Construction and Identification of a Food-Grade Recombinant Cyberlindnera jadinii Strain Expressing Lignin Peroxidase

Abstract

Lignin peroxidase is one of a series of enzymes involved in lignin degradation and is secreted by white-rot fungi. However, white-rot fungi have a long growth cycle and low enzyme activity, which limits their application. An efficient and stable heterologous expression system might be the solution to overcome these critical limitations. In this study, the lignin peroxidase gene of white-rot fungus (Phanerodontia chrysosporium) was cloned and heterologously expressed in the food-grade yeast Cyberlindnera jadinii for the first time. The strain ZHMX4 expressing lignin peroxidase was constructed, and its genetic stability, enzyme activity and phenotypic analysis were evaluated. ZHMX4 retained and maintained genetic stability for up to 100 generations. Its lignin peroxidase activity reached a maximum at 96 h with 68.52 U/L. Phenotypic analysis (Biolog) showed obvious changes in the substrate metabolism of the engineered strain compared to Cyberlindnera jadinii. Thus, ZHMX4 is a food-grade genetically engineered strain with great potential for lignin degradation. This study successfully expressed lignin peroxidase in Cyberlindnera jadinii as a new approach for the biodegradation of lignin. These findings should be useful for further academic studies, industrial applications of lignin peroxidase and construction of artificial white-rot fungi.

1. Introduction

Straw is an important source of roughage for herbivorous livestock. However, the degree of utilization is very low due to a lack of suitable and adequate methods. Most straw is discarded and burned on the spot, resulting in a waste of resources and generation of environmental pollution. Lignin, as a recalcitrant high molecular weight polymer, widely exists in straw tissue [1,2,3,4]. Therefore, extensive research efforts are being undertaken to effectively degrade lignin and improve the utilization rate of straw forage. At present, microbial and enzymatic treatments are considered to be the best method for lignin degradation because of their low cost, low pollution and simple operation [5,6]. White-rot fungi are the microorganisms with the highest potential for such microbial and enzymatic treatments because of their ability to completely degrade lignin to CO₂ and H₂O [7,8,9]. Phanerodontia chrysosporium is a white-rot fungus which secretes a family of lignin-degrading enzymes that are involved in the biodegradation of lignin and several environmental pollutants [10,11]. In 1983, Glenn and Tien reported that P. chrysosporium secretes Lignin peroxidase (LiP) and Mn-dependent peroxidase (MnP) under nutrient limitation. They also studied the mechanism involved in biosynthesis of both enzymes and their role in lignin degradation. It was proposed that LiP and MnP play key roles in lignin degradation [12,13]. This capability of P. chrysosporium to produce lignin peroxidases and manganese peroxidases makes it a model organism for studying lignin-degrading enzyme systems. P. chrysosporium has previously been proposed as an efficient biological resource for the production of LiP [14].

LiP, an oxidoreductase, is a monomer heme protein (molecular weight 38~43 kDa) secreted by P. chrysosporium [15]. It is the main lignin degradation enzyme in the process of lignin biodegradation [16,17]. It can enzymatically hydrolyze lignin in straw, forage and feed seed coat, and as a result, improve the quality of feed materials, and, thus, improve the nutritional value [18].

Nonetheless, the LiP produced by wild-type strains isolated from the environment has shown some disadvantages, such as difficulty to use, proneness to inactivation, high nutritional requirements, low yield and low enzyme activity, which to a great extent hinder the large-scale application of LiP. Nevertheless, in recent years, to overcome these disadvantages, more and more lignin peroxidase genes (lip) from different sources have been cloned and expressed in heterologous hosts [19,20,21]. Therefore, it is important to study the expression of LiP.

Cyberlindnera jadinii (former Candida utilis) is certified as a food-grade yeast by the Food and Drug Administration of the USA (FDA) and is used in the food, feed and pharmaceutical industries [22]. Extensive studies on C. jadinii have led to the development of a mature C. jadinii expression system. In selecting resistance markers, investigators have proposed the L41 gene present in the C. jadinii genome, which encodes the L41 ribosomal protein responsible for the cycloheximide (CYH)-resistant phenotype in yeasts. Studies have shown that a CYH resistance gene can be obtained through mutating a single base in codon 56 of the L41 gene. This has provided a convenient method for the construction of a C. jadinii integrated expression vector [23]. GAP-p (glyceraldehyde-3-phosphate dehydrogenase promoter) is a strong constitutive promoter, which was successfully cloned from C. jadinii [24]. The 18S rDNA sequence in C. jadinii is a highly repetitive unit and an effective strategy to increase the copy number of foreign genes in the yeast genome [25] in the absence of a stable plasmid in C. jadinii. The integration of foreign genes into chromosomes using an integrated vector is the main approach for C. jadinii to introduce foreign genes into chromosomes [26,27]. These findings confirm that C. jadinii has good potential to be applied as a genetically engineered expression host. Up to now, there are no reports on heterologous expression of the white-rot fungi lip gene in C. jadinii.

At present, the main bottlenecks in applying white-rot fungi lipid peroxidase for lignin degradation include the low yield of LiP, the inability for industrial-scale production and the high cost of producing lignin-degrading enzymes. To enable lignin degradation through increasing the yield of LiP to promote the digestion and utilization of straw feed, the lip gene of white-rot fungus (P. chrysosporium) was cloned via genetic engineering and subsequently, a recombinant C. jadinii carrying the lip gene was constructed. The genetic stability and enzyme activity of the engineered strain were also studied, and the findings laid the foundation for further research and applications.

2. Materials and Methods

2.1. Plasmids and Strains

P. chrysosporium (BNCC 190652) was purchased from Beijing BeNa Culture Collection and cultured in comprehensive potato dextrose agar (PDA) medium (1000 mL potato juice, 3 g Monopotassium phosphate, 1.5 g magnesium sulfate, 20 g glucose, 10 mg vitamin B1, 20 g agar, pH neutral) at 32 °C for 6 days. C. jadinii (CICC 31395), used for the expression of the lip gene, was purchased from China Industrial Microbial Strain Preservation and Management Center and cultured in Yeast Potato Dextrose (YPD) medium (1% yeast extract, 2% peptone and 2% dextrose) at 30 °C. The pBR322 plasmid as a skeleton vector was purchased from TAKARA Co., Ltd, Dalian, China.

2.2. Primer Design

Primers were designed and appropriate restriction sites were introduced, guided by the C. jadinii gene sequence published in GenBank (Accession Number: M74229.1) as well as the sequence and features of the pBR322 plasmid (

Table 1. PCR primers used in this study.

	Primers	Primers Sequence (5′ to 3′)	Size (bp)	Source
1	GAP-p1	GGATATCTTACAGCGAGCACTCAA EcoRV	975	C. jadinii
	GAP-p2	GCTCTAGAATGTTGTTTGT XbaI
2	GAP-t1	CTAGCTAGCTATGACTTTTAT NheI	462	C. jadinii
	GAP-t2	GGGATCCTTCATTCATCCCTCACTATCG BamHI
3	L41-P4	CGTCGACAGTAAGTATGAAAAGAGC SalI	1970	C. jadinii
	L41-RM4	GGGATCCGG GTTTGGTCTATGTTGCT BamHI
	mL41-P5	AACCAAGCAAGTTTTCCAC	CAA code Gln	C. jadinii
	mL41-R5	GTGGAAAACTTGCTTGGTT
4	18S rDNA-P3	CGATATCTGCCAGTAGTCATATGC EcoRV	1587	C. jadinii
	18S rDNA-R3	CGATATCTGACTTGCGCTTACTAG EcoRV
5	Lip-R1+1	GCTCTAGAATGGCCTTCAAGCAGCTCTTC XbaI	1239	P. chrysosporium
	Lip-F1+1	CTAGCTAGCTTAGGCCTTGTGCGGGG NheI
6	M1-1S	GGGCCCTTCTGGGTCTTGTAATT		pGMLR
	M1-1AS	GCATATGACTACTGGCAAGTAAGTATGAAAAGAGCCAAT
	M2-1S	ATTGGCTCTTTTCATACTTACTTGCCAGTAGTCATATGC
	M2-1AS	GCCCTGTATCGTTATTTATTGTCACTACCTCCCTG

Primers #1–#5 were used for amplification of the gene of interest; the underlining indicates restriction sites. Primers of #6 were used for SOE-PCR to delete the DNA sequences from prokaryotic cells.

).

2.3. Construction of a Homologous Integrated Expression Vector

2.3.1. Cloning of the lip Gene

P. chrysosporium total RNA was extracted using Trizol reagent following the manufacturer’s instructions. Based on the full lip cDNA sequence of the lip gene (GenBank Accession Number: M74229.1), primers Lip-R1+1 and Lip-F1+1 were designed. The cDNA was generated from the total RNA extracted from P. chrysosporium using the BcaBEST^TM RNA PCR kit Ver.1.1 (RR023A, TAKARA) with oligo dT primers. The lip cDNA was amplified via PCR with the upstream primer Lip-R1+1 and the downstream primer Lip-F1+1. The amplification was carried out under the following conditions: the first step was at 94 °C for 1 min, followed by 30 cycles of 94 °C for 30 s, 51 °C for 30 s, and 72 °C for 2 min, and the final extension was carried out at 72 °C for 5 min. The purified PCR products were cloned into the pMD^TM19-T vector Cloning Kit (6013, TAKARA), and transformed into Trans1-T1 Phage Resistant Chemically Competent Cell (CD501-02, TransGen Biotech, Beijing, China) to construct the recombinant clone. The PCR-positive clones were sequenced, and the cloned sequence was confirmed through comparing the sequence within the recombinant construct with the sequence published in GenBank.

2.3.2. Cloning of C. jadinii GAP Promoter Sequence, GAP Terminator Sequence, Cycloheximide Resistance Gene (CYH) and 18S rDNA Fragment

Primers were designed based on the C. jadinii GAP gene promoter sequence-GAP-p (ID: FJ664342.1), GAP gene terminator sequence-GAP-t (ID: FJ664343.1) and 18S rDNA gene sequence (ID: AB054569.1) published in GenBank and the sequence characteristics of the pBR322 plasmid. Appropriate restriction sites (GAP-p1/GAP-p2 (EcoRV/XbaI), GAP-t1/GAP-t2 (XbaI/BamHI), 18S rDNA-P3/18S rDNA-R3 (EcoRV and EcoRV)) were also introduced (Table 1). The C. jadinii genome was used as the template. Yeast GAP-p, GAP-t and 18s rDNA fragments were obtained via PCR amplification with the corresponding primers. These PCR-amplified fragments were ligated into the pMD19-T vector to obtain ligation products, named pT-GP, pT-GT and pT-rD plasmid, respectively. All three plasmids were transformed into Trans-5α chemically competent cells (CD201-01, TransGen Biotech), and the positive clones were identified via PCR.

Primers L41-P4 and L41-RM4 were designed, and suitable restriction sites (SalI and BamHI) were introduced using the GenBank published sequence of the C. jadinii CYH sensitive gene (L41) (ID: D67040.1), combined with the sequence characteristics of the pBR322 plasmid. At the same time, a pair of reverse complementary primers, mL41-P5 and mL41-R5, was also designed. The upstream and downstream fragments of L41 were amplified via PCR using the C. jadinii genome as template and the primers P4/R5 and P5/RM4. Then, the upstream and downstream fragments were mixed at equal ratios, and the primer P4/RM4 was used for nested PCR to obtain the cycloheximide resistance gene, CYH. The fragment was ligated to the pMD19-T vector to obtain the pT-CYH plasmid, which was transformed into Trans-5α chemically competent cells. Positive clones were identified via PCR.

2.3.3. Construction of the pGMLR Vector

The cloned GAP-p and GAP-t sequences, CYH and 18S rDNA gene fragments including restriction sites were linked to the pBR322 vectors. After pT-GP and pT-GT were obtained, pT-GP, pT-GT and pBR322 were digested with EcoRV/XbaI, XbaI/BamHI and EcoRV/BamHI, respectively. Then, the digested fragments were ligated via T4 DNA ligase using a three-fragment linking method to obtain the plasmid pBR-GAP. pT-CYH and plasmid pBR-GAP were digested with BamHI/SalI and the target fragments were recovered and ligated with T4 DNA ligase to obtain the construct pBR-G-L. The plasmid pBR-G-L was digested with XbaI/NheI and the target fragment was recovered. The recovered fragment was ligated to the lip gene via T4 DNA ligase to obtain the plasmid pGML. The plasmids pT-rD and pGML were digested with EcoRV, and the digested fragments were ligated with T4 DNA ligase to obtain the integrated expression vector pGMLR.

2.4. Construction of Recombinant Food-Grade C. jadinii Expressing lip

Primers were designed with the pGMLR expression vector as a template, and the target sequence was divided into two fragments. The prokaryotic DNA sequences for the bacterial plasmid sequence and Amp drug resistance marker sequence were deleted using Splicing Overlap Extension (SOE) PCR [28]. The primers used in this process were M1-1S, M1-1AS, M2-1S and M2-1AS. The target fragment of the SOE PCR experiment was recovered and electrotransformed into C. jadinii to obtain the recombinant C. jadinii strain ZHMX4. The recombinant strain was spread on YPD/CYH (20 μg/mL) plates and cultured at 30 °C for 3 to 5 days.

2.5. Identification and Genetic Stability Study of Transformants

The transformants were subcultured in YPD liquid medium containing CYH (20 μg/mL) over 3 generations. Several transformants were selected and genomes were extracted. The primers Lip-F1+1 and Lip-R1+1 were used to confirm the identity of the transformants via PCR and sequencing. The PCR-positive transformants were continuously cultured in YPD medium without CYH, and then subcultured in CYH selective medium with different concentration gradients (20, 30, 45, 50 μg/mL). The yeast genome was extracted on the 1st and 15th day of culture, and the lip gene was detected via PCR to determine the genetic stability of the foreign gene. The reproductive generation of yeast for each transfer was calculated using the following formula [29]:

$$\frac{logN-log0.1}{log2}$$

(1)

Total protein was extracted from the transformants using the Yeast Protein Extraction Reagent kit (9780, TAKARA) following the manufacturer’s instructions and expression of the lip protein was verified via SDS-PAGE.

2.6. Detection of Lignin Peroxidase Expression and Enzyme Activity

The recombinant ZHMX4 and P. chrysosporium were each cultured separately in 10 mL optimized enzyme production medium (10 g Glucose, 1 g Yeast extract, 0.1 g (NH₄)₂SO₄, 0.3 g KH₂PO₄, 0.4 g MgSO₄.7H₂O, 0.035 g MnSO₄, 0.007 g CuSO₄.5H₂O) at 8% inoculum, pH 3, 30 °C and 200 rpm/min shaking until the culture achieved the logarithmic phase. The cultures were sampled at 24, 48, 72, 96, 120, 144, 168 and 192 h, centrifuged for 10 min at 5000× g, and the supernatant was used to determine the enzyme activity. The peroxidase enzyme activity was determined using veratryl alcohol (VA) as the substrate [30]. One milliliter of 50 mmol/L tartrate buffer (pH 3), 500 μL of 10 mmol/L veratryl alcohol and 1 mL crude enzyme solution were mixed and warmed up for 10 min in a warm bath at 30 °C after which, 20 μL of 20 mmol/L H₂O₂ solution was added to start the reaction. The change in absorbance at 310 nm in the first 3 min of the reaction was measured. One unit (U) of enzyme activity was defined as the amount of enzyme needed to oxidise 1 μM of veratryl alcohol to veratraldehyde per minute. The experiment was carried out with the enzyme solution but without H₂O₂ as the control.

Enzyme activity was calculated based on the following formula:

$$U\left(U/L\right)=\frac{OD}{t}\times \frac{V}{\epsilon \times {10}^{-6}\times Va}$$

(2)

OD = absorption

V = reaction volume (ml)

t = reaction time (min)

Va = enzyme volume (ml)

ε = extinction coefficient

LiP: ε = 3.6 × 10⁴ [(mol/L)⁻¹cm⁻¹].

2.7. Phenotype Characterization Using the Biolog MicroStation™ System

Three days before the inoculation of Biolog YT MicroPlates, containing 94 different carbon sources, (Biolog, Inc., Hayward, CA, USA), the ZHMX4 and C. jadinii were streaked twice on YPD plates and incubated at 30 °C. The wells of the Biolog YT MicroPlates were inoculated with 100 μL of the cell suspensions, adjusted to 47% T transmittance as recommended by the manufacturer. Positive reactions were automatically recorded using a microplate reader with a 590 nm wavelength filter.

3. Results

3.1. Construction of the Homologous Integration Expression Vector pGMLR

The homologous integrative expression vector used pBR322 as the base vector, and included an 18S rDNA gene fragment, the GAP-p promoter sequence of the yeast-derived glyceraldehyde-3-phosphate dehydrogenase (GAPD) gene, the lip gene, the GAP-t terminator sequence of the yeast-derived GAPD gene, and the cycloheximide resistance gene CYH that were sequentially ligated from the 3′-end to the 5′-end. The plasmid was extracted and verified via enzyme digestion and PCR. All the fragments were correctly ligated to the vector, and the recombinant expression vector was named pGMLR (Figure 1). SOE-PCR was performed using the pGMLR vector as a template to delete DNA sequences that were derived from prokaryotes. The PCR products obtained after SOE-PCR, were sequenced and the results (Figure 2) showed that the sequence was completely consistent with the predicted eukaryotic sequence (~6233 bp), indicating that the prokaryotic gene sequence was deleted and the food-grade sequence was spliced successfully.

3.2. Identification and Genetic Stability Study of Transformants

The target fragment of the SOE PCR experiment was recovered and electrotransformed into C. jadinii to obtain the recombinant C. jadinii strain ZHMX4. Then, the ZHMX4 strain was spread on CYH-containing agar plates and cultured at 30 °C until colonies were observed. Positive transformants were selected and subcultured in YPD liquid medium containing CYH (20 μg/mL) over several generations, and all the transformants grew well. Genomic DNA was extracted from the transformants and used as the template for PCR amplification with primers Lip-F1+1 and Lip-R1+1, and the PCR amplicon was sequenced. As shown in Figure 3, the amplified products of the selected transformants #1–#6 are consistent with the size of the lip gene (~1239 bp). The sequencing results (Figure 4) also showed that the sequence was identical to the original sequence, confirming the correct integration of the lip gene into the C. jadinii chromosome.

The positive recombinant strain #6 was selected and subjected to continuous culture in YPD liquid medium without CYH, and then screened in CYH-selective medium at different CYH concentration gradients (20, 30, 45, 50 μg/mL). We observed that the transformants grew in 50 μg/mL CYH-resistant medium, but the untransformed C. jadinii could not grow. Hence, an engineered strain of C. jadinii with stable CYH resistance was obtained.

Genomic DNA of the recombinant strain #6 was extracted and PCR was performed using primers Lip-F1+1 and Lip-R1+1. As shown in Figure 5, the lip-gene-amplified product was still present after 100 generations, which indicated that the foreign gene lip was stable. The recombinant strain #6 is henceforth referred to as ZHMX4 and is used for further analysis.

3.3. Expression of Recombinant Lignin Peroxidase Protein

The positive recombinant strain ZHMX4 was cultured for protein expression. SDS-PAGE analysis of the ZHMX4 culture supernatant demonstrated a significant protein band of approximately 38 kDa, which was consistent with the expected molecular weight of the lip-gene-encoded protein (Figure 6). As expected, there was no corresponding protein band in the culture supernatant of the C. jadinii strain. This indicated that lignin peroxidase was expressed by the lip gene integrated into C. jadinii.

3.4. Measuring the Enzyme Activity of Recombinant Lignin Peroxidase

P. chrysosporium and the recombinant strain ZHMX4 cultures were tested to determine LiP activity after different culture periods. As shown in Figure 7, the foreign gene lip expressed LiP in C. jadinii. In the first two days of culturing, ZHMX4 secreted negligible amounts of LiP. LiP activity was first noted in the extracellular fluid at 72 h. Under the experimental conditions in a shaking incubator, LiP achieved maximum activity at 96 h, at 68.52 U/L, which was 16-fold higher than that of the parent strain P. chrysosporium. Subsequently, the enzyme activity began to gradually decrease.

3.5. Phenotype Profiling with the Biolog MicroStation™ System

Biolog’s patented technology uses each microbe’s ability to use particular carbon sources or chemical sensitivity assays to produce a unique pattern or “Phenotypic Fingerprint” for that microbe. A microorganism respires when it begins to use the carbon sources in certain wells of the MicroPlate, which reduces a tetrazolium redox dye, and those wells change color to purple. The change in chromaticity across the first three rows of the plate indicates the oxidation of carbon sources by the microorganisms, and a change in turbidity across the last five rows shows the utilization of the carbon sources. The end result is a pattern of colored wells on the MicroPlate that is characteristic of that microorganism. All necessary nutrients and biochemicals are prefilled and dried into the 96 wells of the MicroPlate.

YT MicroPlates containing 94 different carbon sources (Biolog MicroStation™ System) were used to determine the phenotype profiles of the ZHMX4 and C. jadinii (Figure 8). Compared with the host strain C. jadinii, the metabolic characteristics of the engineered strain showed obvious changes. ZHMX4 had higher metabolic utilization of D-cellobiose, maltose, maltotriose, N-acetyl-D-glucosamine and-D-glucose. The results provide an experimental basis to further optimize the medium of ZHMX4.

4. Discussion

LiP was the first lignin degradation enzyme identified within the extracellular enzymes secreted by P. chrysosporium. It is the key functional enzyme for lignin degradation and has great commercial value and broad application prospects. However, the LiP produced by fungi in nature has shown some disadvantages, such as high nutritional requirements, low yields and low enzyme activity, which to a great extent hinders the application of LiP for industrial purposes. The heterologous expression of LiP has previously been explored using various hosts. In particular, the heterologous expression of LiP in baculovirus expression systems has been reported but with low enzyme activity detected in the growth medium [31]. In an Escherichia coli expression system, P. chrysosporium LiP was expressed as inactive inclusion bodies, although subsequent activation was obtained in vitro [32,33]. LiP was also expressed in an Aspergillus niger expression system, but extracellular LiP activity produced from this expression system was weak [34]. Meanwhile, LiP expressed in the yeast Pichia expression system [19,30] has also been reported, but Pichia is not a food-grade yeast and induction of expression from a foreign gene expression is driven by methanol, which is not acceptable by food and feed industries.

C. jadinii is a promising industrial strain and has been certified as food-grade yeast by the FDA. It can be directly used as a safe single-cell protein in feed additives and can also be directly used in the production of enzyme preparations. The fermentation broth does not need to be separated and purified, which is time-saving and economical. Therefore, genetic modification of C. jadinii provides the strain with broad application prospects. For example, in the silage industry, the use of safe food-grade strains (such as C. jadinii) as expression systems for improvement and application is particularly exciting. The processing of silage relies on a carbon source metabolic pathway; therefore, the C. jadinii expression system is an attractive option to express the lignin-degrading enzyme, lignin peroxidase.

In this study, the lip gene of white-rot fungus (P. chrysosporium) was cloned, and heterologously expressed in the food-grade yeast, C. jadinii, for the first time. The recombinant strain ZHMX4 expressing LiP was constructed, and its genetic stability and enzyme activity were evaluated. The prokaryotic DNA sequence from the homologous integrated expression vector was deleted before transformation into C. jadinii. All the genetic elements of the homologous integrated DNA were taken from the probiotic C. jadinii and the non-toxic and harmless fungi P. chrysosporium. There were no antibiotic resistance genes; no drift, diffusion and integration of resistance genes and no other toxic protein genes to eliminate any potential harm to the environment or human and animal safety. This would enable the product to reach the food-grade level and be added directly to food and feed. ZHMX4 still retained the inserted gene after 100 generations, indicating that the foreign gene was preserved and maintained high genetic stability even after multiple rounds of subculturing. The enzyme activity assay also confirmed that the lip gene was inserted into the chromosome of C. jadinii and could express active LiP. Phenotypic analysis showed obvious changes in the metabolic characteristics of ZHMX4 compared to C. jadinii. Thus, ZHMX4 is a food-grade genetically engineered strain with great potential for lignin degradation.

We also carried out a series of experiments on the biological characteristics of ZHMX4 [35], including the determination of the lip gene copy number, lignin degradation ability and transcriptome analysis. The results showed that ZHMX4 copy number was quantified using Digital PCR and determined to be 5 copies/μL. The degradation rate of lignin reached 50.12%. A total of 6024 genes were identified in ZHMX4 when compared with C. jadinii, of which 583 genes were differentially expressed. There were 291 up-regulated genes and 292 down-regulated differentially expressed genes.

Although the production of foreign proteins using the C. jadinii expression system has been successfully demonstrated, the production yield of LiP is still insufficient to meet the needs of large-scale industry requirements. Currently, we are looking into increasing the level of enzyme production through optimizing key regulatory elements of the enzyme-coding gene (improving the promoter strength, optimizing the signal peptide), restructuring and optimizing the metabolic pathway of the engineered strain as well as optimizing the culture medium.

5. Conclusions

In this study, LiP was expressed using the C. jadinii expression system. PCR, sequence analysis and SDS-PAGE results indicate that the lip gene from P. chrysosporium was successfully cloned into C. jadinii. The LiP activity was also presented by recombinant strain ZHMX4. Phenotypic analysis showed obvious changes in the metabolic characteristics of ZHMX4 compared to C. jadinii. These findings are very useful for further academic studies, provide a new approach for the biodegradation of lignin and also furnish an alternative experimental platform for the food and feed industry.