The Creation of a Multiallele Knockout Genotype in Rabbit Using CRISPR/Cas9 and Its Application in Translational Medicine
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethics Statement
2.2. Animals
2.3. Microinjection and Embryo Transfer
2.4. DNA Isolation from Blastocysts and Newborn Pups
2.5. Detection of Mutations in Embryos and Pups by PCR and Sequencing
2.6. T7 Endonuclease I Assay
2.7. Off-Target Assay
3. Results
3.1. Testing of Guides and Production of Founder Knockout Animals
3.2. Off-Target Analysis
3.3. Heritability of Deletions
4. Discussion
Author Contributions
Funding
Conflicts of Interest
References
- Yang, D.; Xu, J.; Zhu, T.; Fan, J.; Lai, L.; Zhang, J.; Chen, Y.E. Effective gene targeting in rabbits using RNA-guided Cas9 nucleases. J. Mol. Cell Biol. 2014, 6, 97–99. [Google Scholar] [CrossRef] [PubMed]
- Guo, R.; Wan, Y.; Xu, D.; Cui, L.; Deng, M.; Zhang, G.; Jia, R.; Zhou, W.; Wang, Z.; Deng, K.; et al. Generation and evaluation of Myostatin knock-out rabbits and goats using CRISPR/Cas9 system. Sci. Rep. 2016, 6, 29855. [Google Scholar] [CrossRef] [PubMed]
- Song, Y.; Xu, Y.; Deng, J.; Chen, M.; Lu, Y.; Wang, Y.; Yao, H.; Zhou, L.; Liu, Z.; Lai, L.; et al. CRISPR/Cas9-mediated mutation of tyrosinase (Tyr) 3′ UTR induce graying in rabbit. Sci. Rep. 2017, 7, 1–8. [Google Scholar] [CrossRef] [PubMed]
- Song, Y.; Sui, T.; Zhang, Y.; Wang, Y.; Chen, M.; Deng, J.; Chai, Z.; Lai, L.; Li, Z. Genetic deletion of a short fragment of glucokinase in rabbit by CRISPR/Cas9 leading to hyperglycemia and other typical features seen in MODY-2. Cell. Mol. Life Sci. 2020, 77, 3265–3277. [Google Scholar] [CrossRef]
- Yuan, T.; Zhong, Y.; Wang, Y.; Zhang, T.; Lu, R.; Zhou, M.; Lu, Y.; Yan, K.; Chen, Y.; Hu, Z.; et al. Generation of hyperlipidemic rabbit models using multiple sgRNAs targeted CRISPR/Cas9 gene editing system. Lipids Health Dis. 2019, 18, 1–9. [Google Scholar] [CrossRef]
- Sui, T.; Lau, Y.S.; Liu, D.; Liu, T.; Xu, L.; Gao, Y.; Lai, L.; Li, Z.; Han, R. A novel rabbit model of Duchenne muscular dystrophy generated by CRISPR/Cas9. DMM Dis. Model. Mech. 2018, 11, 1–9. [Google Scholar] [CrossRef]
- Li, H.; Li, Z.; Xiao, N.; Su, X.; Zhao, S.; Zhang, Y.; Cui, K.; Liu, Q.; Shi, D. Site-specific integration of rotavirus VP6 gene in rabbit β-casein locus by CRISPR/Cas9 system. Vitr. Cell. Dev. Biol.-Anim. 2019, 55, 586–597. [Google Scholar] [CrossRef]
- Yang, D.; Song, J.; Zhang, J.; Xu, J.; Zhu, T.; Wang, Z.; Lai, L.; Chen, Y.E. Identification and characterization of rabbit ROSA26 for gene knock-in and stable reporter gene expression. Sci. Rep. 2016, 6, 25161. [Google Scholar] [CrossRef]
- Liu, H.; Sui, T.; Liu, D.; Liu, T.; Chen, M.; Deng, J.; Xu, Y.; Li, Z. Multiple homologous genes knockout (KO) by CRISPR/Cas9 system in rabbit. Gene 2018, 647, 261–267. [Google Scholar] [CrossRef]
- Liu, Z.; Chen, M.; Chen, S.; Deng, J.; Song, Y.; Lai, L.; Li, Z. Highly efficient RNA-guided base editing in rabbit. Nat. Commun. 2018, 9, 1–10. [Google Scholar] [CrossRef]
- Yang, D.; Zhang, J.; Xu, J.; Zhu, T.; Fan, Y.; Fan, J.; Chen, Y.E. Production of apolipoprotein C-III knockout rabbits using zinc finger nucleases. J. Vis. Exp. 2013, 81, 1–7. [Google Scholar] [CrossRef] [PubMed]
- Lozano, W.M.; Arias-Mutis, O.J.; Calvo, C.J.; Chorro, F.J.; Zarzoso, M. Diet-induced rabbit models for the study of metabolic syndrome. Animals 2019, 9, 463. [Google Scholar] [CrossRef] [PubMed]
- Fan, J.; Kitajima, S.; Watanabe, T.; Xu, J.; Zhang, J.; Liu, E.; Chen, Y.E. Rabbit models for the study of human atherosclerosis: From pathophysiological mechanisms to translational medicine. Pharmacol. Ther. 2015, 146, 104–119. [Google Scholar] [CrossRef] [PubMed]
- Baumgartner, C.; Brandl, J.; Münch, G.; Ungerer, M. Rabbit models to study atherosclerosis and its complications—Transgenic vascular protein expression In Vivo. Prog. Biophys. Mol. Biol. 2016, 121, 131–141. [Google Scholar] [CrossRef] [PubMed]
- Bősze, Z.; Major, P.; Baczkó, I.; Odening, K.E.; Bodrogi, L.; Hiripi, L.; Varró, A. The potential impact of new generation transgenic methods on creating rabbit models of cardiac diseases. Prog. Biophys. Mol. Biol. 2016, 121, 123–130. [Google Scholar] [CrossRef]
- Koike, T.; Liang, J.; Wang, X.; Ichikawa, T.; Shiomi, M.; Liu, G.; Sun, H.; Kitajima, S.; Morimoto, M.; Watanabe, T.; et al. Overexpression of Lipoprotein Lipase in Transgenic Watanabe Heritable Hyperlipidemic Rabbits Improves Hyperlipidemia and Obesity. J. Biol. Chem. 2004, 279, 7521–7529. [Google Scholar] [CrossRef]
- Jolivet, G.; Braud, S.; DaSilva, B.; Passet, B.; Harscoët, E.; Viglietta, C.; Gautier, T.; Lagrost, L.; Daniel-Carlier, N.; Houdebine, L.M.; et al. Induction of body weight loss through RNAi- knockdown of APOBEC1 gene expression in transgenic rabbits. PLoS ONE 2014, 9, e106655. [Google Scholar] [CrossRef]
- Gonzalez-Bulnes, A.; Chavatte-Palmer, P. Contribution of Large Animals to Translational Research on Prenatal Programming of Obesity and Associated Diseases. Curr. Pharm. Biotechnol. 2017, 18, 541–551. [Google Scholar] [CrossRef]
- Osteil, P.; Moulin, A.; Santamaria, C.; Joly, T.; Jouneau, L.; Aubry, M.; Tapponnier, Y.; Archilla, C.; Schmaltz-Panneau, B.; Lecardonnel, J.; et al. A Panel of Embryonic Stem Cell Lines Reveals the Variety and Dynamic of Pluripotent States in Rabbits. Stem. Cell Rep. 2016, 7, 383–398. [Google Scholar] [CrossRef]
- Tancos, Z.; Nemes, C.; Polgar, Z.; Gocza, E.; Daniel, N.; Stout, T.A.E.; Maraghechi, P.; Pirity, M.K.; Osteil, P.; Tapponnier, Y.; et al. Generation of rabbit pluripotent stem cell lines. Theriogenology 2012, 78, 1774–1786. [Google Scholar] [CrossRef]
- Quan, L.; Chen, Y.; Song, J.; Yan, Q.; Zhang, Q.; Lai, S.; Fan, N.; Xin, J.; Zou, Q.; Lai, L. Establishment of a rabbit Oct4 promoter-based EGFP reporter system. PLoS ONE 2014, 9, e109728. [Google Scholar] [CrossRef][Green Version]
- Zhang, S.; Xiang, S.; Yang, J.; Shi, J.; Guan, X.; Jiang, J.; Wei, Y.; Luo, C.; Shi, D.; Lu, F. Optimization of parthenogenetic activation of rabbit oocytes and development of rabbit embryo by somatic cell nuclear transfer. Reprod Domest. Anim. 2019, 54, 258–269. [Google Scholar] [CrossRef]
- Barman, A.; Deb, B.; Chakraborty, S. A glance at genome editing with CRISPR–Cas9 technology. Curr. Genet. 2020, 66, 447–462. [Google Scholar] [CrossRef] [PubMed]
- Adli, M. The CRISPR tool kit for genome editing and beyond. Nat. Commun. 2018, 9, 1–13. [Google Scholar] [CrossRef] [PubMed]
- Sakurai, T.; Watanabe, S.; Kamiyoshi, A.; Sato, M.; Shindo, T. A single blastocyst assay optimized for detecting CRISPR/Cas9 system-induced indel mutations in mice. BMC Biotechnol. 2014, 14, 1–11. [Google Scholar] [CrossRef] [PubMed]
- Kleinstiver, B.P.; Pattanayak, V.; Prew, M.S.; Tsai, S.Q.; Nguyen, N.T.; Zheng, Z.; Keith Joung, J. High-fidelity CRISPR-Cas9 variants with undetectable genome- wide off-targets. Nature 2016, 528, 490–495. [Google Scholar] [CrossRef]
- Anderson, K.R.; Haeussler, M.; Watanabe, C.; Janakiraman, V.; Lund, J.; Modrusan, Z.; Stinson, J.; Bei, Q.; Buechler, A.; Yu, C.; et al. CRISPR off-target analysis in genetically engineered rats and mice. Nat. Methods 2018, 15, 512–514. [Google Scholar] [CrossRef]
- Mehravar, M.; Shirazi, A.; Nazari, M.; Banan, M. Mosaicism in CRISPR/Cas9-mediated genome editing. Dev. Biol. 2019, 445, 156–162. [Google Scholar] [CrossRef]
- Yen, S.-T.; Zhang, M.; Deng, J.M.; Usman, S.J.; Smith, C.N.; Parker-Thornburg, J.; Swinton, P.G.; Martin, J.F.; Behringer, R.R. Somatic mosaicism and allele complexity induced by CRISPR/Cas9 RNA injections in mouse zygotes. Dev. Biol. 2014, 393, 3–9. [Google Scholar] [CrossRef]
- Mizuno, S.; Thi, T.; Dinh, H.; Kato, K. Simple generation of albino C57BL/6J mice with G291T mutation in the tyrosinase gene by the CRISPR/Cas9 system. Mamm. Genome 2014, 25, 327–334. [Google Scholar] [CrossRef]
- Sultana, F.; Hatori, M.; Shimozawa, N.; Ebisawa, T.; Sankai, T. Continuous observation of rabbit preimplantation embryos in vitro by using a culture device connected to a microscope. J. Am. Assoc. Lab. Anim. Sci. 2009, 48, 52–56. [Google Scholar] [PubMed]
- Hiripi, L.; Negre, D.; Cosset, F.L.; Kvell, K.; Czömpöly, T.; Baranyi, M.; Gócza, E.; Hoffmann, O.; Bender, B.; Bosze, Z. Transgenic rabbit production with simian immunodeficiency virus-derived lentiviral vector. Transgenic Res. 2010, 19, 799–808. [Google Scholar] [CrossRef] [PubMed]
- Atashi, F.; Modarressi, A.; Pepper, M.S. The role of reactive oxygen species in mesenchymal stem cell adipogenic and osteogenic differentiation: A review. Stem Cells Dev. 2015, 24, 1150–1163. [Google Scholar] [CrossRef] [PubMed]
- Yao, M.I.N.; Gao, F.; Wang, X.; Shi, Y.; Liu, S.; Duan, H. Nox4 is involved in high glucose—induced apoptosis in renal tubular epithelial cells via Notch pathway. Mol. Med. Rep. 2017, 15, 4319–4325. [Google Scholar] [CrossRef]
- Grandvaux, N.; Soucy-faulkner, A.; Fink, K. Innate host defense: Nox and Duox on phox’s tail. Biochimie 2007, 89, 1113–1122. [Google Scholar] [CrossRef]
- Feng, C.; Zhang, Y.; Yang, M.; Lan, M.; Liu, H.; Huang, B.; Zhou, Y. Oxygen-Sensing Nox4 Generates Genotoxic ROS to Induce Premature Senescence of Nucleus Pulposus Cells through MAPK and NF- κ B Pathways. Oxid. Med. Cell Longev. 2017, 2017, 7426458. [Google Scholar] [CrossRef]
- Liu, C.; Hua, N.; Fu, X.; Pan, Y.; Li, B.; Li, X. Metformin Regulates the Expression of SK2 and SK3 in the Atria of Rats with Type 2 Diabetes Mellitus Through the NOX4 / p38MAPK Signaling Pathway. Cardiovasc. Pharmacol. 2018, 72, 205–213. [Google Scholar] [CrossRef]
- Song, S.; Xiao, X.; Guo, D.; Mo, L.; Bu, C.; Ye, W.; Den, Q.; Liu, S.; Yang, X. Phytomedicine Protective effects of Paeoni florin against AOPP-induced oxidative injury in HUVECs by blocking the ROS-HIF-1 α / VEGF pathway. Phytomedicine 2017, 34, 115–126. [Google Scholar] [CrossRef]
- Yang, Q.; Wu, F.; Wang, J.; Gao, L.; Wei, B.; Zhou, L.; Wen, J.; Ma, T. Nox4 in Renal Diseases: An Update. Free Radic. Biol. Med. 2018, 124, 466–472. [Google Scholar] [CrossRef]
- Radermacher, K.A.; Wingler, K.; Langhauser, F.; Altenho, S.; Kleikers, P.; Hermans, J.J.R.; Hrabe, M.; Kleinschnitz, C.; Schmidt, H.H.H.W. Neuroprotection After Stroke by Targeting NOX4 As a Source of Oxidative Stress. Antioxid. Redox. Signal. 2013, 18, 1418–1427. [Google Scholar] [CrossRef]
- Meng, Y.; Li, T.; Zhou, G.-S.; Chen, Y.; Yu, C.-H.; Pang, M.-X.; Li, W.; Li, Y.; Zhang, W.-Y.; Li, X. The angiotensin-converting enzyme 2/angiotensin (1-7)/Mas axis protects against lung fibroblast migration and lung fibrosis by inhibiting the NOX4-derived ROS-mediated RhoA/Rho kinase pathway. Antioxid. Redox Signal. 2015, 22, 241–258. [Google Scholar] [CrossRef] [PubMed]
- Nlandu Khodo, S.; Dizin, E.; Sossauer, G.; Szanto, I.; Martin, P.-Y.; Feraille, E.; Krause, K.H.; de Seigneux, S. NADPH-oxidase 4 protects against kidney fibrosis during chronic renal injury. J. Am. Soc. Nephrol. 2012, 23, 1967–1976. [Google Scholar] [CrossRef] [PubMed]
- Lozhkin, A.; Vendrov, A.E.; Pan, H.; Wickline, S.A.; Nageswara, R.; Runge, M.S. NADPH oxidase 4 regulates vascular inflammation in aging and atherosclerosis. J. Mol. Cell Cardiol. 2017, 102, 10–21. [Google Scholar] [CrossRef] [PubMed]
- Schürmann, C.; Rezende, F.; Kruse, C.; Yasar, Y.; Löwe, O.; Fork, C.; Van De Sluis, B.; Bremer, R.; Weissmann, N.; Shah, A.M.; et al. The NADPH oxidase Nox4 has anti-atherosclerotic functions. Eur. Heart J. 2015, 36, 3447–3456. [Google Scholar] [CrossRef]
- Fan, J.; Chen, Y.; Yan, H.; Niimi, M.; Wang, Y.; Liang, J. Principles and Applications of Rabbit Models for Atherosclerosis Research. J. Atheroscler. Thromb. 2018, 25, 213–220. [Google Scholar] [CrossRef]
- Faggion, C.M. Animal research as a basis for clinical trials. Eur. J. Oral Sci. 2015, 123, 61–64. [Google Scholar] [CrossRef]
- Bailey, J.; Thew, M.; Balls, M. An Analysis of the Use of Animal Models in Predicting Human Toxicology and Drug Safety. Altern. Lab. Anim. 2014, 42, 181–199. [Google Scholar] [CrossRef]
- Box, R.J.; Spielmann, H. Use of the dog as non-rodent test species in the safety testing schedule associated with the registration of crop and plant protection products (pesticides): Present status. Arch. Toxicol. 2005, 79, 615–626. [Google Scholar] [CrossRef]
- Gilmore, K.M.; Greer, K.A. Why is the dog an ideal model for aging research? Exp. Gerontol. 2015, 71, 14–20. [Google Scholar] [CrossRef]
- Burkhardt, A.M.; Zlotnik, A. Translating translational research: Mouse models of human disease. Cell. Mol. Immunol. 2013, 10, 373–374. [Google Scholar] [CrossRef]
- Perlman, R.L. Mouse models of human disease an evolutionary perspective. Evol. Med. Public Health 2016, 2016, 170–176. [Google Scholar] [CrossRef] [PubMed]
- Ivics, Z.; Hiripi, L.; Hoffmann, O.I.; Mátés, L.; Yau, T.Y.; Bashir, S.; Zidek, V.; Landa, V.; Geurts, A.; Pravenec, M.; et al. Germline transgenesis in rabbits by pronuclear microinjection of Sleeping Beauty transposons. Nat. Protoc. 2014, 9, 794–809. [Google Scholar] [CrossRef] [PubMed]
- Sambrook, J.; Russell, D.W. Molecular Cloning: A Laboratory Manual, 4th ed.; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, NY, USA, 2012; ISBN 978-1-936113-42-2. [Google Scholar]
- Imanishi, M.; Negi, S.; Sugiura, Y. Non-FokI-based zinc finger nucleases. Methods Mol. Biol. 2010, 649, 337–349. [Google Scholar] [CrossRef] [PubMed]
- Plecitá-hlavatá, L.; Jab, M.; Holendová, B.; Tauber, J.; Berková, Z.; Cahová, M.; Schröder, K.; Brandes, R.P.; Siemen, D.; Je, P. Glucose-Stimulated Insulin Secretion Fundamentally Requires H2O2 Signaling by NADPH Oxidase 4. Diabetes 2020, 69, 1341–1354. [Google Scholar] [CrossRef] [PubMed]
- Wan, S.; Nie, Y.; Zhang, Y.; Huang, C.; Zhu, X. Gut Microbial Dysbiosis Is Associated with Profibrotic Factors in Liver Fibrosis Mice. Front. Cell. Infect. Microbiol. 2020, 10, 1–12. [Google Scholar] [CrossRef] [PubMed]
- Jiang, J.; Huang, K.; Xu, S.; Garcia, J.G.N.; Wang, C.; Cai, H. Redox Biology Targeting NOX4 alleviates sepsis-induced acute lung injury via attenuation of redox-sensitive activation of CaMKII/ERK1/2/MLCK and endothelial cell barrier dysfunction. Redox Biol. 2020, 36, 101638. [Google Scholar] [CrossRef] [PubMed]
- Chakrabarti, A.M.; Henser-brownhill, T.; Monserrat, J.; Poetsch, A.R.; Luscombe, N.M.; Scaffidi, P. Target-Specific Precision of CRISPR-Mediated Genome Editing. Mol. Cell 2019, 73, 699–713. [Google Scholar] [CrossRef]
- Labun, K.; Guo, X.; Chavez, A.; Church, G.; Gagnon, J.A.; Valen, E. Accurate analysis of genuine CRISPR editing events with ampliCan. Genome Res. 2019, 29, 843–847. [Google Scholar] [CrossRef]
- Shin, H.Y.; Wang, C.; Lee, H.K.; Yoo, K.H.; Zeng, X.; Kuhns, T.; Yang, C.M.; Mohr, T.; Liu, C.; Hennighausen, L. CRISPR/Cas9 targeting events cause complex deletions and insertions at 17 sites in the mouse genome. Nat. Commun. 2017, 8, 15464. [Google Scholar] [CrossRef]
- Lamas-Toranzo, I.; Galiano-Cogolludo, B.; Cornudella-Ardiaca, F.; Cobos-Figueroa, J.; Ousinde, O.; Bermejo-Álvarez, P. Strategies to reduce genetic mosaicism following CRISPR-mediated genome edition in bovine embryos. Sci. Rep. 2019, 9, 14900. [Google Scholar] [CrossRef]
- Yan, Q.; Zhang, Q.; Yang, H.; Zou, Q.; Tang, C.; Fan, N. Generation of multi-gene knockout rabbits using the Cas9 / gRNA system. Cell Regen. 2014, 3, 1–11. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Honda, A.; Hirose, M.; Sankai, T.; Yasmin, L. Single-step generation of rabbits carrying a targeted allele of the tyrosinase gene using CRISPR / Cas9. Exp. Anim. 2015, 64, 31–37. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Lv, Q.; Yuan, L.; Deng, J.; Chen, M.; Wang, Y.; Zeng, J.; Li, Z.; Lai, L. Efficient Generation of Myostatin Gene Mutated Rabbit by CRISPR/Cas9. Sci. Rep. 2016, 6, 25029. [Google Scholar] [CrossRef] [PubMed]
- Song, Y.; Yuan, L.; Wang, Y.; Chen, M.; Deng, J.; Lv, Q.; Sui, T.; Li, Z.; Lai, L. Efficient dual sgRNA-directed large gene deletion in rabbit with CRISPR/Cas9 system. Cell. Mol. Life Sci. 2016, 73, 2959–2968. [Google Scholar] [CrossRef] [PubMed]
- Yuan, L.; Sui, T.; Chen, M.; Deng, J.; Huang, Y.; Zeng, J.; Lv, Q.; Song, Y.; Li, Z.; Lai, L. OPEN CRISPR / Cas9-mediated GJA8 knockout in rabbits recapitulates human congenital cataracts. Sci. Rep. 2016, 6, 22024. [Google Scholar] [CrossRef]
Primer | Sequence | Product Size (Base Pairs) |
---|---|---|
2. exon-forward | TTGCTTGGATTTCACCCTGC | 312 |
2. exon-reverse | AGTCTGGTGGCTAAGTCTGC | |
4. exon-forward | ACATCTCACCAACGTTTGA | 386 |
4. exon-reverse | TAGACAATCATATTTAAAC | |
2nd exon seq. primer-forward | CAACTAACAAAACTTGACGCC | 1059 |
2nd exon seq. primer-reverse | AAGCCACTGAAAAACACCC |
Off-Targets | Off-Target Sequence Compared to Target DNA | Chromosome | Location | Number of Mismatches | Primers |
---|---|---|---|---|---|
NOX4 2nd exon target site | TGGTGGAGGTAATGGTACTCNGG | chr1 | 127339745 | 0 | |
Off-target-1 | TGtTGGtGGTAATGGTACTtGGG | chr1 | 135497670 | 3 | forward AAGAGACAGGAGACAGGAAG reverse ATTAGGAAAGCAATGTGAGGG |
Off-target-2 | TGGTGGAGGTAATGGTgaTCGGG | chr10 | 31875932 | 2 | forward AAAGACAACCGAAAGGCAG reverse AGCATAATGAGATTAAGCCCAG |
Off-target-3 | TGGaGGAGGTAATGaTcCTCTGG | chr11 | 37138594 | 3 | forward ATGATGAGATGGAGGCAAGG reverse TGTGTGATTATTGGCGGAGA |
Off-target-4 | TGGTGGAGGTgATGGTgCTCAGG | chr14 | 81541288 | 2 | forward TGACCCTTAACAGTCCCTCC reverse CCTAAACCCCTACACCTACC |
Off-target-5 | TGaTGGAGGTAATGGTAtTtGGG | chr15 | 45312042 | 3 | forward AGGAAGAAAGTAGGGCCAGT reverse CTGCCCAGCTGAGTTGTAGT |
Off-target-6 | TGGTGGtGGTggTGGTACTCTGG | chr2 | 99798645 | 3 | forward GGGTGAACCAGCAGTAAAG reverse GTTCAGATAGACAGCCCCAG |
Off target-7 | TGGTGGAGaTAATGGgAtTCTGG | chr8 | 79971373 | 3 | forward AAGAAACGTGCCAGGGGATT reverse TTAACCCCTACGTCATGGCC |
Off target-8 | TGGTGtAGGgAATGGTACTCCGG | chr9 | 111235794 | 2 | forward GGTGTAATCCAGGAACAATGCT reverse CATGCCCCAGGACTGTAGAG |
Targeted Exon of NOX4 | Total/Mutant Blastocysts | Ratio |
---|---|---|
2nd exon | 11/2 | 18% |
4th exon | 18/3 | 16% |
Code of Founder Animal | Sex | Mutation | Consequence |
---|---|---|---|
#1 | ♂ | 7 bp deletion (GGTACTC) | early stop codon |
#2 | ♀ | 8 bp deletion (TGGTACTC) | early stop codon |
#3 | ♀ | 8 bp deletion (TGGTACTC) | early stop codon |
#4 | ♀ | 8 bp deletion (TGGTACTC) | early stop codon |
#5 | ♂ | allele A: 8 bp deletion (ACTCTGGC) | early stop codon |
allele B: 128 bp deletion | early stop codon | ||
allele C: 104 bp deletion in total | early stop codon |
Rabbit Subline | ∆128 | ∆8 | ∆104 | Wild-Type | Animals Born | ||||
---|---|---|---|---|---|---|---|---|---|
sex | ♀ | ♂ | ♀ | ♂ | ♀ | ♂ | ♀ | ♂ | |
number of animals | 7 | 3 | 9 | 5 | 2 | 1 | 1 | 0 | 28 |
ratio to total (%) | 25% | 11% | 32% | 18% | 7% | 3.50% | 3.50% | 0 | |
ratio of genotype to total (%) | 36% | 50% | 10% | 4% | |||||
sex ratio within genotype (%) | 70% | 30% | 64% | 36% | 67% | 33% | 100% | 0% | |
sex ratio (%) | ♀ | 19 | 68% | ||||||
♂ | 9 | 32% |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Pintér, T.; Geiszt, M.; Petheő, G.L.; Mihálffy, M.; Skoda, G.; Lipták, N.; Kerekes, A.; Bősze, Z.; Hiripi, L.; Bodrogi, L. The Creation of a Multiallele Knockout Genotype in Rabbit Using CRISPR/Cas9 and Its Application in Translational Medicine. Appl. Sci. 2020, 10, 8508. https://doi.org/10.3390/app10238508
Pintér T, Geiszt M, Petheő GL, Mihálffy M, Skoda G, Lipták N, Kerekes A, Bősze Z, Hiripi L, Bodrogi L. The Creation of a Multiallele Knockout Genotype in Rabbit Using CRISPR/Cas9 and Its Application in Translational Medicine. Applied Sciences. 2020; 10(23):8508. https://doi.org/10.3390/app10238508
Chicago/Turabian StylePintér, Tímea, Miklós Geiszt, Gábor L. Petheő, Máté Mihálffy, Gabriella Skoda, Nándor Lipták, Andrea Kerekes, Zsuzsanna Bősze, László Hiripi, and Lilla Bodrogi. 2020. "The Creation of a Multiallele Knockout Genotype in Rabbit Using CRISPR/Cas9 and Its Application in Translational Medicine" Applied Sciences 10, no. 23: 8508. https://doi.org/10.3390/app10238508
APA StylePintér, T., Geiszt, M., Petheő, G. L., Mihálffy, M., Skoda, G., Lipták, N., Kerekes, A., Bősze, Z., Hiripi, L., & Bodrogi, L. (2020). The Creation of a Multiallele Knockout Genotype in Rabbit Using CRISPR/Cas9 and Its Application in Translational Medicine. Applied Sciences, 10(23), 8508. https://doi.org/10.3390/app10238508