Effect of Moderate-Intensity Endurance Exercise on Inflammatory Cytokines in Leukocytes of Dogs
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animals
2.2. Treadmill Adaptation for Dog Safety
2.3. Endurance Exercise Program
2.4. Hematology and Serum Biochemistry Parameter Analysis
2.5. Quantitative Reverse Transcription-Polymerase Chain Reaction (qRT-PCR)
2.6. Statistical Analyses
3. Results
3.1. Effect of Exercise on Hematological and Serum Biochemistry Parameters
3.2. Effect of Exercise on the Expression of Immune-Related Cytokine Genes
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Conflicts of Interest
Data Availability
References
- MacKinnon, M. ‘Sick as a dog’: Zooarchaeological evidence for pet dog health and welfare in the Roman world. World Archaeol. 2010, 42, 290–309. [Google Scholar] [CrossRef]
- Franklin, A.J.H. “Be[a]ware of the Dog”: A Post-Humanist Approach to Housing. Hous. Theory Soc. 2006, 23, 137–156. [Google Scholar] [CrossRef]
- Overall, K.L. Clinical Behavioral Medicine for Small Animals; Mosby-Year Book, Inc.: Maryland Heights, MO, USA, 1997. [Google Scholar]
- Westgarth, C.; Christley, R.M.; Marvin, G.; Perkins, E. I Walk My Dog Because It Makes Me Happy: A Qualitative Study to Understand Why Dogs Motivate Walking and Improved Health. Int. J. Environ. Res. Public Health 2017, 14, 936. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Medicine, A.C.o.S. ACSM’s Guidelines for Exercise Testing and Prescription; Lippincott Williams & Wilkins: Philadelphia, PA, USA, 2013. [Google Scholar]
- Radin, L.; Belic, M.; Bottegaro, N.B.; Hrastic, H.; Torti, M.; Vucetic, V.; Stanin, D.; Vrbanac, Z. Heart rate deflection point during incremental test in competitive agility border collies. Vet. Res. Commun. 2015, 39, 137–142. [Google Scholar] [CrossRef] [PubMed]
- Rovira, S.; Munoz, A.; Riber, C.; Benito, M. Heart rate, electrocardiographic parameters and arrhythmias during agility exercises in trained dogs. Rev. Med. Vet. Toulouse 2010, 161, 307–313. [Google Scholar]
- Lee, H.S.; Oh, H.J.; Lee, S.H.; Kim, J.W.; Kim, J.-H. Comparison of physiological and hematological responses to treadmill exercise in younger and older adult dogs. Korean J. Sport Sci. 2019, 30, 677–688. [Google Scholar] [CrossRef]
- Piccione, G.; Casella, S.; Panzera, M.; Giannetto, C.; Fazio, F. Effect of Moderate Treadmill Exercise on Some Physiological Parameters in Untrained Beagle Dogs. Exp. Anim. Tokyo 2012, 61, 511–515. [Google Scholar] [CrossRef] [Green Version]
- German, A.J.; Blackwell, E.; Evans, M.; Westgarth, C. Overweight dogs exercise less frequently and for shorter periods: Results of a large online survey of dog owners from the UK. J. Nutr. Sci. 2017, 6, e11. [Google Scholar] [CrossRef] [Green Version]
- Ostrowski, K.; Schjerling, P.; Pedersen, B.K. Physical activity and plasma interleukin-6 in humans—Effect of intensity of exercise. Eur. J. Appl. Physiol. 2000, 83, 512–515. [Google Scholar] [CrossRef]
- Duncan, G.E.; Anton, S.D.; Sydeman, S.; Newton, R.L.; Corsica, J.A.; Durning, P.E.; Ketterson, T.U.; Martin, A.D.; Limacher, M.C.; Perri, M.G. Prescribing exercise at varied levels of intensity and frequency—A randomized trial. Arch. Intern. Med. 2005, 165, 2362–2369. [Google Scholar] [CrossRef]
- Pedersen, B.K.; Toft, A.D. Effects of exercise on lymphocytes and cytokines. Brit. J. Sport Med. 2000, 34, 246–251. [Google Scholar] [CrossRef] [Green Version]
- Hasegawa, H.; Mizoguchi, I.; Chiba, Y.; Ohashi, M.; Xu, M.L.; Yoshimoto, T. Expanding Diversity in Molecular Structures and Functions of the IL-6/IL-12 Heterodimeric Cytokine Family. Front. Immunol. 2016, 7, 479. [Google Scholar] [CrossRef] [Green Version]
- Hung, Y.-L.; Suzuki, K. The pattern recognition receptors and lipopolysaccharides (LPS)-induced systemic inflammation. Int. J. Res. Stud. Med. Health Sci. 2017, 2, 1–7. [Google Scholar]
- Suzuki, K. Cytokine Response to Exercise and Its Modulation. Antioxidants 2018, 7, 17. [Google Scholar] [CrossRef] [Green Version]
- Nemzek, J.A.; Agrodnia, M.D.; Hauptman, J.G. Breed-specific pro-inflammatory cytokine production as a predisposing factor for susceptibility to sepsis in the dog. J. Vet. Emerg. Crit. Care 2007, 17, 368–372. [Google Scholar] [CrossRef]
- Kingsnorth, A.J.G. Role of cytokines and their inhibitors in acute pancreatitis. Gut 1997, 40, 1. [Google Scholar] [CrossRef] [Green Version]
- Chen, Y.W.; Li, Y.T.; Chen, Y.C.; Li, Z.Y.; Hung, C.H. Exercise Training Attenuates Neuropathic Pain and Cytokine Expression After Chronic Constriction Injury of Rat Sciatic Nerve. Anesth. Analg. 2012, 114, 1330–1337. [Google Scholar] [CrossRef] [PubMed]
- De Gonzalo-Calvo, D.; Davalos, A.; Montero, A.; Garcia-Gonzalez, A.; Tyshkovska, I.; Gonzalez-Medina, A.; Soares, S.M.A.; Martinez-Camblor, P.; Casas-Agustench, P.; Rabadan, M.; et al. Circulating inflammatory miRNA signature in response to different doses of aerobic exercise. J. Appl. Physiol. 2015, 119, 124–134. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wadley, A.J.; Chen, Y.W.; Lip, G.Y.; Fisher, J.P.; Aldred, S. Low volume-high intensity interval exercise elicits antioxidant and anti-inflammatory effects in humans. J. Sports Sci. 2016, 34, 1–9. [Google Scholar] [CrossRef]
- Koh, Y.; Park, K.S. Responses of inflammatory cytokines following moderate intensity walking exercise in overweight or obese individuals. J. Exerc. Rehabil. 2017, 13, 472–476. [Google Scholar] [CrossRef]
- Nieman, D.C.; Henson, D.A.; Austin, M.D.; Brown, V.A. Immune response to a 30-minute walk. Med. Sci. Sport Exer. 2005, 37, 57–62. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Karlsson, I.; Hagman, R.; Johannisson, A.; Wang, L.; Karlstam, E.; Wernersson, S. Cytokines as Immunological Markers for Systemic Inflammation in Dogs with Pyometra. Reprod. Domest. Anim. 2012, 47, 337–341. [Google Scholar] [CrossRef] [PubMed]
- Piantedosi, D.; Di Loria, A.; Guccione, J.; De Rosa, A.; Fabbri, S.; Cortese, L.; Carta, S.; Ciaramella, P. Serum biochemistry profile, inflammatory cytokines, adipokines and cardiovascular findings in obese dogs. Vet. J. 2016, 216, 72–78. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2− ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Ra, K.; Oh, H.J.; Kim, G.A.; Kang, S.K.; Ra, J.C.; Lee, B.C. High Frequency of Intravenous Injection of Human Adipose Stem Cell Conditioned Medium Improved Embryo Development of Mice in Advanced Maternal Age through Antioxidant Effects. Animals 2020, 10, 978. [Google Scholar] [CrossRef]
- Ferasin, L.; Marcora, S. A pilot study to assess the feasibility of a submaximal exercise test to measure individual response to cardiac medication in dogs with acquired heart failure. Vet. Res. Commun. 2007, 31, 725–737. [Google Scholar] [CrossRef]
- Lee, H.S.; Lee, S.H.; Kim, J.W.; Lee, Y.S.; Lee, B.C.; Oh, H.J.; Kim, J.H. Development of Novel Continuous and Interval Exercise Programs by Applying the FITT-VP Principle in Dogs. Sci. World J. 2020, 2020, 3029591. [Google Scholar] [CrossRef]
- Cerqueira, J.A.; Restan, W.A.Z.; Fonseca, M.G.; Catananti, L.A.; de Almeida, M.L.M.; Feringer, W.H.; Pereira, G.T.; Carciofi, A.C.; Ferraz, G.D. Intense exercise and endurance-training program influence serum kinetics of muscle and cardiac biomarkers in dogs. Res. Vet. Sci. 2018, 121, 31–39. [Google Scholar] [CrossRef]
- Lee, H.S.; Kim, J.H.; Oh, H.J.; Kim, J.H.J.A. Effects of Interval Exercise Training on Serum Biochemistry and Bone Mineral Density in Dogs. Animals 2021, 11, 2528. [Google Scholar] [CrossRef]
- Lee, C.D.; Folsom, A.R.; Nieto, F.J.; Chambless, L.E.; Shahar, E.; Wolfe, D.A. White blood cell count and incidence of coronary heart disease and ischemic stroke, and mortality from cardiovascular disease in African-American and white men and women: The Atherosclerosis Risk in Communities Study. Circulation 2001, 103, 1357–1358. [Google Scholar]
- Lippi, G.; Bassi, A.; Guidi, G.; Zatti, M. Relation between regular aerobic physical exercise and inflammatory markers. Am. J. Cardiol. 2002, 90, 820. [Google Scholar] [CrossRef]
- Mccarthy, D.A.; Dale, M.M. The Leukocytosis of Exercise—A Review and Model. Sports Med. 1988, 6, 333–363. [Google Scholar] [CrossRef]
- Perna, F.M.; Schneiderman, N.; LaPerriere, A. Psychological stress, exercise and immunity. Int. J. Sports Med. 1997, 18, S78–S83. [Google Scholar] [CrossRef] [PubMed]
- Hoffman-Goetz, L.; Pervaiz, N.; Packer, N.; Guan, J. Freewheel training decreases pro- and increases anti-inflammatory cytokine expression in mouse intestinal lymphocytes. Brain Behav. Immun. 2010, 24, 1105–1115. [Google Scholar] [CrossRef] [PubMed]
- Lin, C.L.; Wang, J.S.; Fu, T.C.; Hsu, C.C.; Huang, Y.C. Hypoxic Exercise Training Elevates Erythrocyte Aggregation. Appl Sci. 2021, 11, 6038. [Google Scholar] [CrossRef]
- Wierzba, T.H.; Olek, R.A.; Fedeli, D.; Falcioni, G. Lymphocyte DNA Damage in Rats Challenged with a Single Bout of Strenuous Exercise. J. Physiol. Pharmacol. 2006, 57, 115–131. [Google Scholar] [PubMed]
- Brines, R.; Hoffman-Goetz, L.; Pedersen, B.K. Can you exercise to make your immune system fitter? Immunol. Today 1996, 17, 252–254. [Google Scholar] [CrossRef]
- Horn, P.L.; Pyne, D.B.; Hopkins, W.G.; Barnes, C.J. Lower white blood cell counts in elite athletes training for highly aerobic sports. Eur. J. Appl. Physiol. 2010, 110, 925–932. [Google Scholar] [CrossRef] [PubMed]
- Shek, P.N.; Shephard, R.J. Physical exercise as a human model of limited inflammatory response. Can. J. Physiol. Pharm. 1998, 76, 589–597. [Google Scholar] [CrossRef]
- Suzuki, K.; Totsuka, M.; Nakaji, S.; Yamada, M.; Kudoh, S.; Liu, Q.; Sugawara, K.; Yamaya, K.; Sato, K. Endurance exercise causes interaction among stress hormones, cytokines, neutrophil dynamics, and muscle damage. J. Appl. Physiol. 1999, 87, 1360–1367. [Google Scholar] [CrossRef]
- Schnelle, A.N.; Barger, A.M. Neutropenia in dogs and cats: Causes and consequences. Vet. Clin. N. Am. Small Anim. Pr. 2012, 42, 111–122. [Google Scholar] [CrossRef]
- Barreda, D.R.; Hanington, P.C.; Belosevic, M. Regulation of myeloid development and function by colony stimulating factors. Dev. Comp. Immunol. 2004, 28, 509–554. [Google Scholar] [CrossRef]
- Parisotto, R.; Pyne, D.; Martin, D.; Gore, C.; Fallon, K.; Fricker, P.; Hahn, A. Neutropenia in elite male cyclists. Clin. J. Sport Med. 2003, 13, 303–305. [Google Scholar] [CrossRef]
- Abramson, J.; Wheeler, J. The Neutrophil: The Natural Immune System; Oxford University Press: Oxford, UK, 1993. [Google Scholar]
- Mayadas, T.N.; Cullere, X.; Lowell, C.A. The Multifaceted Functions of Neutrophils. Annu Rev. Pathol. Mech. 2014, 9, 181–218. [Google Scholar] [CrossRef] [Green Version]
- Maeda, K.; Malykhin, A.; Teague-Weber, B.N.; Sun, X.H.; Farris, A.D.; Coggeshall, K.M. Interleukin-6 aborts lymphopoiesis and elevates production of myeloid cells in systemic lupus erythematosus-prone B6.Sle1.Yaa animals. Blood 2009, 113, 4534–4540. [Google Scholar] [CrossRef]
- Baldridge, M.T.; King, K.Y.; Boles, N.C.; Weksberg, D.C.; Goodell, M.A. Quiescent haematopoietic stem cells are activated by IFN-gamma in response to chronic infection. Nature 2010, 465, 793–799. [Google Scholar] [CrossRef] [PubMed]
- Pronk, C.J.H.; Veiby, O.P.; Bryder, D.; Jacobsen, S.E.W. Tumor necrosis factor restricts hematopoietic stem cell activity in mice: Involvement of two distinct receptors. J. Exp. Med. 2011, 208, 1563–1570. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mossadegh-Keller, N.; Sarrazin, S.; Kandalla, P.K.; Espinosa, L.; Stanley, E.R.; Nutt, S.; Moore, J.; Sieweke, M.H. M-CSF instructs myeloid lineage fate in single haematopoietic stem cells. Nat. Cell Biol. 2013, 497, 239–243. [Google Scholar] [CrossRef] [PubMed]
- Manz, M.G.; Boettcher, S. Emergency granulopoiesis. Nat. Rev. Immunol. 2014, 14, 302–314. [Google Scholar] [CrossRef]
- Cowland, J.B.; Borregaard, N. Granulopoiesis and granules of human neutrophils. Immunol. Rev. 2016, 273, 11–28. [Google Scholar] [CrossRef] [PubMed]
- Malinowski, K.; Shock, E.J.; Rochelle, P.; Kearns, C.F.; Guirnalda, P.D.; McKeever, K.H. Plasma beta-endorphin, cortisol and immune responses to acute exercise are altered by age and exercise training in horses. Equine Vet. J. Suppl 2006, 267–273. [Google Scholar] [CrossRef]
- Watson, H.G.; Meiklejohn, D.J. Leucopenia in professional football players. Brit. J. Haematol. 2001, 112, 826–827. [Google Scholar] [CrossRef] [PubMed]
- Peake, J.M.; Della Gatta, P.; Suzuki, K.; Nieman, D.C. Cytokine expression and secretion by skeletal muscle cells: Regulatory mechanisms and exercise effects. Exerc. Immunol. Rev. 2015, 21, 8–25. [Google Scholar]
- Tamassia, N.; Bianchetto-Aguilera, F.; Arruda-Silva, F.; Gardiman, E.; Gasperini, S.; Calzetti, F.; Cassatella, M.A. Cytokine production by human neutrophils: Revisiting the “dark side of the moon”. Eur. J. Clin. Investig. 2018, e12952. [Google Scholar] [CrossRef] [PubMed]
- Suzuki, K. Chronic Inflammation as an Immunological Abnormality and Effectiveness of Exercise. Biomolecules 2019, 9, 223. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Szabo, S.J.; Kim, S.T.; Costa, G.L.; Zhang, X.; Fathman, C.G.; Glimcher, L.H. A novel transcription factor, T-bet, directs Th1 lineage commitment. Cell 2000, 100, 655–669. [Google Scholar] [CrossRef] [Green Version]
- Gruenbacher, G.; Gander, H.; Rahm, A.; Nussbaumer, W.; Romani, N.; Thurnher, M. CD56+ human blood dendritic cells effectively promote TH1-type γδ T-cell responses. Blood J. Am. Soc. Hematol. 2009, 114, 4422–4431. [Google Scholar] [CrossRef] [PubMed]
- Steensberg, A.; van Hall, G.; Osada, T.; Sacchetti, M.; Saltin, B.; Pedersen, B.K. Production of interleukin-6 in contracting human skeletal muscles can account for the exercise-induced increase in plasma interleukin-6. J. Physiol. 2000, 529, 237–242. [Google Scholar] [CrossRef]
- Fischer, C.P.; Hiscock, N.J.; Penkowa, M.; Basu, S.; Vessby, B.; Kallner, A.; Sjoberg, L.B.; Pedersen, B.K. Supplementation with vitamins C and E inhibits the release of interleukin-6 from contracting human skeletal muscle. J. Physiol. 2004, 558, 633–645. [Google Scholar] [CrossRef]
- Pedersen, B.K.; Febbraio, M.A. Muscle as an endocrine organ: Focus on muscle-derived interleukin-6. Physiol Rev. 2008, 88, 1379–1406. [Google Scholar] [CrossRef] [Green Version]
- Harris, T.B.; Ferrucci, L.; Tracy, R.P.; Corti, M.C.; Wacholder, S.; Ettinger, W.H.; Heimovitz, H.; Cohen, H.J.; Wallace, R. Associations of elevated interleukin-6 and C-reactive protein levels with mortality in the elderly. Am. J. Med. 1999, 106, 506–512. [Google Scholar] [CrossRef]
- Bruunsgaard, H.; Ladelund, S.; Pedersen, A.N.; Schroll, M.; Jorgensen, T.; Pedersen, B.K. Predicting death from tumour necrosis factor-alpha and interleukin-6 in 80-year-old people. Clin. Exp. Immunol. 2003, 132, 24–31. [Google Scholar] [CrossRef]
- Ferrucci, L.; Corsi, A.; Lauretani, F.; Bandinelli, S.; Bartali, B.; Taub, D.D.; Guralnik, J.M.; Longo, D.L. The origins of age-related proinflammatory state. Blood 2005, 105, 2294–2299. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Johannsen, N.M.; Swift, D.L.; Johnson, W.D.; Dixit, V.D.; Earnest, C.P.; Blair, S.N.; Church, T.S. Effect of Different Doses of Aerobic Exercise on Total White Blood Cell (WBC) and WBC Subfraction Number in Postmenopausal Women: Results from DREW. PLoS ONE 2012, 7, e31319. [Google Scholar] [CrossRef]
- Lancaster, G.I.; Halson, S.L.; Khan, Q.; Drysdale, P.; Wallace, F.; Jeukendrup, A.E.; Drayson, M.T.; Gleeson, M. Effects of acute exhaustive exercise and chronic exercise training on type 1 and type 2 T lymphocytes. Exerc. Immunol.Rev. 2004, 10, 91–106. [Google Scholar] [PubMed]
- Ostrowski, K.; Rohde, T.; Asp, S.; Schjerling, P.; Pedersen, B.K. Pro-and anti-inflammatory cytokine balance in strenuous exercise in humans. J. Physiol. 1999, 515, 287–291. [Google Scholar] [CrossRef]
- Sugama, K.; Suzuki, K.; Yoshitani, K.; Shiraishi, K.; Kometani, T. Urinary excretion of cytokines versus their plasma levels after endurance exercise. Exerc. Immunol. Rev. 2013, 19, 29–48. [Google Scholar]
- Lu, J.; Zhang, H.L.; Yin, Z.Z.; Tu, Y.; Li, Z.G.; Zhao, B.X.; Guo, J.Y. Moxibustion Attenuates Inflammatory Response to Chronic Exhaustive Exercise in Rats. Int J. Sports Med. 2012, 33, 580–585. [Google Scholar] [CrossRef] [PubMed]
- Petersen, A.M.W.; Pedersen, B.K. The anti-inflammatory effect of exercise. J. Appl. Physiol. 2005, 98, 1154–1162. [Google Scholar] [CrossRef] [Green Version]
- Gokhale, R.; Chandrashekara, S.; Vasanthakumar, K.C. Cytokine response to strenuous exercise in athletes and non-athletes—An adaptive response. Cytokine 2007, 40, 123–127. [Google Scholar] [CrossRef]
- Keller, C.; Keller, P.; Giralt, M.; Hidalgo, J.; Pedersen, B.K. Exercise normalises overexpression of TNF-alpha in knockout mice. Biochem. Bioph. Res. Co. 2004, 321, 179–182. [Google Scholar] [CrossRef]
- Paolucci, E.M.; Loukov, D.; Bowdish, D.M.E.; Heisz, J.J. Exercise reduces depression and inflammation but intensity matters. Biol. Psychol. 2018, 133, 79–84. [Google Scholar] [CrossRef] [PubMed]
- Ibfelt, T.; Petersen, E.W.; Bruunsgaard, H.; Sandmand, M.; Pedersen, B.K. Exercise-induced change in type 1 cytokine-producing CD8(+) T cells is related to a decrease in memory T cells. J. Appl. Physiol. 2002, 93, 645–648. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tan, K.S.; Nackley, A.G.; Satterfield, K.; Maixner, W.; Diatchenko, L.; Flood, P.M. β2 adrenergic receptor activation stimulates pro-inflammatory cytokine production in macrophages via PKA-and NF-κB-independent mechanisms. Cell Signal. 2007, 19, 251–260. [Google Scholar] [CrossRef] [PubMed]
- Moates, J.M.; Lacy, D.B.; Goldstein, R.E.; Cherrington, A.D.; Wasserman, D.H. Metabolic Role of the Exercise-Induced Increment in Epinephrine in the Dog. Am. J. Physiol. 1988, 255, E428–E436. [Google Scholar] [CrossRef] [PubMed]
- Steensberg, A.; Toft, A.D.; Bruunsgaard, H.; Sandmand, M.; Halkjaer-Kristensen, J.; Pedersen, B.K. Strenuous exercise decreases the percentage of type 1 T cells in the circulation. J. Appl. Physiol. 2001, 91, 1708–1712. [Google Scholar] [CrossRef] [Green Version]
- Marshall, G.D.; Agarwal, S.K. Stress, immune regulation, and immunity: Applications for asthma. Allergy Asthma Proc. 2000, 21, 241–246. [Google Scholar] [CrossRef] [PubMed]
- Spellberg, B.; Edwards, J.E. Type 1 type 2 immunity in infectious diseases. Clin. Infect. Dis. 2001, 32, 76–102. [Google Scholar] [CrossRef] [PubMed]
- Witkowska-Pilaszewicz, O.; Baska, P.; Czopowicz, M.; Zmigrodzka, M.; Szarska, E.; Szczepaniak, J.; Nowak, Z.; Winnicka, A.; Cywinska, A. Anti-Inflammatory State in Arabian Horses Introduced to the Endurance Training. Animals 2019, 9, 616. [Google Scholar] [CrossRef] [Green Version]
- Volpin, G.; Cohen, M.; Assaf, M.; Meir, T.; Katz, R.; Pollack, S. Cytokine Levels (IL-4, IL-6, IL-8 and TGF beta) as Potential Biomarkers of Systemic Inflammatory Response in Trauma Patients. Int. Orthop. 2014, 38, 1303–1309. [Google Scholar] [CrossRef] [Green Version]
- Hart, P.H.; Vitti, G.F.; Burgess, D.R.; Whitty, G.A.; Piccoli, D.S.; Hamilton, J.A. Potential Antiinflammatory Effects of Interleukin-4—Suppression of Human Monocyte Tumor Necrosis Factor-Alpha, Interleukin-1, and Prostaglandin-E2. Proc. Natl. Acad. Sci. USA 1989, 86, 3803–3807. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zamani, A.; Salehi, I.; Alahgholi-Hajibehzad, M.J. Moderate exercise enhances the production of interferon-γ and interleukin-12 in peripheral blood mononuclear cells. Immune Netw. 2017, 17, 186–191. [Google Scholar] [CrossRef] [Green Version]
- Pedersen, B.K.; Steensberg, A.; Fischer, C.; Keller, C.; Ostrowski, K.; Schjerling, P. Exercise and cytokines with particular focus on muscle-derived IL-6. Exerc. Immunol. Rev. 2001, 7, 18–31. [Google Scholar] [PubMed]
- La Gerche, A.; Inder, W.J.; Roberts, T.J.; Brosnan, M.J.; Heidbuchel, H.; Prior, D.L. Relationship between Inflammatory Cytokines and Indices of Cardiac Dysfunction following Intense Endurance Exercise. PLoS ONE 2015, 10, e0130031. [Google Scholar] [CrossRef]
- Felsburg, P.J. Overview of immune system development in the dog: Comparison with humans. Hum. Exp. Toxicol. 2002, 21, 487–492. [Google Scholar] [CrossRef] [PubMed]
Parameters (Unit) | Dogs |
---|---|
No. of Dogs | 6 |
Sex | Male |
Age (month) | 31.8 ± 15.8 |
Weight (kg) | 9.1 ± 1.3 |
Protocol | Session | 1 | 2 | 3 | 4 | 5 |
---|---|---|---|---|---|---|
1 | Time (min) | 5 | 5 | 5 | 5 | 5 |
Slope (%) | 0 | 1 | 1 | 2 | 2 | |
Speed (km/h) | 3.0 | 3.2 | 3.4 | 3.6 | 3.8 | |
2 | Time (min) | 5 | 5 | 5 | 5 | 5 |
Slope (%) | 1 | 2 | 2 | 3 | 3 | |
Speed (km/h) | 3.2 | 3.4 | 3.6 | 3.8 | 4.0 | |
3 | Time (min) | 5 | 5 | 5 | 5 | 5 |
Slope (%) | 2 | 3 | 3 | 4 | 4 | |
Speed (km/h) | 3.4 | 3.6 | 3.8 | 4.0 | 4.2 | |
4 | Time (min) | 5 | 5 | 5 | 5 | 5 |
Slope (%) | 3 | 4 | 4 | 5 | 5 | |
Speed (km/h) | 3.6 | 3.8 | 4.0 | 4.2 | 4.4 |
Gene | Primer Sequence (5′ → 3′) | Accession Number |
---|---|---|
β-actin | F: GCGCAAGTACTCTGTGTGGA | NM_001195845.2 |
R: ACATTTGCTGGAAGGTGGAC | ||
IFN-γ | F: CGCAAGGCGATAAATGAACT | NM_001003174.1 |
R: GACTCCTTTTCCGCTTCCTT | ||
TNF-α | F: CCCCAAGTGACAAGCCAGTA | NM_001003244.4 |
R: CTCAGCTTCGGGGTTTGCTA | ||
IL-4 | F: ACTCACCAGCACCTTTGTCC | NM_001003159.1 |
R: CTCGCTGTGAGGATGTTCAA | ||
IL-1β | F: TTGTGCACGGGGATGAAAGT | NM_001037971.1 |
R: TTGATGCCCAAGACCACAGG | ||
IL-6 | F: GCAGGAGATTCCAAGGATGA | NM_001003301.1 |
R: TTGTTTGCAGAGGTGAGTGG | ||
IL-8 | F: TCAGAACTTCGATGCCAGTG | AF048717.1 |
R: GGGCCACTGTCAATCACTCT | ||
IL-10 | F: CCTGTCGGAGATGATCCAGT | NM_001003077.1 |
R: GATGTCTGGGTCGTGGTTCT |
Parameters | Group | Pre-Exercise | 2 Weeks of Exercise | Post-Exercise |
---|---|---|---|---|
WBC (k/μL) | Control Exercise | 7810.0 ± 1120.6 8650.0 ± 3085.7 A | 7313.3 ± 2043.4 4916.6 ± 1097.9 B | 7543.3 ± 976.5 6806.6 ± 450.8 C |
AST (U/L) | Control Exercise | 37.6 ± 4.0 35.0 ± 2.6 A | 30.0 ± 1.0 31.0 ± 5.5 A | 30.6 ± 5.5 26.3 ± 2.0 B |
ALP (U/L) | Control Exercise | 35.3 ± 8.6 40.0 ± 4.5 A | 34.8 ± 2.0 44.0 ± 2.6 A | 30.3 ± 5.1 49.6 ± 7.0 B |
Glucose (mmol/L) | Control Exercise | 110.6 ± 7.0 110.3 ± 5.6 A | 110.3 ± 7.7 101.3 ± 7.5 B | 104.6 ± 6.6 108.0 ± 9.6 A |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lee, H.S.; Oh, H.J.; Ra, K.; Kim, J.-H. Effect of Moderate-Intensity Endurance Exercise on Inflammatory Cytokines in Leukocytes of Dogs. Appl. Sci. 2022, 12, 215. https://doi.org/10.3390/app12010215
Lee HS, Oh HJ, Ra K, Kim J-H. Effect of Moderate-Intensity Endurance Exercise on Inflammatory Cytokines in Leukocytes of Dogs. Applied Sciences. 2022; 12(1):215. https://doi.org/10.3390/app12010215
Chicago/Turabian StyleLee, Hae Sung, Hyun Ju Oh, Kihae Ra, and Jong-Hee Kim. 2022. "Effect of Moderate-Intensity Endurance Exercise on Inflammatory Cytokines in Leukocytes of Dogs" Applied Sciences 12, no. 1: 215. https://doi.org/10.3390/app12010215
APA StyleLee, H. S., Oh, H. J., Ra, K., & Kim, J.-H. (2022). Effect of Moderate-Intensity Endurance Exercise on Inflammatory Cytokines in Leukocytes of Dogs. Applied Sciences, 12(1), 215. https://doi.org/10.3390/app12010215