Next Article in Journal
Clinical Assessment of Dairy Goats’ Udder Health Using Infrared Thermography
Previous Article in Journal
Biochemical Mechanisms That Buffer the Effects of High Temperatures in the Sand-Dwelling Lizard Holbrookia propinqua
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Animals
Volume 15
Issue 5
10.3390/ani15050659
animals-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

The Molecular Monitoring of an Invasive Freshwater Fish, Brown Trout (Salmo trutta), Using Real-Time PCR Assay and Environmental Water Samples

by
Su-Hwan Kim
1,
Soo-In Lee
2,
Sang-Hun Lee
1,
So-Eun Jo
3 and
Keun-Yong Kim
3,*
1
Wetland Research Team, National Institute of Ecology, Seocheon 33657, Republic of Korea
2
Invasive Alien Species Team, National Institute of Ecology, Seocheon 33657, Republic of Korea
3
Genetic Analysis Team, AquaGenTech Co., Ltd., Busan 48228, Republic of Korea
*
Author to whom correspondence should be addressed.
Animals 2025, 15(5), 659; https://doi.org/10.3390/ani15050659
Submission received: 5 February 2025 / Revised: 13 February 2025 / Accepted: 19 February 2025 / Published: 24 February 2025
(This article belongs to the Section Aquatic Animals)
Browse Figures
Review Reports Versions Notes

Simple Summary

This study presents the development and application of a qPCR assay to monitor an invasive brown trout (Salmo trutta) in South Korea using environmental DNA (eDNA). The assay demonstrated high sensitivity and specificity, detecting S. trutta in various water samples downstream of the Soyang and Uiam Reservoirs. The results highlight the method’s potential as a non-invasive, efficient, and reliable tool for monitoring invasive fish species and mitigating their ecological impacts.

Abstract

Salmo trutta, commonly known as brown trout, is an invasive species that has established itself in various regions, including South Korea, where it poses ecological risks to native freshwater fish populations. To enable natural habitat restoration, S. trutta needs to be monitored, but traditional monitoring techniques are associated with several limitations. Therefore, in this study, we aimed to apply a sensitive and specific real-time PCR (qPCR) assay using a set of primers and a hydrolysis probe specific to the mitochondrial cytochrome b gene of S. trutta. Environmental DNA (eDNA) was extracted from river-water samples collected downstream of the Soyang Reservoir and around the Uiam Reservoir between January and March 2023. The qPCR assays successfully detected S. trutta eDNA in 11 of the 24 samples, with high concentrations found upstream and downstream of the Soyang River. Our results demonstrate the effectiveness of qPCR assay for the S. trutta detection in aquatic environments and highlight its potential for monitoring the spread of this species, especially in areas that are difficult to survey using traditional methods. This molecular approach offers a more efficient tool for S. trutta population management, mitigating its impact on native biodiversity.

1. Introduction

Salmo trutta Linnaeus, 1758, endemic to most of Europe and commonly referred to as brown trout, is a freshwater migratory species that spawns in riverbeds composed of gravel or sand with fast-flowing, cool, and oxygen-rich waters. This species exhibits a high degree of behavioral variability, with some populations being purely freshwater residents, whereas others are anadromous, known as sea trout, and migrate to the ocean before returning to rivers to spawn. This species is prized for its adaptability, thrives in a wide range of habitats, and is well-known for sport fishing [1,2].
Over the past few decades, S. trutta has been introduced to many regions outside its native range, including North America, Australia, and parts of Asia such as South Korea, for food consumption and recreational fishing [2,3,4,5,6,7]. As an aggressive predator and competitor, this alien species outcompetes native fish for food and habitat. It preys on native aquatic animals, disrupting natural aquatic ecosystems [2,5,6,7,8,9,10] and also hybridizes with native salmonids, reducing their genetic integrity and fitness, threatening their long-term viability, and destabilizing freshwater ecosystems [11,12,13]. Due to these ecological threats, S. trutta is listed among the “100 of the World’s Worst Invasive Alien Species” by the IUCN [14].
Although its introduction has not been recorded in South Korea, Park et al. [8] reported that S. trutta successfully established a sexually mature population downstream of the Soyang Reservoir in Chuncheon-si, Gangwon-do, South Korea. This area is enclosed by three reservoirs: Soyang Reservoir, which discharges water into the Soyang River and drains into the northeastern Uiam Reservoir; Paro Lake, which is connected to the Bukhan River and drains into the northwestern Uiam Reservoir; and the southern Uiam Reservoir, which discharges water into the Han River basin. As a result, the S. trutta population introduced into South Korea became landlocked. As a cold-water species, its optimal habitat temperature ranges between 12 and 19 °C; however, it is resilient and survives at temperatures up to 24.7 °C [15]. During summer, rivers in South Korea approach 30 °C, limiting the species’ ability to establish a wide distribution. Nevertheless, owing to hydroelectric power generation, the multipurpose dam in the Soyang Reservoir continuously discharges cold water from its mid layer, maintaining a discharge water temperature of 15 °C throughout the year that creates conditions that allow for S. trutta survival downstream.
In 2021, the Ministry of Environment of South Korea legally designated S. trutta as an invasive species to prevent further spread and minimize ecological damage through eradication and removal projects [16,17]. Owing to its popularity in recreational fishing and ecological adaptability, there are concerns regarding the impact of widespread S. trutta release and distribution. Therefore, the close monitoring of its habitat and potential spread is required, necessitating the urgent need for rapid and effective identification in new habitats and areas of expansion. However, the current assessment and monitoring of S. trutta are still conducted using traditional methods such as skimming nets, gill nets, or angler-provided rod catch data, as electrofishing—a common method used in freshwater fish surveys—is illegal in South Korea. Given the ecological traits of S. trutta, including its preference for cold water and long-distance migration, monitoring through traditional methods is challenging, as these surveys are often expensive, labor intensive, and time consuming.
The environmental DNA (eDNA)-based real-time PCR (quantitative PCR or qPCR) assay is a powerful tool for the molecular monitoring of invasive fish species in aquatic ecosystems, as well as for monitoring commercially exploited, rare, or endangered fish species; for example [18,19,20,21,22,23]. This method involves the collection of water samples from an environment where a target species may be present and an analysis of the obtained samples for the detection of biological material, such as skin cells, scales, mucus, blood, feces, and gametes, shed by the species. qPCR amplifies DNA fragments unique to the target species, enabling highly sensitive detection even at low population densities. This technique is particularly useful for early detection, tracking the spread, and monitoring the distribution of exotic fish species, such as S. trutta [22,24,25,26,27].
In this study, we aimed to determine the distribution range of S. trutta through a qPCR analysis of water samples collected from river water downstream of the Soyang Reservoir and around the Uiam Reservoir, where the species is known to occur.

2. Materials and Methods

2.1. Sampling of Fish Specimens and Genomic DNA (gDNA) Extraction

Specimens of S. trutta (n = 2), the other five salmonid species, i.e., Brachymystax lenok tsinlingensis, Oncorhynchus keta, Oncorhynchus mykiss, Thymallus grubii, and Salmo salar, and 19 freshwater fish species belonging to diverse orders and families (Acheilognathus rhombeus, Coreoperca herzi, Cyprinus carpio, Gasterosteus aculeatus, Hemiculter eigenmanni, Lepomis macrochirus, Liobagrus andersoni, Misgurnus anguillicaudatus, Monopterus albus, Mugil cephalus, Odontobutis platycephala, Orthrias nudus, Oryzias latipes, Plecoglossus altivelis, Repomucenus olidus, Rhynchocypris oxycephalus, Silurus asotus, Tachysurus fulvidraco, and Zacco platypus) were collected from rivers or local markets in South Korea. A piece of the pelvic fin of each species was excised and used for gDNA extraction, as previously described by Asahida et al. [28]. The extracted gDNA was resuspended in TE buffer (10 mM Tris-HCl and 1 mM EDTA, pH 8.0), and its quantity and quality were assessed using a spectrophotometer (NanoDrop™ One, Thermo Fisher Scientific Inc., Waltham, MA, USA).

2.2. Modification of Primers and Probe

All mitochondrial cytochrome b gene (mt-cyb) sequences of S. trutta haplotypes and all reference sequences of the mitochondrial genomes of salmoniform species were retrieved from GenBank (https://www.ncbi.nlm.nih.gov/; accessed on 17 July 2023) and aligned using CLUSTALW, implemented in BioEdit 7.2 [29]. Following a comparison of the aligned nucleotide matrices, the forward and reverse primers and hydrolysis probe reported by Carim et al. [26] were modified and used in the qPCR assays. Their melting temperature (Tm) and secondary structures were predicted using the Sequence Manipulation Suite ver. 2 (https://www.bioinformatics.org/sms2/; accessed on 17 July 2023) [30] and optimized prior to oligonucleotide syntheses.

2.3. Environmental Water Sampling and eDNA Extraction

Environmental water samples (each 1–2 L) were collected in sterile disposable plastic bottles at a depth of 10 m from eight stations located downstream of the Soyang Reservoir and around the Uiam Reservoir between January and March 2023 (Table 1) in Chuncheon-si, Gangwon-do, South Korea. The samples were vacuum-filtered through glass microfiber filters (Grade GF/F circles, 47 mm; Whatman, Marlborough, MA, USA). Each filter was folded in half four times using uncontaminated forceps, inserted into a 2.0 mL microtube, and placed in a cooled ice box with polyethylene bags containing ice, protected from light exposure. They were then transported directly to the laboratory and stored in at −70 °C until further use. Each filter was broken using Omni Bead Ruptor 12 Bead Mill Homogenizer (OMNI International, Kennesaw, GA, USA) and eDNA was extracted using DNeasy Blood & Tissue kit (Qiagen, Hilden, Germany), following the manufacturer’s instructions. The eDNA was finally eluted in 50 μL of sterile distilled water and immediately stored at –20 °C for further processing.

2.4. qPCR Assay

qPCR amplification was conducted in triplicate (three technical replicates) for each eDNA sample using GoTaq® Probe qPCR Master Mix (Promega, Madison, WI, USA). The reaction mixture (10 μL) contained 5 μL of GoTaq® Probe qPCR Master Mix, 1 μL of CXR Reference Dye, 1 μL of eDNA as a template, and 0.2 μM each of the forward primer Str-cyb-0297f (5′-CCGAGGACTCTACTATGGT-3′) and the reverse primer Str-cyb-0384r (5′-GGAAGAACGTAGCCCACG-3′) and the hydrolysis probe Str-cyb-0341p (5′-FAM-ATATCGGAGTCGTACTGCTA-MGB-Eclipse-3′), which were synthesized by Macrogen, Inc. (Seoul, South Korea). qPCR was performed using a QuantStudio™ 5 Real-Time PCR System (Thermo Fisher Scientific Inc.) with the following cycling conditions: an initial activation at 95 °C for 2 min, followed by 50 cycles of denaturation at 95 °C for 15 s, and annealing and extension at 60 °C for 45 s. The gDNAs (20 ng μL−1) extracted from two S. trutta specimens were used as positive controls. Sterile distilled water was used as a negative control to monitor contamination during filtration, eDNA extraction, and qPCR analysis.
A synthesized partial DNA fragment of S. trutta mt-cyb containing all the binding sites for the forward and reverse primers and the hydrolysis probe was produced by gene synthesis and inserted into a plasmid by Bioneer Inc. (Daejeon, South Korea). The sensitivity of the primers and probe was tested by qPCR assay against 10-fold serial dilutions of the plasmid DNA (109 copies rxn−1) in triplicate for each dilution. The results were used to produce a standard curve to quantify the copy numbers of S. trutta eDNA. Their specificity was also tested against five other salmonid and nineteen freshwater fish species belonging to diverse orders and families that are commonly found in South Korea.

3. Results

3.1. Modified Primers and Probe

In this study, we modified the forward and reverse primers, as well as the hydrolysis probe, previously described by Carim et al. [26], which were specific to S. trutta and designed based on mt-cyb sequences (Table 2). The Tm of the forward and reverse primers used in this study (Str-cyb-0297f and Str-cyb-0384r, respectively) were lower than those used by Carim et al. [26] (Str-cyb-0294f and Str-cyb-0382r, respectively). Both primers used in the present study showed the exact matches with all S. trutta haplotypes in the GenBank database. Additionally, the hydrolysis probe used in this study (Str-cyb-0341p) had a higher Tm than that used by Carim et al. [26] (Str-cyb-0345p). The probe also matched all S. trutta haplotypes in the GenBank database, with a single base-pair mismatch in only one haplotype (GenBank accession number JX960839) reported by Crête-Lafrenière et al. [31], but multiple base-pair mismatches with other salmoniform species, including the congeneric Salmo ischchan, Salmo obtusirostris, and S. salar.
The forward and reverse primers produced a 105-bp amplicon, as predicted using conventional PCR amplification. The hydrolysis probe consisted of a 20-mer oligonucleotide with a fluorophore, 6-carboxyfluorescein (6-FAM), covalently attached to the 5′-end, and a quencher, MGB-Eclipse, at the 3′-end. This combination of oligonucleotides was unique to S. trutta and was not found in other salmoniform species.

3.2. Sensitivity and Specificity Tests

qPCR amplification using the designed primers and probe resulted in positive amplification with a quantification cycle (Cq) value of 17.776 against a standard concentration of the gDNA (20 ng μL−1) extracted from S. trutta. No background amplification was observed. The sensitivity test was conducted using a serial dilution of plasmid DNA (1–109 copies rxn−1), in which a partial DNA fragment of S. trutta mt-cyb containing all the binding sites for the forward and reverse primers and the hydrolysis probe were inserted. An inverse relationship was observed between the Cq values and plasmid DNA concentrations, with a detection limit of as low as 102 copies rxn−1 of plasmid DNA and a Cq value of 36.717 (Figure 1). Therefore, the Cq value was set as the lowest detection limit to achieve acceptable levels of precision and accuracy in the qPCR assay. This correlation was used to generate the standard curve slope, which produced the following linear regression equation:
y = −3.51x + 43.818 (r2 = 0.999, efficiency = 92.69%)
Linear regression was used to detect and quantify S. trutta eDNA in environmental water samples.
To confirm the specificity of the primers and hydrolysis probe for S. trutta, we carried out qPCR amplification of five salmonid (B. lenok tsinlingensis, O. keta, O. mykiss, T. grubii, and S. salar) and nineteen freshwater fish species belonging to diverse orders and families that are commonly found in the rivers and lakes or local markets of South Korea. Only two S. trutta specimens successfully produced positive fluorescence amplifications, whereas the other fish species failed to produce measurable amplifications (Figure 2).

3.3. qPCR Assay of Environmental Water Samples

The primers and hydrolysis probe specific to S. trutta in this study were used to amplify eDNA extracted from the collected environmental water samples (n = 24). Positive amplifications were observed in 11 samples (Stns. 1, 2, and 8 in January 2023; Stns. 1, 2, 5, and 8 in February 2023; and Stns. 1, 6, 7, and 8 in March 2023), with Cq values ranging from 30.665 to 38.629, corresponding to plasmid copy numbers from 250.6 copies L−1 to 132,677.1 copies L−1 (Table 3). The highest value, 132,677.1 ± 6386.3 copies L−1, was observed for St. 1.
S. trutta eDNA was detected in all three replicates in the upstream section of the Soyang River (St. 1), located downstream of the Soyang Reservoir, between January and March 2023 (Figure 3). It was also detected in all three replicates from the downstream section (St. 8) in February 2023 but in only one replicate out of three in January and March. Additionally, it was detected in all three replicates from Sangjung Island (St. 2), located upstream of the Uiam Reservoir, in January and February 2023; however, no S. trutta eDNA was detected in March. In contrast, two small streams flowing into the Uiam Reservoir (Stns. 5 and 6) possessed S. trutta eDNA in only one out of three replicates in February and March, whereas St. 7, located downstream of the Uiam Reservoir, showed S. trutta eDNA in only one of the three replicates in March at very low concentrations. However, S. trutta eDNA was not detected in the Gongji Stream (St. 3), which flows into the Uiam Reservoir, or in St. 4, which is located downstream of the Bukhan River. Representative samples that showed the positive amplifications were further verified via Sanger sequencing to confirm the absence of false-positive results.

4. Discussion

An eDNA-based qPCR assay enhances management efforts aimed at preventing the establishment and spread of invasive species, and by providing rapid and precise results, is useful in protecting native biodiversity [32,33]. The effectiveness of qPCR for species detection depends on the development of species-specific forward and reverse primers and/or hydrolysis probe that exclusively amplify the DNA fragment of the target species, minimizing false positives from cross-amplification with closely related species [34,35]. To ensure target specificity, the primers and/or probe need to be tested against all related species potentially present in the study area to confirm that only the target species is amplified. This validation process is essential for its accurate detection using molecular monitoring. Using the primers and probe specific to S. trutta that were modified from Carim et al. [26], we aimed to amplify S. trutta eDNA from environmental water samples by qPCR assay, even if present at low concentrations, to allow for its accurate and early detection.
It has been previously reported that qPCR targeting S. trutta is an important tool for detecting and monitoring this invasive species [22,25,26,27]. This method aids in tracking the spread of S. trutta and supports efforts to control its population and mitigate ecological damage. In this study, we modified the forward and reverse primer of Carim et al. [26] by reducing their Tm and the hydrolysis probe by increasing its Tm to enhance qPCR sensitivity and specificity. Reducing the Tm of both primers improved their binding efficiency to eDNA at low temperatures, increasing the amplification efficiency, especially in low-concentration samples, and resulting in greater detection sensitivity. Additionally, increasing the Tm of the hydrolysis probe enhanced its binding stability to the target sequence, ensuring more selective binding to the correct target and reducing nonspecific binding. This minimizes false positives and enables a more accurate detection of the target species. Aligning the Tm of both primers and probe improved the overall balance and efficiency of the qPCR, thus enhancing the robustness of the qPCR assay, particularly when complex or degraded samples are used. These optimizations led to a more reliable and precise detection of the target species, such as S. trutta, via molecular monitoring.
In the present study, S. trutta eDNA was detected in high quantities and frequencies in the upstream (St. 1) and downstream (St. 8) sections of the Soyang River, which is consistent with previous findings [7,17,36,37]. These areas are characterized by shallow water depths, with riverbeds mainly composed of sand, pebbles, gravel, and boulders [8,17]. In addition to these two stations, S. trutta eDNA was detected on Sangjung Island (St. 2), located upstream of the Uiam Reservoir. The environmental water was released from the middle layer of the Soyang Reservoir for hydroelectric power generation, maintaining a discharge water temperature of 15 °C throughout the year. As a result, the downstream area, approximately 10 km before merging with the Bukhan River, is influenced by the cold water released from the reservoir [38]. These three stations were directly affected by such cold water. Thus, the riverbed structure and hydraulic characteristics of the Soyang River provide an optimal environment for S. trutta inhabitation and spawning [39,40,41], because this species requires low water temperatures and high levels of dissolved oxygen. Park et al. [8] observed sexually mature males and females in the Soyang Reservoir, supporting the conclusion that S. trutta migrates downstream from the Soyang Reservoir for spawning. Therefore, these areas serve as overwintering habitats for anadromous fish, such as S. trutta, which migrate to the upper rivers or streams for reproduction. This species also has a high potential to expand its habitat to the Paro Reservoir, located upstream of the Uiam Reservoir, because of its distinct life cycle, necessitating broader monitoring efforts across the Han River basin.
Our study confirmed previously known habitats of S. trutta and demonstrated that this fish is expanding its habitat. Consistent with previous findings, we found that S. trutta eDNA was detected in the Soyang River [8,37]; however, we also detected S. trutta in the Uiam Reservoir, indicating that the species utilizes a broader range of habitats than previously reported. Although the quantity of eDNAs does not always directly reflect the biomass or number of individuals, owing to various biotic and abiotic factors in the natural habitats of the target species [21,27,42,43,44], our results highlight qPCR as an alternative tool for determining the presence of S. trutta in aquatic environments. This method offers a more efficient and effective approach for assessing and monitoring practices than traditional field surveys. Furthermore, this approach can support conservation efforts by habitats that require the removal of invasive species with the goal of restoring the area to its predefined historical conditions [25].
This survey was conducted during a limited period, specifically during the winter months (January and February) and early spring (March), when water was at the lowest annual temperature [8]. This water condition is suitable for S. trutta, enabling broad species distribution. It is necessary to apply molecular monitoring during warmer months, that is, from late spring to fall, when water temperatures rise. During this period, it is likely that S. trutta moves to deeper and cooler areas at the bottom of the Uiam Reservoir, where a lower water temperature is maintained. In this study, we found that S. trutta eDNA was more frequently detected at the southern stations (Stns. 5, 6, and 7), which were located around the main water body of the Uiam Reservoir in February and March, when the water temperature was higher than that in January.
In addition, S. trutta frequently hybridizes with other native salmonid species [12,13]. It also has a high potential to hybridize with native salmonid species in South Korea, such as B. lenok tsinlingensis and O. masou masou, leading to genetic mixing that reduces the integrity and fitness of native populations. Such hybridization may result in the loss of locally adapted traits, inhibiting resilience to environmental changes, climate stress, and competition with invasive salmonid species. The introduction of S. trutta through intentional stocking or natural migration to other rivers and streams in South Korea could negatively impact the natural genetic pollution, further endangering native populations. S. trutta fishing has gained popularity, and it was reported in online communities that attempts have been made to transplant this species into other rivers or streams outside the Uiam Reservoir, highlighting the need for ongoing monitoring to prevent its spread. Overall, our findings highlight the potential for the future use of our qPCR assay for the monitoring of invasive fish species.

5. Conclusions

This study demonstrated that the qPCR assay using the species-specific primers and probe is effective for the molecular monitoring of an invasive S. trutta in South Korea. The assay successfully detected S. trutta eDNA from environmental water samples collected downstream of the Soyang Reservoir and around the Uiam Reservoir, even at low concentrations. Our findings confirm the presence of S. trutta in these areas and highlight its expanding habitat range, raising concerns about potential ecological impacts on native freshwater species. The qPCR assay developed in this study provides a reliable, sensitive, and efficient tool for the early detection and continuous monitoring of S. trutta, offering an effective alternative to traditional sampling methods. Continuous molecular monitoring is essential to prevent further spread, mitigate ecological risks, and support conservation efforts aimed at protecting native biodiversity in South Korean freshwater ecosystems.

Author Contributions

Conceptualization: S.-H.K., S.-I.L. and K.-Y.K.; field sampling: S.-H.K.; lab experiment: S.-E.J.; manuscript writing: S.-H.K., S.-H.L. and K.-Y.K. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by grants from the National Institute of Ecology funded by the Ministry of Environment of the Republic of Korea (NIE-A-2024-09 and NIE-A-2024-19).

Institutional Review Board Statement

Ethical review and approval were waived for this study because no live animals were directly involved in the research. The study exclusively utilized environmental DNA extracted from water samples, which does not involve direct handling, disturbance, or harm to any fish or other organisms. The methods employed in this study comply with ethical standards for non-invasive molecular monitoring.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in this study are included in the article.

Acknowledgments

We sincerely appreciate Jung-Soo Heo of AquaGenTech Co., Ltd. for his valuable comments and suggestions on qPCR assays and Joo-Won Shin for his assistance with environmental water sampling.

Conflicts of Interest

The co-authors (So-Eun Jo and Keun-Yong Kim) are employees of AquaGenTech Co., Ltd. The authors declare no conflicts of interest. The sponsors have no role in the design, execution, interpretation, or writing of the study.

References

  1. Elliott, J.M. Quantitative Ecology and the Brown Trout; Oxford University Press: Oxford, UK, 1994. [Google Scholar]
  2. Klemetsen, A.; Amundsen, P.A.; Dempson, J.B.; Jonsson, B.; Jonsson, N.; O’Connell, M.F.; Mortensen, E. Atlantic salmon Salmo salar L., brown trout Salmo trutta L. and Arctic charr Salvelinus alpinus (L.): A review of aspects of their life histories. Ecol. Freshw. Fish 2003, 12, 1–59. [Google Scholar] [CrossRef]
  3. Townsend, C.R. Invasion biology and ecological impacts of brown trout Salmo trutta in New Zealand. Biol. Conserv. 1996, 78, 13–22. [Google Scholar] [CrossRef]
  4. Behnke, R. Trout and Salmon of North America; The Free Press, Simon & Schuster Inc.: New York, NY, USA, 2010. [Google Scholar]
  5. McDowall, R.M. Impacts of introduced salmonids on native galaxiids in New Zealand upland streams: A new look at an old problem. Trans. Am. Fish. Soc. 2003, 132, 229–238. [Google Scholar] [CrossRef]
  6. Korsu, K.; Huusko, A.; Muotka, T. Impacts of invasive stream salmonids on native fish: Using meta-analysis to summarize four decades of research. Boreal Environ. Res. 2010, 15, 491–500. [Google Scholar]
  7. Hasegawa, K. Invasions of rainbow trout and brown trout in Japan: A comparison of invasiveness and impact on native species. Ecol. Freshw. Fish 2020, 29, 419–428. [Google Scholar] [CrossRef]
  8. Park, C.W.; Yun, Y.J.; Kim, J.W.; Bae, D.Y.; Kim, J.G.; Kim, S.H. An Identification of domestic habitat and settlement of the invasive exotic fish brown trout, Salmo trutta. Korean J. Ichthyol. 2022, 34, 270–276. (In Korean) [Google Scholar]
  9. Townsend, C.R.; Crowl, T.A. Fragmented population structure in a native New Zealand fish: An effect of introduced brown trout? Oikos 1991, 61, 347–354. [Google Scholar] [CrossRef]
  10. McHugh, P.; Budy, P. Experimental effects of nonnative brown trout on the individual- and populations-level performance of native Bonneville cutthroat trout. Trans. Am. Fish. Soc. 2006, 135, 1441–1455. [Google Scholar] [CrossRef]
  11. McIntosh, A.R.; McHugh, P.A.; Dunn, N.R.; Goodman, J.M.; Howard, S.W.; Jellyman, P.G.; O’Brien, L.K.; Nyström, P.; Woodford, D.J. The impact of trout on galaxiid fishes in New Zealand. N. Z. J. Ecol. 2010, 34, 195–206. [Google Scholar]
  12. Meldgaard, T.; Crivelli, A.J.; Jesensek, D.; Poizat, G.; Rubin, J.F.; Berrebi, P. Hybridization mechanisms between the endangered marble trout (Salmo marmoratus) and the brown trout (Salmo trutta) as revealed by in-stream experiments. Biol. Conserv. 2007, 136, 602–611. [Google Scholar] [CrossRef]
  13. Castillo, A.G.F.; Ayllon, F.; Moran, P.; Izquierdo, J.I.; Martinez, J.L.; Beall, E.; Garcia-Vazquez, E. Interspecific hybridization and introgression are associated with stock transfers in salmonids. Aquaculture 2008, 278, 31–36. [Google Scholar] [CrossRef]
  14. Lowe, S.; Browne, M.; Boudjelas, S.; De Poorter, M. 100 of the World’s Worst Invasive Alien Species: A Selection from the Global Invasive Species Database; Invasive Species Specialist Group: Auckland, New Zealand, 2000. [Google Scholar]
  15. Molony, B. Environmental Requirements and Tolerances of Rainbow Trout (Oncorhynchus mykiss) and Brown Trout (Salmo trutta) with Special Reference to Western Australia: A Review; Department of Fisheries, Government of Western Australia: Perth, Australia, 2001. [Google Scholar]
  16. Ministry of Environment. Notice on Designation of Ecosystem-disrupting Organisms; Ministry of Environment: Sejong, Republic of Korea, 2021. (In Korean) [Google Scholar]
  17. National Institute of Ecology. Monitoring of Invasive Alien species in 2023; National Institute of Ecology: Seocheon, Republic of Korea, 2023. (In Korean) [Google Scholar]
  18. Wilcox, T.M.; Carim, K.J.; McKelvey, K.S.; Young, M.K.; Schwartz, M.K. The dual challenges of generality and specificity when developing environmental DNA markers for species and subspecies of Oncorhynchus. PLoS ONE 2015, 10, e0142008. [Google Scholar] [CrossRef] [PubMed]
  19. Atkinson, S.; Carlsson, J.E.L.; Ball, B.; Egan, D.; Kelly-Quinn, M.; Whelan, K.; Carlsson, J. A quantitative PCR-based environmental DNA assay for detecting Atlantic salmon (Salmo salar L.). Aquat. Conserv. 2018, 28, 1238–1243. [Google Scholar] [CrossRef]
  20. Fernandez, S.; Sandin, M.M.; Beaulieu, P.G.; Clusa, L.; Martinez, J.L.; Ardura, A.; García-Vázquez, E. Environmental DNA for freshwater fish monitoring: Insights for conservation within a protected area. PeerJ 2018, 6, e4486. [Google Scholar] [CrossRef] [PubMed]
  21. Knudsen, S.W.; Ebert, R.B.; Hesselsøe, M.; Kuntke, F.; Hassingboe, J.; Mortensen, P.B.; Thomsen, P.F.; Sigsgaard, E.E.; Hansen, B.K.; Nielsen, E.E.; et al. Species-specific detection and quantification of environmental DNA from marine fishes in the Baltic Sea. J. Exp. Mar. Biol. Ecol. 2019, 510, 31–45. [Google Scholar] [CrossRef]
  22. Hernandez, C.; Bougas, B.; Perreault-Payette, A.; Simard, A.; Côté, G.; Bernatchez, L. 60 specific eDNA qPCR assays to detect invasive, threatened, and exploited freshwater vertebrates and invertebrates in Eastern Canada. Environ. DNA 2020, 2, 373–386. [Google Scholar] [CrossRef]
  23. Kim, K.-Y.; Heo, J.S.; Moon, S.Y.; Kim, K.-S.; Choi, J.-H.; Yoo, J.-T. Preliminary application of molecular monitoring of the Pacific herring (Clupea pallasii) based on real-time PCR assay utilization on environmental water samples. Korean J. Ecol. Environ. 2021, 54, 209–220. [Google Scholar] [CrossRef]
  24. Gustavson, M.S.; Collins, P.C.; Finarelli, J.A.; Egan, D.; Conchúir, R.Ó.; Wightman, G.D.; King, J.J.; Gauthier, D.T.; Whelan, K.; Carlsson, J.E.; et al. An eDNA assay for Irish Petromyzon marinus and Salmo trutta and field validation in running water. J. Fish. Biol. 2015, 87, 1254–1262. [Google Scholar] [CrossRef]
  25. Banks, J.C.; Demetras, N.J.; Hogg, I.D.; Knox, M.A.; West, D.W. Monitoring brown trout (Salmo trutta) eradication in a wildlife sanctuary using environmental DNA. N. Z. Nat. Sci. 2016, 41, 1–13. [Google Scholar]
  26. Carim, K.J.; Wilcox, T.M.; Anderson, M.; Lawrence, D.J.; Young, M.K.; McKelvey, K.S.; Schwartz, M.K. An environmental DNA marker for detecting nonnative brown trout (Salmo trutta). Conserv. Genet. Resour. 2016, 8, 259–261. [Google Scholar] [CrossRef]
  27. Deutschmann, B.; Müller, A.K.; Hollert, H.; Brinkmann, M. Assessing the fate of brown trout (Salmo trutta) environmental DNA in a natural stream using a sensitive and specific dual-labelled probe. Sci. Total Environ. 2019, 655, 321–327. [Google Scholar] [CrossRef]
  28. Asahida, T.; Kobayashi, T.; Saitoh, K.; Nakayama, I. Tissue preservation and total DNA extraction form fish stored at ambient temperature using buffers containing high concentration of urea. Fish. Sci. 1996, 62, 727–730. [Google Scholar] [CrossRef]
  29. Hall, T.A. BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 1999, 41, 95–98. [Google Scholar]
  30. Stothard, P. The sequence manipulation suite: JavaScript programs for analyzing and formatting protein and DNA sequences. BioTechniques 2000, 28, 1102–1104. [Google Scholar] [CrossRef] [PubMed]
  31. Crête-Lafrenière, A.; Weir, L.K.; Bernatchez, L. Framing the Salmonidae family phylogenetic portrait: A more complete picture from increased taxon sampling. PLoS ONE 2012, 7, e46662. [Google Scholar] [CrossRef] [PubMed]
  32. Lodge, D.M.; Turner, C.R.; Jerde, C.L.; Barnes, M.A.; Chadderton, L.; Egan, S.P.; Feder, J.L.; Mahon, A.R.; Pfrender, M.E. Conservation in a cup of water: Estimating biodiversity and population abundance from environmental DNA. Mol. Ecol. 2012, 21, 2555–2558. [Google Scholar] [CrossRef]
  33. Thomsen, P.F.; Willerslev, E. Environmental DNA–An emerging tool in conservation for monitoring past and present biodiversity. Biol. Conserv. 2015, 183, 4–18. [Google Scholar] [CrossRef]
  34. Ficetola, G.F.; Miaud, C.; Pompanon, F.; Taberlet, P. Species detection using environmental DNA from water samples. Biol. Lett. 2008, 4, 423–425. [Google Scholar] [CrossRef]
  35. Wilcox, T.M.; McKelvey, K.S.; Young, M.K.; Jane, S.F.; Lowe, W.H.; Whiteley, A.R.; Schwartz, M.K. Robust detection of rare species using environmental DNA: The importance of primer specificity. PLoS ONE 2013, 8, e59520. [Google Scholar] [CrossRef]
  36. National Institute of Ecology. Investigating Ecological Risk of Alien Species in 2020; National Institute of Ecology: Seocheon, Republic of Korea, 2020. (In Korean) [Google Scholar]
  37. Kim, J.; Hong, D.; Kim, J.; Kim, B.; Kim, H.; Choi, J. Length–weight relationship and condition factor of the invasive fish species brown trout (Salmo trutta) in Soyang River. J. Agric. Life Environ. Sci. 2023, 35, 604–617. (In Korean) [Google Scholar]
  38. Yi, Y.K.; Lee, H.S.; Baek, H.J.; Kim, Y.D. Temperature variation of release water of Soyang Reservoir. In Convention 2006 Civil Expo & Conference; Korean Society of Civil Engineers: Seoul, Republic of Korea, 2006; pp. 165–166. (In Korean) [Google Scholar]
  39. Kondolf, G.M.; Wolman, M.G. The sizes of salmonid spawning gravels. Water Resour. Res. 1993, 29, 2275–2285. [Google Scholar] [CrossRef]
  40. Young, M.K. Conservation Assessment for Inland Cutthroat Trout; Rocky Mountain Forest and Range Experiment Station: Fort Collins, CO, USA, 1995; Volume 256. [Google Scholar]
  41. Armstrong, J.D.; Kemp, P.S.; Kennedy, G.J.A.; Ladle, M.; Milner, N.J. Habitat requirements of Atlantic salmon and brown trout in rivers and streams. Fish. Res. 2003, 62, 143–170. [Google Scholar] [CrossRef]
  42. Goldberg, C.S.; Strickler, K.M.; Pilliod, D.S. Moving environmental DNA methods from concept to practice for monitoring aquatic macroorganisms. Biol. Conserv. 2015, 183, 1–3. [Google Scholar] [CrossRef]
  43. Barnes, M.A.; Turner, C.R. The ecology of environmental DNA and implications for conservation genetics. Conserv. Genet. 2016, 17, 1–17. [Google Scholar] [CrossRef]
  44. Yates, M.C.; Fraser, D.J.; Derry, A.M. Meta-analysis supports further refinement of eDNA for monitoring aquatic species-specific abundance in nature. Environ. DNA 2019, 1, 5–13. [Google Scholar] [CrossRef]
Animals 15 00659 g001
Figure 1. Amplification plot and standard curve of the real-time PCR assay using the primers and hydrolysis probe specific to brown trout, Salmo trutta. A serial dilution of plasmid DNA (1–109 copies rxn−1) shows a detection limit of as low as 102 copies rxn−1 (A), with the standard-curve slope producing a linear regression (B).
Figure 1. Amplification plot and standard curve of the real-time PCR assay using the primers and hydrolysis probe specific to brown trout, Salmo trutta. A serial dilution of plasmid DNA (1–109 copies rxn−1) shows a detection limit of as low as 102 copies rxn−1 (A), with the standard-curve slope producing a linear regression (B).
Animals 15 00659 g001
Animals 15 00659 g002
Figure 2. An amplification curve of real-time PCR assay using the primers and hydrolysis probe specific to brown trout, Salmo trutta. Specificity testing was conducted on five salmonid species, Brachymystax lenok tsinlingensis, Oncorhynchus keta, Oncorhynchus keta, Thymallus grubii, and Salmo salar, as well as two S. trutta specimens and nineteen freshwater fish species commonly found in South Korean rivers and lakes or local markets.
Figure 2. An amplification curve of real-time PCR assay using the primers and hydrolysis probe specific to brown trout, Salmo trutta. Specificity testing was conducted on five salmonid species, Brachymystax lenok tsinlingensis, Oncorhynchus keta, Oncorhynchus keta, Thymallus grubii, and Salmo salar, as well as two S. trutta specimens and nineteen freshwater fish species commonly found in South Korean rivers and lakes or local markets.
Animals 15 00659 g002
Animals 15 00659 g003
Figure 3. Average environmental DNA (eDNA) concentrations (copies L−1) of brown trout, Salmo trutta, quantified using the real-time PCR assay across eight stations in the downstream river of the Soyang Reservoir and around Uiam Reservoir. (A) January 2023; (B) February 2023; and (C) March 2023.
Figure 3. Average environmental DNA (eDNA) concentrations (copies L−1) of brown trout, Salmo trutta, quantified using the real-time PCR assay across eight stations in the downstream river of the Soyang Reservoir and around Uiam Reservoir. (A) January 2023; (B) February 2023; and (C) March 2023.
Animals 15 00659 g003
Table 1. Sampling sites of environmental water samples for the molecular monitoring of brown trout, Salmo trutta, downstream of the Soyang Reservoir and around the Uiam Reservoir in Chuncheon-si, Gangwon-do, South Korea.
Table 1. Sampling sites of environmental water samples for the molecular monitoring of brown trout, Salmo trutta, downstream of the Soyang Reservoir and around the Uiam Reservoir in Chuncheon-si, Gangwon-do, South Korea.
StationGPS CoordinateLocation
St. 137°55′37.17″ N 127°47′07.03″ EUpstream of the Soyang River
St. 237°54′15.93″ N 127°42′46.12″ EThe Sangjung Island
St. 337°52′08.34″ N 127°43′26.22″ EThe Gongji Stream
St. 437°54′57.30″ N 127°43′05.38″ EDownstream of the Bukhan River
St. 537°53′39.78″ N 127°41′23.97″ ESmall stream flowing into the Uiam Reservoir
St. 637°51′08.81″ N 127°40′07.78″ ESmall stream flowing into the Uiam Reservoir
St. 737°51′21.98″ N 127°41′09.69″ EDownstream of the Uiam Reservoir
St. 837°53′40.60″ N 127°43′25.11″ EDownstream of the Soyang River
Table 2. A comparison of the forward and reverse primers and the hydrolysis probe from Carim et al. [29] and those modified in this study, which are specific to brown trout, Salmo trutta.
Table 2. A comparison of the forward and reverse primers and the hydrolysis probe from Carim et al. [29] and those modified in this study, which are specific to brown trout, Salmo trutta.
Oligonucleotide Name 1Sequence (5′ → 3′)G + C (%)Nearest Neighbor Tm (°C)References
Forward primer
Str-cyb-0294fCGCCCGAGGACTCTACTATGGT59.0967.87Carim et al. [26]
Str-cyb-0297fCCGAGGACTCTACTATGGT52.6360.07This study
Reverse primer
Str-cyb-0382rGGAAGAACGTAGCCCACGAA55.0065.00Carim et al. [26]
Str-cyb-0384rGGAAGAACGTAGCCCACG61.1162.94This study
Hydrolysis probe
Str-cyb-0345pCGGAGTCGTACTGCTAC58.8258.83Carim et al. [26]
Str-cyb-0341pATATCGGAGTCGTACTGCTA45.0060.01This study
1 The oligonucleotides were named based on the species name, with the first letter of the genus (S) and the first two letters of the species (tr) for S. trutta, followed by the gene name, mitochondrial cytochrome b gene (mt-cyb), the relative position of the first base of each oligonucleotide from the start codon of mt-cyb, and their direction: forward (f); reverse (r); or function probe (p).
Table 3. The quantification of environmental DNA from water samples collected downstream of the Soyang Reservoir and around Uiam Reservoir using real-time PCR analysis with the primers and hydrolysis probe specific to brown trout, Salmo trutta.
Table 3. The quantification of environmental DNA from water samples collected downstream of the Soyang Reservoir and around Uiam Reservoir using real-time PCR analysis with the primers and hydrolysis probe specific to brown trout, Salmo trutta.
Water SampleVolume (mL)Quantification Cycle
(Cq) Value		Total Volume
Equivalent (Copies L−1)		AverageStandard Deviation
Replicate 123123
January 2023
St. 1200030.75730.80930.665131,416127,015139,600132,677.16386.3
St. 2200034.60734.62835.45710,51710,37560228971.32555.0
St. 32000ND 1NDND0000.00.0
St. 42000NDNDND0000.00.0
St. 52000NDNDND0000.00.0
St. 62000NDNDND0000.00.0
St. 72000NDNDND0000.00.0
St. 8200035.836NDND4696001565.42711.3
February 2023
St. 1200034.11634.96134.88614,5108335875810,534.23449.3
St. 2200036.46436.399ND3111324602119.01836.4
St. 32000NDNDND0000.00.0
St. 42000NDNDND0000.00.0
St. 5200037.382NDND170300567.7983.2
St. 62000NDNDND0000.00.0
St. 71000NDNDND0000.00.0
St. 8200035.03934.23733.673792013,40819,40213,576.65742.7
March 2023
St. 1200035.46934.94636.1505976842038226072.72300.9
St. 22000NDNDND0000.00.0
St. 32000NDNDND0000.00.0
St. 42000NDNDND0000.00.0
St. 52000NDNDND0000.00.0
St. 62000NDND38.62900752250.6334.1
St. 7100037.365NDND3445001148.31989.0
St. 82000NDND37.539001537512.4887.5
Negative control1000NDNDND0000.00.0
1 ND: not detected.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Kim, S.-H.; Lee, S.-I.; Lee, S.-H.; Jo, S.-E.; Kim, K.-Y. The Molecular Monitoring of an Invasive Freshwater Fish, Brown Trout (Salmo trutta), Using Real-Time PCR Assay and Environmental Water Samples. Animals 2025, 15, 659. https://doi.org/10.3390/ani15050659

AMA Style

Kim S-H, Lee S-I, Lee S-H, Jo S-E, Kim K-Y. The Molecular Monitoring of an Invasive Freshwater Fish, Brown Trout (Salmo trutta), Using Real-Time PCR Assay and Environmental Water Samples. Animals. 2025; 15(5):659. https://doi.org/10.3390/ani15050659

Chicago/Turabian Style

Kim, Su-Hwan, Soo-In Lee, Sang-Hun Lee, So-Eun Jo, and Keun-Yong Kim. 2025. "The Molecular Monitoring of an Invasive Freshwater Fish, Brown Trout (Salmo trutta), Using Real-Time PCR Assay and Environmental Water Samples" Animals 15, no. 5: 659. https://doi.org/10.3390/ani15050659

APA Style

Kim, S.-H., Lee, S.-I., Lee, S.-H., Jo, S.-E., & Kim, K.-Y. (2025). The Molecular Monitoring of an Invasive Freshwater Fish, Brown Trout (Salmo trutta), Using Real-Time PCR Assay and Environmental Water Samples. Animals, 15(5), 659. https://doi.org/10.3390/ani15050659

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop