An Example of Synergistic Action between Soluble Salts and Biodeteriogens. J. Cult. Herit. 2015, 16, 838–847. [Google Scholar] [CrossRef] [Scilit]
  18. Vázquez-de la Fuente, I.; Prieto-Taboada, N.; Lama, E.; Cristobal, D.; García-Arrona, R.; Arana, G.; Madariaga, J.M. The relevance of the use of ionic chromatography for the quantification of soluble salts in the analysis of built heritage: Improving the European norms. Microchem. J. 2023, 191, 108921. [Google Scholar] [CrossRef]
  19. Giaobini, C.; De Cicco, M.A.; Tiglie, I.; Accardo, G. Actinomycetes and biodeterioration in the field of fine art. In Biodeterioration 7; Houghton, D.R., Smith, R.N., Eggins, H.O.W., Eds.; Springer: Dordrecht, The Netherlands, 1988; pp. 418–423. [Google Scholar]
  20. Albertano, P.; Urzì, C. Structural interactions among epilithic cyanobacteria and heterotrophic microorganisms in Roman hypogea. Microb. Ecol. 1999, 38, 244–252. [Google Scholar] [CrossRef] [Scilit]
  21. Gorbushina, A.A.; Heyrman, J.; Dornieden, T.; Gonzalez-Delvalle, M.; Krumbein, W.E.; Laiz, L.; Swings, J. Bacterial and fungal diversity and biodeterioration problems in mural painting environments of St. Martins church (Greene–Kreiensen, Germany). Int. Biodeterior. Biodegrad. 2004, 53, 13–24. [Google Scholar] [CrossRef] [Scilit]
  22. Caneva, G.; Nugari, M.P.; Nugari, M.P.; Salvadori, O. Plant Biology for Cultural Heritage: Biodeterioration and Conservation; Getty Publications: Los Angeles, CA, USA, 2008. [Google Scholar]
  23. Kiyuna, T.; An, K.D.; Kigawa, R.; Sano, C.; Miura, S.; Sugiyama, J. Mycobiota of the Takamatsuzuka and Kitora Tumuli in Japan, focusing on the molecular phylogenetic diversity of Fusarium and Trichoderma. Mycoscience 2008, 49, 298–311. [Google Scholar] [CrossRef] [Scilit]
  24. Scheerer, S.; Ortega Morales, O.; Gaylarde, C.; Allen, I.; Laskin, S.; Geoffrey, G. Microbial deterioration of stone monuments—An updated overview. Adv. Appl. Microbiol. 2009, 66, 97–139. [Google Scholar] [CrossRef] [Scilit]
  25. Bastian, F.; Jurado, V.; Nováková, A.; Alabouvette, C.; Sáiz-Jiménez, C. The microbiology of Lascaux cave. Microbiology 2010, 156, 644–652. [Google Scholar] [CrossRef] [Scilit]
  26. Caneva, G.; Bartoli, F.; Fontani, M.; Mazzeschi, D.; Visca, P. Changes in biodeterioration patterns of mural paintings: Multitemporal mapping for a preventive conservation strategy in the Crypt of the Original Sin (Matera, Italy). J. Cult. Herit. 2019, 40, 59–68. [Google Scholar] [CrossRef] [Scilit]
  27. Zucconi, L.; Canini, F.; Isola, D.; Caneva, G. Fungi affecting wall paintings of historical value: A worldwide meta-analysis of their detected diversity. Appl. Sci. 2022, 12, 2988. [Google Scholar] [CrossRef] [Scilit]
  28. Isola, D.; Bartoli, F.; Morretta, S.; Caneva, G. The roman houses of the Caelian Hill (Rome, Italy): Multitemporal evaluation of biodeterioration patterns. Microorganisms 2023, 11, 1770. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  29. Cennamo, P.; De Rosa, A.; Scielzo, R.; Rippa, M.; Trojsi, G.; Chianese, E. Diagnostic investigation of the wall paints conservative state in a hypogeal room of the archaeological park of Baia (Italy). Acta IMEKO 2024, 13, 1–8. [Google Scholar] [CrossRef] [Scilit]
  30. Urzì, C.; De Leo, F.; Bruno, L.; Pangallo, D.; Krakova, L. New species description, biomineralization processes and biocleaning applications of Roman catacombs-living bacteria. In The Conservation of Subterranean Cultural Heritage; Saiz-Jimenez, C., Ed.; CRC Press: Boca Raton, FL, USA, 2014; pp. 65–72. [Google Scholar]
  31. Ma, Y.; Zhang, H.; Du, Y.; Tian, T.; Xiang, T.; Liu, X.; Wu, F.; An, L.; Wang, W.; Gu, J.D. The community distribution of bacteria and fungi on ancient wall paintings of the Mogao Grottoes. Sci. Rep. 2015, 5, 7752. [Google Scholar] [CrossRef] [Scilit]
  32. Sanchez-Moral, S.; Luque, L.; Cuezva, S.; Soler, V.; Benavente, D.; Laiz, L.; Gonzalez, J.M.; Saiz-Jimenez, C. Deterioration of building materials in Roman catacombs: The influence of visitors. Sci. Total Environ. 2005, 349, 260–276. [Google Scholar] [CrossRef] [Scilit]
  33. Ramadori, M. L’Annunziata di Riofreddo: Il Contesto Storico, Gli Affreschi, Gli Artisti; LUMEN: Pietrasecca di Carsoli (Aq), Italy, 2009. [Google Scholar]
  34. Di Calisto, L. Devozione per immagini al tempo di Martino V: I murali dell’oratorio dell’Annunziata a Riofreddo; Edizioni Zip: Pescara, Italy, 2012. [Google Scholar]
  35. D’Achille, P.; Petrocchi, S. Limes linguistico e limes artistico nella Roma del Rinascimento. In Storia della lingua e storia dell’arte in Italia: Dissimmetrie e intersezioni, Proceedings of the terzo Convegno ASLI, Associazione per la storia della lingua italiana, Roma, Italy, 30–31 May 2002; Casale, V., D’Achille, P., Eds.; F. Cesati: Firenze, Italy, 2004; pp. 99–137. [Google Scholar]
  36. Toscano, B. La regione artistica di Ninfa. Un problema di geografia artistica. In Ninfa, una città, un Giardino. Proceedings of the Atti del Colloquio Della Fondazione Camillo Caetani, Roma, Sermoneta, Ninfa, Italy, 7–9 October 1988; Fiorani, L., Ed.; L’Erma di Bretschneider: Roma, Italy, 1990; pp. 185–206. [Google Scholar]
  37. Ramadori, M. Committenza artistica dell’oratorio della SS. Annunziata di Riofreddo in relazione al matrimonio Colonna Trinci e situazione conservativa degli affreschi. In Il Foglio di Lumen: Pubblicazione Dell’associazione Culturale Lumen; Associazione Culturale Lumen: Pietrasecca di Carsoli (Aq), Italy, 2013; Volume 37, pp. 16–19. [Google Scholar]
  38. Spada, M.; Sorella, F.; Galeotti, M.; Tosini, I.; Cuzman, O.A. Non-invasive technologies to timely screen out different application conditions of essential oils on stone. Int. Biodeterior. Biodegrad. 2021, 163, 105285. [Google Scholar] [CrossRef] [Scilit]
  39. UNI 10923 2001. Beni culturali—Materiali lapidei naturali ed artificiali—Allestimento di preparati biologici per l’osservazione al microscopio ottico.
  40. Guiry, M.D. AlgaeBase Version 4.2, World-Wide Electronic Publication; National University of Ireland: Galway, Ireland, 2007; Available online: https://www.algaebase.org (accessed on 8 July 2025).
  41. Turrini, P.; Tescari, M.; Visaggio, D.; Pirolo, M.; Lugli, G.A.; Ventura, M.; Frangipani, E.; Visca, P. The microbial community of a biofilm lining the wall of a pristine cave in Western New Guinea. Microbiol. Res. 2020, 241, 126584. [Google Scholar] [CrossRef] [Scilit]
  42. Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W.; Lipman, D.J. Basic local alignment search tool. J. Mol. Biol. 1990, 215, 403–410. [Google Scholar] [CrossRef] [PubMed]
  43. Isola, D.; Zucconi, L.; Cecchini, A.; Caneva, G. Dark-pigmented biodeteriogenic fungi in etruscan hypogeal tombs: New data on their culture-dependent diversity, favouring conditions, and resistance to biocidal treatments. Fungal Biol. 2021, 125, 609–620. [Google Scholar] [CrossRef] [Scilit]
  44. Leplat, J.; François, A.; Bousta, F. Parengyodontium album, a frequently reported fungal species in the cultural heritage environment. Fungal Biol. Rev. 2020, 34, 126–135. [Google Scholar] [CrossRef] [Scilit]
  45. Nogales, J.; Campos, R.; BenAbdelkhalek, H.; Olivares, J.; Lluch, C.; Sanjuan, J. Rhizobium tropici genes involved in free-living salt tolerance are required for the establishment of efficient nitrogen-fixing symbiosis with Phaseolus vulgaris. Mol. Plant-Microbe Interact. 2002, 15, 225–232. [Google Scholar] [CrossRef] [Scilit]
  46. Tank, N.; Saraf, M. Salinity-resistant plant growth promoting rhizobacteria ameliorates sodium chloride stress on tomato plants. J. Plant Interact. 2010, 5, 51–58. [Google Scholar] [CrossRef] [Scilit]
  47. Lin, X.R.; Chen, H.B.; Li, Y.X.; Zhou, Z.H.; Li, J.B.; Wang, Y.Q.; Wang, S.S. Priestia sp. LWS1 Is a Selenium-Resistant Plant Growth-Promoting Bacterium That Can Enhance Plant Growth and Selenium Accumulation in Oryza sativa L. Agronomy 2022, 12, 1301. [Google Scholar] [CrossRef] [Scilit]
  48. Li, K.C.J. The Biology of Deep Soil Microbacteria. Ph.D. Thesis, University of British Columbia, Vancouver, BC, Canada, 2016. [Google Scholar]
  49. Li, Q.; Hou, Z.; Zhou, D.; Jia, M.; Lu, S.; Yu, J. A plant growth-promoting bacteria Priestia megaterium JR48 induces plant resistance to the crucifer black rot via a salicylic acid-dependent signaling pathway. Front. Plant Sci. 2022, 13, 1046181. [Google Scholar] [CrossRef] [Scilit]
  50. Poyatos-Jiménez, F.; Morales, F.; Morales-Carrera, R.; Boffo, S.; Giordano, A.; Romero-Noguera, J. Fungal and bacterial biodeterioration of outdoor canvas paintings: The case of the cloisters of Quito, Ecuador. Crit. Rev. Eukaryot. Gene Expr. 2021, 31, 45–63. [Google Scholar] [CrossRef] [Scilit]
  51. Kisová, Z.; Planý, M.; Pavlović, J.; Bučková, M.; Puškárová, A.; Kraková, L.; Šoltys, K. Biodeteriogens characterization and molecular analyses of diverse funeral accessories from XVII Century. Appl. Sci. 2020, 10, 5451. [Google Scholar] [CrossRef] [Scilit]
  52. Gil, M.; Martins, M.R.; Carvalho, M.L.; Souto, C.; Longelin, S.; Cardoso, A.; Candeias, A.E. Microscopy and microanalysis of an extreme case of salt and biodegradation in 17th century wall paintings. Microsc. Microanal. 2015, 21, 606–616. [Google Scholar] [CrossRef] [Scilit]
  53. Nigro, L.; Mura, F.; Toti, M.P.; Cirigliano, A.; Rinaldi, T. Carbonatogenic bacteria on the ‘Motya Charioteer’ sculpture. J. Cult. Herit. 2022, 57, 256–264. [Google Scholar] [CrossRef] [Scilit]
  54. Heyrman, J.; Verbeeren, J.; Schumann, P.; Swings, J.; De Vos, P. Six novel Arthrobacter species isolated from deteriorated mural paintings. Int. J. Syst. Evol. Microbiol. 2005, 55, 1457–1464. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  55. Huang, C.H.; Wang, C.L.; Liou, J.S.; Lee, A.Y.; Blom, J.; Huang, L.; Watanabe, K. Reclassification of Micrococcus aloeverae and Micrococcus yunnanensis as later heterotypic synonyms of Micrococcus luteus. Int. J. Syst. Evol. Microbiol. 2019, 69, 3512–3518. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  56. Vary, P.S. Prime time for Bacillus megaterium. Microbiology 1994, 140, 1001–1013. [Google Scholar] [CrossRef] [Scilit]
  57. Yamada, K.; Komagata, K. Taxonomic studies on coryneform bacteria IV. Morphological, cultural, biochemical, and physiological characteristics. J. Gen. Appl. Microbiol. 1972, 18, 399–416. [Google Scholar] [CrossRef] [Scilit]
  58. Kim, S.J.; Moon, J.Y.; Weon, H.Y.; Hong, S.B.; Seok, S.J.; Kwon, S.W. Noviherbaspirillum suwonense sp. nov., isolated from an air sample. Int. J. Syst. Evol. Microbiol. 2014, 64 Pt 5, 1552–1558. [Google Scholar] [CrossRef] [Scilit]
  59. Jehlička, J.; Edwards, H.G.M.; Osterrothová, K.; Novotná, J.; Nedbalová, L.; Kopecký, J.; Němec, I.; Oren, A. Potential and limits of Raman spectroscopy for carotenoid detection in microorganisms: Implications for astrobiology. Philos. Trans. A Math. Phys. Eng. Sci. 2014, A 372, 20140199. [Google Scholar] [CrossRef] [Scilit]
  60. De Oliveira, V.E.; Castro, H.V.; Edwards, H.G.M.; de Oliveira, L.F.C. Carotenes and carotenoids in natural biological samples: A Raman spectroscopic analysis. J. Raman Spectrosc. 2010, 41, 642–650. [Google Scholar] [CrossRef] [Scilit]
  61. Imperi, F.; Caneva, G.; Cancellieri, L.; Ricci, M.A.; Sodo, A.; Visca, P. The bacterial aetiology of rosy discoloration of ancient wall paintings. Environ. Microbiology 2007, 9, 2894–2902. [Google Scholar] [CrossRef] [Scilit]
  62. Palanisamy, M.; Ramalingam, S. Microbial bacterioruberin: A comprehensive review. Indian. J. Microbiol. 2024, 64, 1477–1501. [Google Scholar] [CrossRef] [Scilit]
  63. Ivleva, N.P.; Wagner, M.; Horn, H.; Niessner, R.; Haisch, C. Towards a nondestructive chemical characterization of biofilm matrix by Raman microscopy. Anal. Bioanal. Chem. 2009, 393, 197–206. [Google Scholar] [CrossRef] [Scilit]
  64. Schmid, T.; Messmer, A.; Yeo, B.S.; Zhang, W.; Zenobi, R. Towards chemical analysis of nanostructures in biofilms II: Tip-enhanced Raman spectroscopy of alginates. Anal. Bioanal. Chem. 2008, 391, 1907–1916. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  65. Alves, J.F.; Edwards, H.G.; Korsakov, A.; De Oliveira, L.F.C. Revisiting the Raman Spectra of Carbonate Minerals. Minerals 2023, 13, 1358. [Google Scholar] [CrossRef] [Scilit]
  66. Berenblut, B.J.; Dawson, P.; Wilkinson, G.R. The Raman spectrum of gypsum. Spectrochim. Acta A Mol. Biomol. Spectrosc. 1971, 27, 1849–1863. [Google Scholar] [CrossRef] [Scilit]
  67. Veneranda, M.; Irazola, M.; Diez, M.; Iturregui, A.; Aramendia, J.; Castro, K.; Madariaga, J.M. Raman spectroscopic study of the degradation of a middle age mural painting: The role of agricultural activities. J. Raman Spectrosc. 2014, 45, 1110–1118. [Google Scholar] [CrossRef] [Scilit]
  68. Song, Q.; Zha, J.; Bai, Y.; Chen, L.; Zhang, Y.; Guo, H. Type and sources of salt efflorescence in painted stone carvings from Pujiang museum, Sichuan, China. Crystals 2023, 13, 273. [Google Scholar] [CrossRef] [Scilit]
  69. Steiger, M.; Asmussen, S. Crystallization of sodium sulfate phases in porous materials: The phase diagram Na2SO4–H2O and the generation of stress. Geochim. Cosmochim. Acta 2008, 72, 4291–4306. [Google Scholar] [CrossRef] [Scilit]
  70. Borrelli, E. Salts. In ARC Laboratory Handbook; ICCROM—International Centre for the Study of the Preservation and Restoration of Cultural Property: Rome, Italy, 1999; pp. 1–24. [Google Scholar]
  71. Ponizovskaya, V.B.; Rebrikova, N.L.; Kachalkin, A.V.; Antropova, A.B.; Bilanenko, E.N.; Mokeeva, V.L. Micromycetes as colonizers of mineral building materials in historic monuments and museums. Fungal Biol. 2019, 123, 290–306. [Google Scholar] [CrossRef] [Scilit]
  72. Trovão, J.; Portugal, A.; Soares, F.; Paiva, D.S.; Mesquita, N.; Coelho, C.; Tiago, I. Fungal diversity and distribution across distinct biodeterioration phenomena in limestone walls of the old cathedral of Coimbra, UNESCO World Heritage Site. Int. Biodeterior. Biodegrad. 2019, 142, 91–102. [Google Scholar] [CrossRef] [Scilit]
  73. Lepinay, C.; Mihajlovski, A.; Seyer, D.; Touron, S.; Bousta, F.; Di Martino, P. Biofilm communities survey at the areas of salt crystallization on the walls of a decorated shelter listed at UNESCO World cultural Heritage. Int. Biodeterior. Biodegrad. 2017, 122, 116–127. [Google Scholar] [CrossRef] [Scilit]
  74. Mihajlovski, A.; Lepinay, C.; Mirval, A.L.; Touron, S.; Bousta, F.; Di Martino, P. Characterization of the archaeal and fungal diversity associated with gypsum efflorescences on the walls of the decorated Sorcerer’s prehistoric cave. Ann. Microbiol. 2019, 69, 1071–1078. [Google Scholar] [CrossRef] [Scilit]
  75. Rosado, T.; Gil, M.; Mirão, J.; Candeias, A.; Caldeira, A.T. Oxalate biofilm formation in mural paintings due to microorganisms–A comprehensive study. Int. Biodeterior. Biodegrad. 2013, 85, 1–7. [Google Scholar] [CrossRef] [Scilit]
  76. Zhao, M.; Li, Y.; Chen, H.; Chen, Y.; Zheng, L.; Wu, Y.; Wang, T. Metagenomic study of the microbiome and key geochemical potentials associated with architectural heritage sites: A case study of the Song Dynasty city wall in Shou County, China. Front. Microbiol. 2024, 15, 1453430. [Google Scholar] [CrossRef] [Scilit]
  77. Pandey, S. Toxicity of fluoride to microbial activity and population in the soil. PhytoTalks 2024, 1, 29–37. [Google Scholar] [CrossRef] [Scilit]
  78. Piñar, G.; Ettenauer, J.; Sterflinger, K. La vie en rose: A review of the rosy discoloration of subsurface monuments. In The Conservation of Subterranean Cultural Heritage; Saiz-Jiménez, C., Ed.; CRC Press: Boca Raton, FL, USA, 2014. [Google Scholar] [CrossRef] [Scilit]
  79. Tescari, M.; Bartoli, F.; Casanova Municchia, A.; Suy, T.B.; Caneva, G. Characterisation of a pink discoloration on stone in the Pnom Krom temple (Angkor, Cambodia). In Science and Art: A Future for Stone, Proceedings of the 13th International Congress on the Deterioration and Conservation of Stone, Paisley, UK, 6–10 September 2016; Hughes, J., Howind, T., Eds.; University of the West of Scotland: Paisley, UK, 2016; Volume 1, p. 147. [Google Scholar]
  80. Tescari, M.; Frangipani, E.; Caneva, G.; Casanova Municchia, A.; Sodo, A.; Visca, P. Arthrobacter agilis and rosy discoloration in “Terme del Foro” (Pompeii, Italy). Int. Biodeterior. Biodegrad. 2018, 130, 48–54. [Google Scholar] [CrossRef] [Scilit]
  81. Tescari, M.; Visca, P.; Frangipani, E.; Bartoli, F.; Rainer, L.; Caneva, G. Celebrating centuries: Pink-pigmented bacteria from rosy patinas in the House of Bicentenary (Herculaneum, Italy). J. Cult. Herit. 2018, 34, 43–52. [Google Scholar] [CrossRef] [Scilit]
  82. Basile, A.; Riggio, F.P.; Tescari, M.; Chebbi, A.; Sodo, A.; Bartoli, F.; Imperi, F.; Caneva, G.; Visca, P. Metagenome-resolved functional traits of Rubrobacter species implicated in rosy discoloration of ancient frescoes in two Georgian Cathedrals. Sci. Total Environ. 2025, 958, 178135. [Google Scholar] [CrossRef] [Scilit]
  83. Charola, A.E. Salts in the Deterioration of Porous Materials: An Overview. J. Am. Inst. Conserv. 2000, 39, 327–343. [Google Scholar] [CrossRef]
  84. Chen, G.; Strevett, K.A. Impact of surface thermodynamics on bacterial transport. Environ. Microbiol. 2001, 3, 237–245. [Google Scholar] [CrossRef] [Scilit]
  85. Dechesne, A.; Wang, G.; Gülez, G.; Or, D.; Smets, B.F. Hydration-controlled bacterial motility and dispersal on surfaces. Proc. Natl. Acad. Sci. USA 2010, 107, 14369–14372. [Google Scholar] [CrossRef] [Scilit]
  86. Ginn, T.R.; Wood, B.D.; Nelson, K.E.; Scheibe, T.D.; Murphy, E.M.; Clement, T.P. Processes in microbial transport in the natural subsurface. Adv. Water Resour. 2002, 25, 1017–1042. [Google Scholar] [CrossRef] [Scilit]
  87. Diaz-Herraiz, M.; Jurado, V.; Cuezva, S.; Laiz, L.; Pallecchi, P.; Tiano, P.; Sanchez-Moral, S.; Saiz-Jimenez, C. Deterioration of an Etruscan tomb by bacteria from the order Rhizobiales. Sci. Rep. 2014, 4, 3610. [Google Scholar] [CrossRef] [Scilit]
  88. Staudt, A.K.; Wolfe, L.G.; Shrout, J.D. Variations in exopolysaccharide production by Rhizobium tropici. Arch. Microbiol. 2012, 194, 197–206. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  89. Casanova Municchia, A.; Fidanza, M.R.; Caneva, G. Advances in testing the interference of biocides on stone materials: A comparative analysis and guidelines for a standardized approach. J. Cult. Herit. 2023, 64, 23–41. [Google Scholar] [CrossRef] [Scilit]
  90. Romanov, V.I.; Hernández-Lucas, I.; Martínez-Romero, E. Carbon metabolism enzymes of Rhizobium tropici cultures and bacteroids. Appl. Environ. Microbiol. 1994, 60, 2339–2342. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  91. Vahabi, A.; Ramezanianpour, A.A.; Sharafi, H.; Zahiri, H.S.; Vali, H.; Noghabi, K.A. Calcium carbonate precipitation by strain Bacillus licheniformis AK 01, newly isolated from loamy soil: A promising alternative for sealing cement-based materials. J. Basic. Microbiol. 2015, 55, 105–111. [Google Scholar] [CrossRef] [Scilit]
  92. Andreolli, M.; Lampis, S.; Bernardi, P.; Calò, S.; Vallini, G. Bacteria from black crusts on stone monuments can precipitate CaCO3 allowing the development of a new bio-consolidation protocol for ornamental stone. Int. Biodeterior. Biodegrad. 2020, 153, 105031. [Google Scholar] [CrossRef] [Scilit]
  93. Huerta, B.; Marti, E.; Gros, M.; López, P.; Pompêo, M.; Armengol, J.; Barceló, D.; Balcázar, J.L.; Rodríguez-Mozaz, S.; Marcé, R. Exploring the links between antibiotic occurrence, antibiotic resistance, and bacterial communities in water supply reservoirs. Sci. Total Environ. 2013, 456, 161–170. [Google Scholar] [CrossRef] [Scilit]
  94. He, J.; Zhang, N.; Shen, X.; Muhammad, A.; Shao, Y. Deciphering environmental resistome and mobilome risks on the stone monument: A reservoir of antimicrobial resistance genes. Sci. Total Environ. 2022, 838, 156443. [Google Scholar] [CrossRef] [Scilit]
  95. Ruginescu, R.; Enache, M.; Popescu, O.; Gomoiu, I.; Cojoc, R.; Batrinescu-Moteau, C.; Maria, G.; Dumbravician, M.; Neagu, S. Characterization of some salt-tolerant bacterial hydrolases with potential utility in cultural heritage bio-cleaning. Microorganisms 2022, 10, 644. [Google Scholar] [CrossRef] [Scilit]
  96. Tomaselli, L.; Tiano, P.; Lamenti, G. Occurrence and fluctuation in photosynthetic biocoenoses dwelling on stone monuments. In Of Microbes and Art: The Role of Microbial Communities in the Degradation and Protection of Cultural Heritage; Ciferri, O., Tiano, P., Mastromei, G., Eds.; Springer: Boston, MA, USA, 2000; pp. 63–76. [Google Scholar] [CrossRef] [Scilit]
  97. Macedo, M.F.; Miller, A.Z.; Dionísio, A.; Saiz-Jimenez, C. Biodiversity of cyanobacteria and green algae on monuments in the Mediterranean Basin: An overview. Microbiology 2009, 155, 3476–3490. [Google Scholar] [CrossRef] [Scilit]
  98. Nugari, M.P.; Pietrini, A.M.; Caneva, G.; Imperi, F.; Visca, P. Biodeterioration of mural paintings in a rocky habitat: The Crypt of the Original Sin (Matera, Italy). Int. Biodeterior. Biodegrad. 2009, 63, 705–711. [Google Scholar] [CrossRef] [Scilit]
  99. Komar, M.; Nowicka-Krawczyk, P.; Ruman, T.; Nizioł, J.; Konca, P.; Gutarowska, B. Metabolomic analysis of photosynthetic biofilms on building façades in temperate climate zones. Int. Biodeterior. Biodegrad. 2022, 169, 105374. [Google Scholar] [CrossRef] [Scilit]
  100. De Luca, D.; Caputo, P.; Perfetto, T.; Cennamo, P. Characterisation of environmental biofilms colonising wall paintings of the fornelle cave in the archaeological site of Cales. Int. J. Environ. Res. Public Health. 2021, 18, 8048. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  101. Ignatenko, M.E.; Yatsenko-Stepanova, T.N.; Khlopko, Y.A. Halotolerant strain of Chlorococcum oleofaciens from the Lake Elton Biosphere Reserve. Biosyst. Divers. 2019, 27, 244–249. [Google Scholar] [CrossRef] [Scilit]
  102. Borisova, Y.V. Species composition of bacteria accompanying microalgae in culture (review of literature). Int. J. Algae 2000, 2, 115–126. [Google Scholar] [CrossRef] [Scilit]
Applsci 15 08762 g001
Figure 1. Study site. Geographical placement of the Riofreddo country in the Latium region.
Figure 1. Study site. Geographical placement of the Riofreddo country in the Latium region.
Applsci 15 08762 g001
Applsci 15 08762 g002
Figure 2. Study site. (a) Outdoor view of the entrance, (b) fresco of “Oratorio dell’Annunziata” chapel, and (c) sampling area on the fresco. S1–S11: areas of ATP measurement, stereo microscope observation, and sampling. Ss represents the control site on pure salt efflorescence.
Figure 2. Study site. (a) Outdoor view of the entrance, (b) fresco of “Oratorio dell’Annunziata” chapel, and (c) sampling area on the fresco. S1–S11: areas of ATP measurement, stereo microscope observation, and sampling. Ss represents the control site on pure salt efflorescence.
Applsci 15 08762 g002
Applsci 15 08762 g003
Figure 3. Stereofield images of sampling points.
Figure 3. Stereofield images of sampling points.
Applsci 15 08762 g003
Applsci 15 08762 g004
Figure 4. Morphological analysis through microscopic observation. Field stereomicroscope images Samples S6a, S7, S9 and S11, respectively, in (a–d); SEM images of the same samples in (a1–c1,d3,d4); stereomicroscope Zeiss Azio Zoom image of S11 (d1); fresh slides 100× magnification of S11 in (d2).
Figure 4. Morphological analysis through microscopic observation. Field stereomicroscope images Samples S6a, S7, S9 and S11, respectively, in (a–d); SEM images of the same samples in (a1–c1,d3,d4); stereomicroscope Zeiss Azio Zoom image of S11 (d1); fresh slides 100× magnification of S11 in (d2).
Applsci 15 08762 g004
Applsci 15 08762 g005
Figure 5. Raman spectra of (A) cultures from the isolated colonies (S6a) (3) and (5) and S11; (B) sample of the substrate with evidence of biological colonization (S6a, S5a, S7) (C = calcite; G = gypsum; P = polysaccharide compounds).
Figure 5. Raman spectra of (A) cultures from the isolated colonies (S6a) (3) and (5) and S11; (B) sample of the substrate with evidence of biological colonization (S6a, S5a, S7) (C = calcite; G = gypsum; P = polysaccharide compounds).
Applsci 15 08762 g005
Applsci 15 08762 g006
Figure 6. (a) Ionic balance, (b) trends of calcium and sulphate and (c) chloride and sodium of analyzed samples in µEqs.
Figure 6. (a) Ionic balance, (b) trends of calcium and sulphate and (c) chloride and sodium of analyzed samples in µEqs.
Applsci 15 08762 g006
Applsci 15 08762 g007
Figure 7. Bi-plot of distribution of samples and ions.
Figure 7. Bi-plot of distribution of samples and ions.
Applsci 15 08762 g007
Table 1. Alteration phenomenology, ATP values and biological identification: (-) analysis not performed; (n.i.) No evidence of isolation was observed.
Table 1. Alteration phenomenology, ATP values and biological identification: (-) analysis not performed; (n.i.) No evidence of isolation was observed.
Alteration
Phenomenology		SamplesAtp Values
Rlu/Cm2		IsolateClosest Relative(S)Accession NumberIdentity
%
Salt
efflorescence		S150----
S4b-----
S5b-----
S6b141----
Red spotS10238----
White turfS230,542AParengyodontium album
(Limber) C.C.T sang et al. CBS:368.72		MH860502.199.11
S88019BMH860502.199.65
C99.82
PinkS4a476-n.i.--
S5a14,933-n.i.--
S6a15,5691Rhizobium tropici CIAT 899TNR_102511.199.93
2Micrococcus yunnanensis
YIM 65004T		NR_116578.199.07
Micrococcus aloeverae AE-6TNR_134088.199.27
3Priestia megaterium
ATCC 14581T		NR_117473.199.86
4Microbacterium flavescens strain 401NR_02935098.70
5Arthrobacter parietis
LMG 22281T		NR_042252.199.71
6Noviherbaspirillum suwonense 5410S-62TNR_133798.198.36
Dark greenS320,275-Eps--
S72027-EPs--
Hard BlackS96913-EPs--
Light GreenS1117,003-Chlorella sp.
satellite bacteria		--
Table 2. Ions weight percentage relative to the dry samples mass; n.d. = not detected.
Table 2. Ions weight percentage relative to the dry samples mass; n.d. = not detected.
S1S2S3S4aS4bS5aS5bS6aS6bS7S8S9S10S11
F−n.d.n.d.n.d.n.d.n.d.n.d.n.d.n.d.n.d.0.110 ± 0.0060.064 ± 0.0030.69 ± 0.040.022 ± 0.0010.20 ± 0.01
Cl−1.3 ± 0.10.76 ± 0.040.52 ± 0.032.1 ± 0.10.60 ± 0.031.30 ± 0.060.64 ± 0.032.7 ± 0.11.4 ± 0.11.1 ± 0.10.61 ± 0.030.52 ± 0.030.20 ± 0.010.18 ± 0.01
NO2−n.d.n.d.n.d.n.d.n.d.n.d.n.d.n.d.n.d.n.d.0.200 ± 0.010n.d.n.d.0.14 ± 0.01
NO3−0.81 ± 0.040.11 ± 0.010.63 ± 0.030.036 ± 0.0020.016 ± 0.0010.10 ± 0.010.010 ± 0.0010.12 ± 0.010.092 ± 0.0050.73 ± 0.040.20 ± 0.010.36 ± 0.020.14 ± 0.010.14 ± 0.01
SO42−0.19 ± 0.0123 ± 147 ± 20.29 ± 0.021.8 ± 0.10.56 ± 0.033.1 ± 0.24.3 ± 0.20.32 ± 0.027.6 ± 0.418 ± 113 ± 15.4 ± 0.326 ± 1
C2O42−n.d.0.0067 ± 0.0003n.d.n.d.n.d.n.d.0.0075 ± 0.0004n.d.n.d.0.0079 ± 0.00040.018 ± 0.0010.056 ± 0.0030.0043 ± 0.00020.050 ± 0.003
PO43−n.d.0.028 ± 0.0010.27 ± 0.01n.d.n.d.n.d.n.d.n.d.n.d.0.010 ± 0.001n.d.n.d.n.d.n.d.
Na+0.36 ± 0.020.24 ± 0.010.10 ± 0.010.83 ± 0.040.20 ± 0.010.75 ± 0.040.22 ± 0.010.710 ± 0.0360.310 ± 0.0160.370 ± 0.0190.200 ± 0.0100.350 ± 0.0180.090 ± 0.0050.140 ± 0.007
NH4+n.d.n.d.n.d.n.d.n.d.n.d.n.d.n.d.n.d.n.d.n.d.n.d.n.d.n.d.
K+0.025 ± 0.0010.046 ± 0.0020.011 ± 0.0010.130 ± 0.0070.059 ± 0.0030.190 ± 0.0100.019 ± 0.0010.290 ± 0.0150.086 ± 0.0040.530 ± 0.0270.190 ± 0.0100.230 ± 0.0120.120 ± 0.0060.260 ± 0.013
Mg2+0.070 ± 0.0040.056 ± 0.0030.072 ± 0.0040.031 ± 0.0020.064 ± 0.0030.036 ± 0.0020.033 ± 0.0020.052 ± 0.0030.026 ± 0.0010.040 ± 0.0020.017 ± 0.0010.057 ± 0.0030.007 ± 0.0010.031 ± 0.002
Ca+3.3 ± 0.218 ± 122 ± 10.65 ± 0.032.1 ± 0.10.98 ± 0.051.8 ± 0.12.1 ± 0.10.85 ± 0.046.1 ± 0.312 ± 112 ± 14.8 ± 0.214 ± 1
Total%6.1 ± 0.343 ± 270 ± 44.1 ± 0.24.8 ± 0.23.9 ± 0.25.8 ± 0.2310 ± 13.1 ± 0.217 ± 131 ± 227 ± 111.000 ± 142 ± 2
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Bartoli, F.; Casanova Municchia, A.; Tescari, M.; Ciccone, I.; Rosati, P.; Lazzara, A.; Catrambone, M. Preventive Diagnosis of Biological Colonization and Salt-Related Decay on the Frescoes of the “Oratorio dell’Annunziata” (Riofreddo, Latium, Italy) to Improve Conservation Plans. Appl. Sci. 2025, 15, 8762. https://doi.org/10.3390/app15158762

AMA Style

Bartoli F, Casanova Municchia A, Tescari M, Ciccone I, Rosati P, Lazzara A, Catrambone M. Preventive Diagnosis of Biological Colonization and Salt-Related Decay on the Frescoes of the “Oratorio dell’Annunziata” (Riofreddo, Latium, Italy) to Improve Conservation Plans. Applied Sciences. 2025; 15(15):8762. https://doi.org/10.3390/app15158762

Chicago/Turabian Style

Bartoli, Flavia, Annalaura Casanova Municchia, Marco Tescari, Ilaria Ciccone, Paolo Rosati, Alessandro Lazzara, and Maria Catrambone. 2025. "Preventive Diagnosis of Biological Colonization and Salt-Related Decay on the Frescoes of the “Oratorio dell’Annunziata” (Riofreddo, Latium, Italy) to Improve Conservation Plans" Applied Sciences 15, no. 15: 8762. https://doi.org/10.3390/app15158762

APA Style

Bartoli, F., Casanova Municchia, A., Tescari, M., Ciccone, I., Rosati, P., Lazzara, A., & Catrambone, M. (2025). Preventive Diagnosis of Biological Colonization and Salt-Related Decay on the Frescoes of the “Oratorio dell’Annunziata” (Riofreddo, Latium, Italy) to Improve Conservation Plans. Applied Sciences, 15(15), 8762. https://doi.org/10.3390/app15158762

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop