Next Article in Journal
Effects of Adding Butyrate or Exogenous Fibrolytic Enzymes on Ruminal Epithelium, Metabolism, and Microbiota of Beef Cattle
Previous Article in Journal
Organic Iron Supplementation in Cows and Its Impacts on Animal Health and Production
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Animals
Volume 15
Issue 23
10.3390/ani15233378
animals-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Fecal Sample Surveillance of the Wildlife Virome in Central Italy: Insights from the Foreste Casentinesi National Park

by
Maria Irene Pacini
,
Mario Forzan
* and
Maurizio Mazzei
Department of Veterinary Sciences, University of Pisa, 56124 Pisa, Italy
*
Author to whom correspondence should be addressed.
Animals 2025, 15(23), 3378; https://doi.org/10.3390/ani15233378
Submission received: 6 October 2025 / Revised: 17 November 2025 / Accepted: 18 November 2025 / Published: 21 November 2025
(This article belongs to the Section Wildlife)
Browse Figures
Versions Notes

Simple Summary

Wild animals can host many viruses, some of which may also affect humans and domestic animals. Monitoring these viruses is challenging because capturing wild animals is stressful and often impractical. In this study, we collected feces left in the environment by several mammal species living in the Foreste Casentinesi National Park in Tuscany, Italy. Using laboratory methods able to detect both known and unknown viruses, we found that more than one-third of the samples contained viral genetic material. Astroviruses were the most common and were detected in deer, foxes, wolves, porcupines, and small mustelids. Foxes carried the highest variety of viruses, such as parvovirus, coronavirus, and adenovirus. Because predators and scavengers may also ingest viruses from their prey, fecal samples provide information not only on individual animals but also on the broader community. Our results show that non-invasive sampling can give important insights into wildlife health, help identify new viruses early, and support biodiversity protection and public health.

Abstract

Wildlife can act as both a reservoir and a sentinel for emerging pathogens, but surveillance is often constrained by difficulties in obtaining samples without disturbing animals. This study explored the viral diversity of wild mammals inhabiting the Foreste Casentinesi National Park (Central Italy) using non-invasive fecal sampling. From 2021 to 2022, 99 fecal samples from several species were collected and analyzed by PCR and metagenomic next-generation sequencing. Of 26 pools examined, 10 (38.5%) tested positive for at least one viral target. Astroviruses were the most frequently detected, found in deer, foxes, wolves, small mustelids, and porcupines. Several sequences showed low similarity to known strains, suggesting divergent or novel viral lineages. Metagenomic analysis also identified members of Circoviridae, Anelloviridae, and Picobirnaviridae. While none of these virus families are currently recognized as major zoonotic agents, their widespread occurrence in wildlife and domestic animals underscores the importance of continued surveillance to better assess their ecological roles, host range, and potential implications for both animal and human health. These results provide new insights into the virome of European wildlife, including the first reports of some viruses in certain species. Overall, our study demonstrates that non-invasive surveillance is a valuable tool for monitoring ecosystem health and supports a One Health approach to early detection of viral threats.

1. Introduction

Wildlife represents an essential component of European biodiversity, contributing to the ecological, structural, and functional balance of natural ecosystems. However, recent assessments indicate that approximately 63% of protected animal species in Europe are unable to maintain viable populations, while 81% of natural habitats remain in unfavourable conservation status due to habitat loss, fragmentation, and degradation and the threat of infectious diseases [1]. When natural habitats are destroyed and biodiversity declines, humans and wildlife come into closer contact, increasing the risk of pathogen spillover. Conversely, conserving healthy ecosystems and diverse species can help regulate disease transmission and prevent outbreaks. In this way, conservation plays a pivotal role in protecting both wildlife and human health through the maintenance of balanced, resilient ecosystems [2]. Italy reflects this general trend, with many native mammal populations declining or increasingly confined to protected areas such as national parks and reserves. Tuscany hosts a high density of wild mammals and harbours the largest population of wild ungulates in peninsular Italy, estimated at approximately 400,000 individuals, with steadily increasing numbers.
The region accounts for about 40% of the national roe deer population, 45% of fallow deer, and 30% of wild boar [3]. Among the multiple stressors affecting wildlife populations, infectious diseases have gained increasing recognition as important drivers of biodiversity decline and as potential threats to both animal and human health [1,4]. Many pathogens circulate silently within wildlife without causing evident disease, yet they can spillover into domestic animals or humans under favourable ecological or environmental conditions [5,6]. Such cross-species transmission events can alter ecosystem dynamics, as demonstrated by viral outbreaks in wild carnivores and ungulates that have led to population declines or secondary infections in domestic livestock. Conservation and infectious diseases are closely interconnected. Understanding the distribution and diversity of pathogens circulating in wildlife is critical for both conservation biology and public health preparedness, in line with the One Health concept that highlights the interdependence of animal, human, and environmental health [7]. In this context monitoring wildlife health remains challenging because free-ranging animals are difficult to capture or handle. Traditional surveillance methods—including live trapping, carcass collection, or sampling during hunting and culling—often provide limited coverage and may bias results toward diseased or dead individuals [8,9]. Moreover, direct capture can induce stress or injury, particularly in sensitive or endangered species, and is logistically demanding in remote areas. These constraints hinder large-scale or long-term monitoring programs, limiting the capacity to detect early signs of emerging infections or ecosystem-level viral circulation.
To overcome these limitations, non-invasive sampling methods, such as the analysis of feces, urine, hair, or environmental swabs, have emerged as valuable alternatives for wildlife surveillance. Fecal samples, in particular, can be collected without disturbing animals and yield valuable information. They allow the identification of pathogens shed through the gastrointestinal tract and—especially in predators and scavengers—can also reveal viruses acquired from prey species, thus providing insight into both host-specific enteric viruses and environmentally acquired pathogens [10,11]. This sampling methodology enables the collection of data from animals that cannot be captured or directly handled and are widely used in studies on both domestic and wild animals. On the other hand, the possible environmental viral contamination even on fresh samples cannot be excluded. Concerning this particular aspect of the sampling procedure adopted, the aim of this research is to define the presence of viruses in the environment rather than in a single host. Numerous investigations have analyzed viruses from feces or rectal swabs collected from wild animals that were either live-captured, found dead, or culled through management programs using either targeted molecular assays or broader metagenomic approaches for virome characterization [12,13,14,15]. Thus, fecal-based studies can reflect not only the health of individual hosts but also the broader virological landscape of the ecosystem.
The introduction of next-generation sequencing (NGS) and metagenomic techniques has revolutionized the study of the wildlife virome, enabling the detection of both known and novel viral genomes without prior assumptions [16]. Metagenomic analysis is a well-established methodology with broad detection capabilities and applicability to various biological matrices, making it a valuable tool for exploring samples potentially containing unexpected or novel viruses [17]. These methods have revealed remarkable viral diversity across taxa and geographical regions: novel members of the Parvoviridae and Hepeviridae family in red foxes in the Netherlands [12], diverse Astroviridae members in wild boars and cervids [18,19,20], and novel Picornaviridae and Picobirnaviridae in small carnivores and rodents [21,22]. In Europe, however, studies encompassing multiple sympatric species within the same ecosystem remain scarce, leaving significant gaps in our understanding of viral circulation and host–pathogen interactions.
The present research investigates the fecal virome of wild mammals inhabiting the Foreste Casentinesi National Park (Central Italy)—one of the country’s most biodiverse and least anthropized ecosystems. By integrating conventional polymerase chain reaction (PCR) and metagenomic NGS approaches, this study aims to (i) characterize the diversity of viruses circulating among wild mammals, (ii) identify potentially novel or divergent viral lineages, and (iii) evaluate the effectiveness of non-invasive sampling as a model for ecosystem-level viral surveillance. Strengthening wildlife pathogen monitoring through such integrated methods may enhance early detection of emerging threats and support both biodiversity conservation and public health within the One Health framework [4].

2. Materials and Methods

2.1. Foreste Casentinesi National Park (PNFC)

The Foreste Casentinesi National Park (PNFC) covers an area of 368 km2 across two regions, Emilia-Romagna and Tuscany, with elevations ranging from 400 to 1658 meters above sea level. Forests account for over 80% of the Park’s total surface area. The extensive woodland coverage, the presence of diverse habitats and vegetation types, along with low human population density, make the Park an ideal environment for the presence and spread of wildlife, which is notable for its richness and diversity of species. For the purposes of this study, only the portion of the Park located within the Province of Arezzo (138 km2) was considered (Figure 1). The Casentinesi Forests National Park represents a crucial stronghold for the conservation of mammalian biodiversity in the northern Apennines. Its extensive mature woodlands and low levels of human disturbance support a wide range of wild species, including several conservation concerns. Among large mammals, the Italian wolf (Canis lupus italicus) has successfully recolonized the area, yet remains vulnerable due to habitat fragmentation, hybridization, and human–wildlife conflict. The park also hosts the European wildcat (Felis silvestris silvestris), a rare and threatened species in Italy, endangered by hybridization with domestic cats and by the reduction in continuous forest cover. Overall, the Casentinesi Forests National Park serves as a key refuge for endangered mammalian species and a model area for long-term biodiversity management within the Apennine ecosystem (https://www.parcoforestecasentinesi.it/) (accessed on 3 September 2025).

2.2. Sampling

Sampling activities were carried out following an agreement between the Department of Veterinary Sciences of the University of Pisa and the Foreste Casentinesi, Monte Falterona and Campigna National Park Authority (26 February 2021). The study area, corresponding to the portion of the Park located within the Province of Arezzo, was divided into eleven cells measuring five × five Km. Each transect of eight-1ten Km length was surveyed at least two times simultaneously by two–three operators, who followed and examined both the main trail/path and the surrounding area, considering a buffer zone of approximately ten m on each side. Additionally, any clearings, openings along or adjacent to the main route, as well as clearly identifiable animal paths, were carefully inspected. Given the aims of the study, only fresh fecal samples from wild mammals were collected. The sampling sessions were conducted between March 2021 and June 2022. Fecal samples were attributed to species based on morphological characteristics (appearance, size), deposition pattern, and content. Freshness was assessed based on consistency, color, moisture, mucus, and odor [23]. All samples were collected using sterile gloves (EN455) (CliniSafe Ltd., Lancaster, UK), aliquoted into Eppendorf tubes, and stored at −80 °C within six hours of collection.

2.3. Sample Processing

Samples were primarily analyzed in pools for conventional PCR screening and subsequent NGS analysis. Pools consisting of three to four fecal samples were created by grouping individual samples belonging to the same species from the same or neighboring transects. In details 100 mg per sample were ground and homogenized together until a uniform mixture was obtained, from which 200 mg were taken for extraction. Nucleic acid extraction was performed using the AllPrep PowerFecal DNA/RNA Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions, including optional on-column DNase and RNase digestion. After lysis and clarification, an additional filtration step was performed using 0.45 μm filters (Euroclone, Milan, Italy). Extracted nucleic acids were quantified using a Nanodrop spectrophotometer (Thermofisher scientific, Waltam, MA, USA), aliquoted, and stored at −80 °C until further analysis.

PCR Screening

Conventional PRC screening was performed on sample pool targeting the major fecal-shed viruses. Based on an extensive literature review, species-specific viral target panels were developed, while for less-studied species such as the porcupine (Hystrix cristata), badger (Meles meles), and small mustelids, broader panels were designed to include viruses from phylogenetically related taxa as well (Appendix A).
When possible—particularly for species with limited or no virological data—broad-range PCR protocols were also employed [2,24,25,26,27]. This strategy maximized the information obtained from each sample and provided an indirect means of investigating elusive species that are difficult or impossible to sample directly. Primer sequences used in this study, along reference details are provided in Table 1.
For the detection of viral DNA targets, conventional PCR was performed following literature protocols as presented in Table 1 using the Wonder Taq Hot Start Kit (Euroclone, Milan, Italy), while RNA viruses were analyzed via RT-PCR using the OneStep RT-PCR Kit (Qiagen, Hilden, Germany). For the second round of nested or semi-nested protocols, Wonder Taq Hot Start was again employed. All reactions were set up following the manufacturers’ protocols.
PCR products were subjected to agarose gel electrophoresis to verify the presence of the amplicons of expected size. Samples showing bands of the correct size were cut from gel and purified using the EuroSAP PCR Enzymatic Clean-up Kit (Euroclone, Milan, Italy) prior to sequencing.
Sanger sequencing was performed by BMR Genomics (Padua, Italy). Resulting sequences were analyzed using the online BLAST (2.17.0 version) tool to confirm target identity choosing somewhat similar sequence (blastn) algorithm using core nucleotide database (core nt). High-quality sequences were further processed using BioEdit (5.0.9 version) and submitted to GenBank.

2.4. Metagenomics Analysis

Although PCR using consensus primers is a useful tool for characterizing viral populations, enabling the detection of viruses even distantly related to known ones, this approach remains limited by the need for primer design and the selection of targets by the operator. To overcome these constraints and reduce operator bias, we employed a next-generation sequencing (NGS) approach, which does not rely on prior knowledge of viral sequences.
Four pooled fecal samples from red foxes (Vulpes vulpes) were subjected to metagenomic analysis to characterize the fecal virome. To enable unbiased amplification of viral nucleic acids, both RNA and DNA extracted from each pool underwent Sequence-Independent Single-Primer Amplification (SISPA) [43,44].
Following SISPA and quantification using a Qubit fluorometer and the dsDNA Assay Kit (Thermo Fisher Scientific, Waltam, MA, USA), RNA- and DNA-derived products were combined in a 1:1 ratio and submitted to IGA Technology Services Srl (Udine, Italy) for shotgun metagenomic sequencing. Libraries were prepared and sequenced on the Illumina NovaSeq 6000 platform (Illumina, Madison, WI, USA), generating approximately 30 million 150 bp paired-end reads per sample.

2.5. Bioinformatics

A preliminary taxonomic classification of the sequencing reads was performed by IGA Technology Services using Kraken v.2, a high-speed and accurate program for taxonomic assignment of DNA sequences [45].
Subsequently, a more detailed bioinformatic analysis was conducted using Geneious Prime® 2022.2.2), as indicated in Pacini et al. [46] supported by computing resources provided by the University of Pisa Data Center. Analyses were carried out on a 64-bit Windows-based virtual machine equipped with dual Intel Xeon Gold 5120 CPUs (2.20 GHz) and 128 GB RAM.

2.6. Phylogenetic Analysis

Phylogenetic relationships were inferred using the Maximum Likelihood (ML) method under the Tamura–Nei substitution model. The initial tree for the heuristic search was selected by choosing the tree with the superior log-likelihood between a Neighbor-Joining (NJ) tree [47] and a Maximum Parsimony (MP) tree [48]. The NJ tree was generated from a matrix of pairwise distances computed using the p-distance method. The MP tree with the shortest length was selected among ten independent MP searches, each initiated with a randomly generated starting tree. All evolutionary analyses were conducted in MEGA version 12 [49].

3. Results

3.1. Sample Collection and Pool Preparation

During sampling session, a total of 99 fecal samples were collected along 21 transects. Fifteen samples were excluded during processing due to advanced degradation or uncertain species attribution.
Samples were grouped into 26 pools: two pools of roe deer, four of fallow deer, three of red deer, four of red foxes, four of wolves, four of badgers, four of small mustelids, and one of porcupines.

3.2. PCR Results

PCR performed on the nucleic acids extracted from fecal samples pool returned with the following results: out of the 26 fecal pools tested, ten pools (38.5%) were positive for at least one viral target. Viral RNA or DNA were detected in multiple species, including red deer (two/three pools), red foxes (three/four pools), wolves (two/four pools), small mustelids (two/four pools), and porcupine (one/one pool). In contrast, all pools from roe deer, fallow deer, and badgers tested negative for the entire panel of viral targets.
Among the viruses investigated, Astrovirus spp. was the most frequently detected, found in red deer (two/three pools), red foxes (three/four pools), wolves (one/four pools), small mustelids (one/four pools), and porcupine (one/one pool). Several additional viruses were identified in red foxes, including bocavirus, Canine parvovirus (CPV), Kobuvirus, Adenovirus type 1 (CAdV-1), and Coronavirus, each detected in one pool. In wolves, Kobuvirus was also found in one pool, while adenovirus was the only additional virus detected in small mustelids (two/four pools).
No pools tested positive for Canine distemper virus (CDV), Bovine viral diarrhea virus (BVDV), Bovine papillomavirus (BPV), Canine circovirus, or Torque teno viruses (TTV1 and TTV2).
A detailed analysis of the positive pools revealed specific associations between viral targets and host species. Astrovirus was the most frequently detected virus, observed in multiple species. Several other viral agents were identified in red foxes, wolves, and small mustelids.

3.2.1. GenBank Submission and BLAST Analysis

All confirmed positive PCR amplified sequences were submitted to GenBank. Table 2 lists accession numbers alongside BLAST results, including the closest match, nucleotide identity percentage, and E-value.

3.2.2. Phylogenetic Analysis

Phylogenetic analyses were performed for viral species for which PCR amplification yielded sequences of sufficient length and informative content. The resulting trees (Figure 2) showed that the detected strains clustered within the expected lineages, confirming their taxonomic assignment. For other viruses, the available amplicons were too short or lacked adequate phylogenetically informative regions, preventing reliable analysis.
Phylogenetic analysis of Mamastrovirus, Mastadenovirus, Bocaporvovirus, Kobuvirus and Canine coronavirus are presented along with their number of nucleotide analysed and protein fragment name. Accession numbers are reported together with the corresponding host species, country of origin, and year of sequence submission. Taxonomic classification follows the information reported in the respective GenBank records. Sequences newly identified in this study are underlined. BLAST analyses were performed for these sequences and were restricted to taxa as indicated in the panel.

3.3. Metagenomic Analysis

Metagenomic analysis was performed on 4 red fox pools. Pools were selected based on PCR results, with red foxes chosen due to their high positivity rate and limited virological data in the literature. Table 3 present the total reads, the percentage of classified vs. unclassified reads, and the taxonomic breakdown. Among classified reads, the vast majority (76–98%) belonged to Bacteria (taxid: 2), while viral reads (Viruses, taxid: 10,239) represented 0.4–2%.

In-Depth Bioinformatic Analysis

Further analyses were conducted using Geneious Prime®, aiming to refine viral identification from the metagenomic datasets. Sequencing reads were compared against two custom viral databases constructed through the NCBI Virus portal: one comprising all known viral sequences isolated from mammals (TaxID: 40674, excluding Homo sapiens viral sequence not related to zoonotic potential, as of 21 October 2022), and another including viruses known to infect birds (TaxID: 8782). The bird database was included to identify potential avian viruses circulating within wild bird populations, considering that the sampled material could have originated from bird predators. The mammalian virus database contained 470,053 sequences and 1033 complete reference genomes, while the avian virus database included 297,656 sequences and 212 complete reference genomes.
Reads were aligned to the reference genomes within these databases to generate consensus sequences, each representing a potential viral fragment identified in the sample. For each consensus sequence, the following parameters were recorded: total consensus length, percentage of reference genome coverage, number of identical sites, pairwise identity, and BLAST E-value.
To ensure reliability and reduce background noise, only consensus sequences meeting strict filtering criteria were retained for further interpretation. Specifically, retained sequences were required to be longer than 150 base pairs, to present more than 75% identical sites, a pairwise identity above 80%, and a BLAST E-value less than or equal to 10−100. [46]. These thresholds were set to minimize false positives and to focus the analysis on highly confident viral identifications. Sequences that did not match the reference sequences present in the database were discarded. Non-matching sequences were excluded based on the comparison with the database.
Table 4 presents these results in detail.

4. Discussion

For the aim of this research a systematic sampling design was implemented across the PNFC, based on predefined transects. This systematic framework, combined with a pooling strategy, optimized data collection and enabled an ecosystem-level assessment of viral circulation throughout the park, ensuring even spatial coverage of the study area. The park’s high biodiversity, ecological continuity, heterogeneous habitats, and limited anthropogenic disturbance made it particularly suitable for this approach. The main limitations concerned the quality and freshness of fecal samples, which were influenced by environmental factors such as temperature, precipitation, snow cover, and leaf litter. Deposition sites also affected sample integrity, particularly in relation to potential environmental contamination. However, such contamination was not considered a limiting factor in this context, as the study aimed to characterize the ecosystem virome rather than evaluate the health status of individual animals. In our study, viral pathogens strictly associated with Homo sapiens were excluded, as they are not relevant to the natural virome dynamics within the study area. However, zoonotic agents potentially shared between wildlife and humans were retained, given their ecological and epidemiological importance at the wildlife–human interface. The inclusion of the bird database was motivated by the need to obtain a comprehensive overview of the ecosystem virome. Considering that many mammalian predators regularly prey upon avian species, this approach allowed the detection of viral sequences potentially originating from Aves, thereby providing a more complete picture of viral diversity across trophic levels.
The integration of conventional PCR screening with metagenomic next-generation sequencing (NGS) enhanced viral detection, combining the high sensitivity of targeted assays with the broad exploratory capacity of untargeted methods. This dual approach provided a more comprehensive understanding of viral diversity in wildlife. Red foxes, being widespread and opportunistic feeders proved particularly informative, confirming their role as sentinel species for ecosystem and zoonotic health surveillance [5,7,12,50,51].
The viruses identified belonged mainly to the families Astroviridae, Picornaviridae (Kobuvirus), Parvoviridae (CPV, Bocavirus, AAV), Adenoviridae, Circoviridae, Anelloviridae, and Picobirnaviridae. The main findings for each viral family are discussed below.

4.1. Astroviridae

Astroviruses (family Astroviridae) are viruses detected in a wide range of domestic and wild hosts. They are classically associated with gastroenteritis, especially in young animals, but recent studies have also reported extra-intestinal infections, such as encephalitis and respiratory involvement, and a potential for cross-species transmission [46,52]. In the Tuscany region, which is characterized by high wildlife biodiversity and a dense population of wild ungulates, metagenomic investigations have identified astrovirus as one of the most frequently detected viral agents in fecal samples from wild mammals, including wild boar, foxes, and mustelids [46]. These findings suggest that Tuscan wildlife may act as an important reservoir of astroviruses, with implications for wildlife health surveillance, zoonotic risk assessment, and conservation. Although the full pathogenic and epidemiological roles of astroviruses in natural environments remain unclear, their detection across multiple species supports their relevance within a One Health framework. Astrovirus was the most widespread virus detected, found in deer, foxes, wolves, porcupines, and small mustelids. These findings expand the known host range in Europe [19,20,53,54,55]. Although some sequences may reflect dietary origin, sequences obtained from fox pools showed high homology with Bovine astrovirus, the consistent detection across taxa supports the presence of astroviruses in the environment and highlights their ecological importance in wildlife viral dynamics.
To date, there are no published reports of Astrovirus infection in wolves, European porcupines (Hystrix cristata), or the small mustelid species sampled, including weasel (Mustela nivalis), beech marten (Martes foina), pine marten (Martes martes), and polecat (Mustela putorius), making our findings the first documented detections in these species.
In general, the relatively low sequence identity with known astrovirus strains suggests the circulation of divergent or novel lineages within the PNFC ecosystem.

4.2. Picornaviridae

Kobuviruses (genus Kobuvirus, family Picornaviridae) are non-enveloped, single-stranded positive-sense RNA viruses that have been detected in a wide range of domestic and wild mammals and are increasingly recognized as enteric pathogens. These viruses have been associated with diarrhoea in cattle, pigs, goats and wildlife, and molecular surveys in Italy have detected kobuvirus RNA in wild ungulates including roe deer, suggesting a multi-host interface and possible wildlife reservoir role [56]. Although the clinical impact in many wildlife species remains poorly defined, their detection in overlapping habitats of livestock and wild fauna underscores their relevance to animal health, surveillance and conservation.
Kobuviruses were detected in foxes and wolves, consistent with previous Italian reports [56,57,58,59,60].
In our study, sequences obtained in foxes by positive PCR analysis showed high nucleotide identity with Canine kobuvirus (CaKoV), particularly with those previously identified in Italian foxes.
The wolf kobuvirus sequence showed high similarity to porcine kobuvirus, suggesting dietary origin and implying the circulation of this virus in wild suids. The detection of kobuviruses in multiple carnivore species supports their broad host range and highlights predator-prey viral transmission as an important pathway for viral maintenance in natural ecosystems.

4.3. Adenoviridae

Adenoviruses (family Adenoviridae) are viruses that infect a broad spectrum of vertebrate hosts, including mammals, birds, and reptiles. They are typically associated with respiratory, ocular, and gastrointestinal infections, though some species can cause systemic disease and mortality in wildlife populations. Molecular studies in Europe have identified adenovirus DNA in several wild mammals, including deer, wild boar, and carnivores, suggesting a wide host range and possible interspecies transmission [2]. In Italy, adenoviruses have been detected in wild ungulates and carnivores, including samples from Tuscany, where viromic analyses highlighted their presence in fecal material from hospitalized wildlife [46].
By metagenomic analyses and PCR assays using Adenovirus spp generic primers, sequences related to Squirrel adenovirus (SqAdV) and rodent Mastadenovirus (MAdV), were detected.
In recent years, SqAdV has gained increasing relevance due to the expansion of its geographical range across several European regions and its impact on the health of the Eurasian red squirrel (Sciurus vulgaris), with significant implications for conservation and reintroduction programs targeting this protected species [61,62,63,64,65,66]. The presence of squirrel adenovirus (SqAdV-1) in fox feces likely reflects predation but has conservation relevance for the local red squirrel population, representing a potential warning sign for the red squirrel population inhabiting the study area. Such detection may highlight a health issue that is difficult to identify by other means, as the infection does not typically produce easily recognizable clinical signs and, in natural environments, carcasses of deceased animals are rapidly removed by predators or scavengers. The detection of rodent-like adenoviruses in mustelids [67] may also indicate dietary origin or potential host adaptation, underlining the value of metagenomics for detecting cross-species viral events.

4.4. Parvoviridae

Parvoviruses (family Parvoviridae, subfamily Parvovirinae) are small, non-enveloped, single-stranded DNA viruses infecting a wide range of vertebrate hosts. They are known for their high environmental stability and for causing severe diseases, including enteritis, myocarditis, and reproductive disorders, particularly in carnivores and ungulates [31,46]. Recent molecular investigations have revealed the circulation of diverse parvovirus lineages in European wildlife, including red foxes (Vulpes vulpes), wild boar (Sus scrofa), and roe deer (Capreolus capreolus), indicating the presence of sylvatic reservoirs. In Italy, and specifically in Tuscany, parvoviruses have been detected through metagenomic analyses of fecal samples from hospitalized wild mammals [46].
Foxes carried multiple parvoviruses—Canine parvovirus (CPV-2c), Bocavirus, and Adeno-Associated virus (AAV)—highlighting frequent viral exchanges between wild and domestic carnivores [12,31,68,69,70,71,72,73,74]. The co-detection of adenoviruses and AAV within the same pool suggests possible co-infection, while the divergent bocavirus sequences indicate continued viral diversification among wild carnivores. These findings emphasize the interface between domestic and wildlife populations as key zones for viral evolution and spillover. Within the Parvoviridae family, a sequence corresponding to Fox adeno-associated virus, a novel adeno-associated virus (AAV) was identified in a fox fecal sample by NGS methodology [12]. Fox AAV was detected in a pool in which two adenoviruses (Squirrel adenovirus and an Aviadenovirus) were also present; it would therefore be of interest to determine whether these viruses occurred in the same individual and whether Fox AAV was actively replicating. Several AAV serotypes have been isolated from birds and a wide range of mammalian species, including humans, but they have not been associated with clinical disease [75]. Bocaparvovirus is a member of the Parvovirinae subfamily and has been reported in humans as well as in a wide range of domestic and wild species [76,77,78,79,80]. In our study, the sequence obtained displayed significant homology with both Feline bocaparvovirus 3 and Lupine bocavirus, suggesting the circulation of divergent strains in wild carnivores and warranting further investigations for accurate classification.
Sequences belonging to the families Circoviridae, Anelloviridae, and Picobirnaviridae were also identified, mostly in fox feces. Many of these sequences likely originated from dietary or environmental sources rather than active infections. Nevertheless, their presence underscores the complex viral landscape within the PNFC. Viruses such as torque teno viruses and porcine circovirus-like sequence may serve as environmental indicators or markers of interspecies viral exchange within the ecosystem.
Our results reveal notable differences compared with recent studies on wildlife admitted to the Veterinary Teaching Hospital of the University of Pisa after recovery from the surrounding province [46,81]. In the Pisa area, fewer viral taxa were detected, but with higher prevalence rates, whereas in the PNFC we found a wider viral diversity, though at lower prevalence. These contrasting patterns can be explained by the ecological characteristics of the two study areas. The province of Pisa has lower biodiversity and highly fragmented habitats, where wild animals live at higher population densities. This situation may promote the circulation and higher prevalence of specific pathogens. In contrast, the PNFC hosts greater biodiversity and large, continuous habitats, which likely allow the coexistence of multiple viral species but limit their widespread transmission.
A notable difference emerged between conventional PCR and metagenomic sequencing applied to the same samples. Several viral targets detected by PCR were not confirmed by metagenomics, reflecting the methodological differences between the two approaches. PCR remains highly sensitive and specific for known targets, whereas metagenomic workflows, such as SISPA, rely on random amplification that can bias genome coverage and favor abundant viral genomes, thus limiting the recovery of complete or less represented sequences [82].
Despite these limitations, metagenomics proved to be a powerful complementary approach, allowing the detection of unexpected or previously unreported viruses that would have been missed by targeted PCR screening. The combined use of conventional and next-generation molecular methods expanded the range of detectable viruses, enabling the identification of both known pathogens—sometimes underrepresented in the population—and novel or unexpected viral agents. Interestingly, most viral sequences were obtained from carnivorous or scavenging species. This pattern likely reflects not only their own viral infections but also those of their prey or other sympatric species. The greater number of viral sequences found in carnivores and scavengers likely reflects their feeding ecology. As predators and consumers of carcasses, these species are in frequent contact with tissues and bodily fluids of various prey species, which may harbor diverse viruses. Consequently, viral sequences derived from prey can be detected in their fecal samples, contributing to the apparent higher viral diversity observed in these trophic groups. These findings highlight the ecological value of the selected sample type, which provided insights into pathogens affecting the sampled hosts as well as those circulating more broadly within the ecosystem. The detection of viruses typically associated with domestic animals in wildlife emphasizes the permeability of ecological boundaries and underscores the importance of continued surveillance within a One Health framework. Non-invasive monitoring of wildlife viromes provides early warning signals for emerging zoonoses and contributes to biodiversity conservation by revealing ecosystem changes that influence host–pathogen dynamics. Strengthening such approaches in protected areas can help anticipate and mitigate the risk of disease emergence.

5. Conclusions

This study demonstrated the effectiveness of a non-invasive approach based on environmental fecal sampling for virological surveillance of wildlife in a high-biodiversity ecosystem such as the PNFC. The integration of conventional molecular techniques and metagenomic analyses enabled the detection of a wide range of viruses, including known pathogens, emerging viruses, and agents not previously reported in certain host species or in Italy. The findings confirm the central role of carnivorous and scavenging species, such as the red fox, as ecological sentinels capable of reflecting viral circulation at the community level. The presence of viruses typically associated with domestic species suggests potential interactions between wildlife and anthropogenic environments, with implications for both animal and public health. Moreover, the detection of viruses considered non-pathogenic or of unknown impact highlights the need to deepen our understanding of host–virus dynamics in natural settings. From a One Health perspective, ongoing monitoring of the wildlife virome represents a crucial tool for anticipating and mitigating the risks associated with the emergence of new infectious diseases.

Author Contributions

Conceptualization, M.I.P., M.F. and M.M.; methodology, M.I.P., M.F. and M.M.; investigation, M.I.P., M.F. and M.M.; resources, M.F. and M.M.; writing—original draft preparation, M.I.P.; writing—review and editing, M.I.P., M.F. and M.M. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by Fondi Ateneo (2020/21) Università di Pisa.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in this study are included in the article. Further inquiries can be directed to the corresponding author.

Acknowledgments

This study was conducted with the collaboration of the Parco Nazionale delle Foreste Casentinesi, based on the scientific cooperation agreement between the Department of Veterinary Science at the University of Pisa and the Parco Nazionale delle Foreste Casentinesi, Monte Falterona e Campigna (Framework Agreement for Scientific Collaboration, Rep. 728 dated 26 February 2021—Accordo Quadro collaborazione scientifica tra il Dipartimento di Scienze Veterinarie dell’Università di Pisa e l’Ente Parco Nazionale delle Foreste Casentinesi).

Conflicts of Interest

The authors declare no conflicts of interest.

Abbreviations

CPVCanine parvovirus
CAdV-1Canine adenovirus type 1
CDVCanine distemper virus
BVDVBovine viral diarrhea virus
BPVBovine papillomavirus
CCoVCanine circovirus
TTV1 and TTV2Torque teno viruses
AdVAdenovirus
RAdVRodent Adenovirus
MAdVMastadenovirus
PMWSPostweaning multisystemic wasting syndrome
RMAdVRodent Mastadenovirus
SqAdvSquirrel adenovirus
CAsVCanine astrovirus
BoVBokaviru
KoVKobuvirus
CaKoVCanine Kobuvirus
CcAstVCapreolus capreolus astrovirus
WMSWet Mink Syndrome
LAdV-1Lutrine adenovirus
PBVPicobirnavirus
PCVPorcine circovirus
PNFCParco Nazionale Foreste Casentinesi

Appendix A

Bibliographic reference of studied viruses
AdVPVBoVCVTTVVAstVCoVPeVBPVMoVRef.
Roe deerAdV spp.-BPV spp.--KoV spp.AstV spp.CoV spp.BVDVBPV spp.-[19,53,83,84,85,86,87,88,89,90,91]
Fallow deerAdV spp.-BPV spp.--KoV spp.AstV spp.CoV spp.BVDVBPV spp.-
Red deerAdV spp.-BPV spp.--KoV spp.AstV spp.CoV spp.BVDVBPV spp.-
Red foxCAdV 1,2
AdV spp.		CPV
FPV		CBoV 1,2,3
BPV spp.		CCV-KoV spp.AstV spp.CoV spp.--CDV[12,24,54,57,69,92,93,94,95,96,97,98,99]
WolfCAdV 1,2
AdV spp.		CPV
FPV		LBoV
CBoV 1,2,3
BPV spp.		CCV-KoV spp.AstV spp.CoV spp.--CDV[24,58,68,69,93,99,100,101]
BadgerCAdV 1,2
AdV spp.		CPV
FPV		BPV spp.-TTV 1,2KoV spp.AstV spp.CoV spp.--CDV[67,69,76,92,95,102,103,104,105,106,107,108,109]
Small mustelidsCAdV 1,2
AdV spp.		CPV
FPV		BPV spp.-TTV 1,2KoV spp.AstV spp.CoV spp.--CDV
PorcupineAdV spp.-BPV spp.--KoV spp.AstV spp.CoV spp.---[14,54,66,104,110,111]

References

  1. Daszak, P.; Cunningham, A.A.; Hyatt, A.D. Emerging Infectious Diseases of Wildlife—Threats to Biodiversity and Human Health. Science 2000, 287, 443–449. [Google Scholar] [CrossRef]
  2. Kock, R. Drivers of Disease Emergence and Spread: Is Wildlife to Blame? Onderstepoort J. Vet. Res. 2014, 81, 1–4. [Google Scholar] [CrossRef]
  3. Mazzarone, V.; Ferretti, M.; Mattioli, L. Report Sulla Gestione Degli Ungulati in Toscana. In Proceedings of the La Gestione Degli Ungulati in Toscana dal 2000 al 2022, Fiesole, Italy, 29 May 2023. [Google Scholar]
  4. Shaheen, M.N.F. The Concept of One Health Applied to the Problem of Zoonotic Diseases. Rev. Med. Virol. 2022, 32, e2326. [Google Scholar] [CrossRef] [PubMed]
  5. Bradley, C.A.; Altizer, S. Urbanization and the Ecology of Wildlife Diseases. Trends Ecol. Evol. 2007, 22, 95–102. [Google Scholar] [CrossRef] [PubMed]
  6. Parrish, C.R.; Holmes, E.C.; Morens, D.M.; Park, E.-C.; Burke, D.S.; Calisher, C.H.; Laughlin, C.A.; Saif, L.J.; Daszak, P. Cross-Species Virus Transmission and the Emergence of New Epidemic Diseases. Microbiol. Mol. Biol. Rev. 2008, 72, 457–470. [Google Scholar] [CrossRef]
  7. Garcês, A.; Pires, I. Secrets of the Astute Red Fox (Vulpes vulpes, Linnaeus, 1758): An Inside-Ecosystem Secret Agent Serving One Health. Environments 2021, 8, 103. [Google Scholar] [CrossRef]
  8. Wobeser, G.A. Disease in Wild Animals; Springer: Berlin/Heidelberg, Germany, 2007; ISBN 978-3-540-48974-0. [Google Scholar]
  9. Breed, D.; Meyer, L.C.R.; Steyl, J.C.A.; Goddard, A.; Burroughs, R.; Kohn, T.A. Conserving Wildlife in a Changing World: Understanding Capture Myopathy—A Malignant Outcome of Stress during Capture and Translocation. Conserv. Physiol. 2019, 7, coz027. [Google Scholar] [CrossRef]
  10. Sarchese, V.; Fruci, P.; Palombieri, A.; Di Profio, F.; Robetto, S.; Ercolini, C.; Orusa, R.; Marsilio, F.; Martella, V.; Di Martino, B. Molecular Identification and Characterization of a Genotype 3 Hepatitis E Virus (HEV) Strain Detected in a Wolf Faecal Sample, Italy. Animals 2021, 11, 3465. [Google Scholar] [CrossRef]
  11. Li, L.; Shan, T.; Wang, C.; Côté, C.; Kolman, J.; Onions, D.; Gulland, F.M.D.; Delwart, E. The Fecal Viral Flora of California Sea Lions. J. Virol. 2011, 85, 9909–9917. [Google Scholar] [CrossRef] [PubMed]
  12. Bodewes, R.; Van Der Giessen, J.; Haagmans, B.L.; Osterhaus, A.D.M.E.; Smits, S.L. Identification of Multiple Novel Viruses, Including a Parvovirus and a Hepevirus, in Feces of Red Foxes. J. Virol. 2013, 87, 7758–7764. [Google Scholar] [CrossRef]
  13. Bergner, L.M.; Orton, R.J.; Da Silva Filipe, A.; Shaw, A.E.; Becker, D.J.; Tello, C.; Biek, R.; Streicker, D.G. Using Noninvasive Metagenomics to Characterize Viral Communities from Wildlife. Mol. Ecol. Resour. 2019, 19, 128–143. [Google Scholar] [CrossRef] [PubMed]
  14. Phan, T.G.; Kapusinszky, B.; Wang, C.; Rose, R.K.; Lipton, H.L.; Delwart, E.L. The Fecal Viral Flora of Wild Rodents. PLoS Pathog. 2011, 7, e1002218. [Google Scholar] [CrossRef]
  15. Ao, Y.; Xu, J.; Duan, Z. A Novel Cardiovirus Species Identified in Feces of Wild Himalayan Marmots. Infect. Genet. Evol. 2022, 103, 105347. [Google Scholar] [CrossRef]
  16. Arumugam, R.; Uli, J.E.; Annavi, G. A Review of the Application of Next Generation Sequencing (NGS) in Wild Terrestrial Vertebrate Research. ARRB 2019, 31, 1–9. [Google Scholar] [CrossRef]
  17. Mokili, J.L.; Rohwer, F.; Dutilh, B.E. Metagenomics and Future Perspectives in Virus Discovery. Curr. Opin. Virol. 2012, 2, 63–77. [Google Scholar] [CrossRef]
  18. Reuter, G.; Nemes, C.; Boros, Á.; Kapusinszky, B.; Delwart, E.; Pankovics, P. Astrovirus in Wild Boars (Sus scrofa) in Hungary. Arch. Virol. 2012, 157, 1143–1147. [Google Scholar] [CrossRef]
  19. Jamnikar-Ciglenecki, U.; Civnik, V.; Kirbis, A.; Kuhar, U. A Molecular Survey, Whole Genome Sequencing and Phylogenetic Analysis of Astroviruses from Roe Deer. BMC Vet. Res. 2020, 16, 68. [Google Scholar] [CrossRef]
  20. Tzipori, S.; Menzies, J.; Gray, E. Detection of Astrovirus in the Faeces of Red Deer. Vet. Rec. 1981, 108, 286. [Google Scholar] [CrossRef] [PubMed]
  21. Ganesh, B.; Masachessi, G.; Mladenova, Z. Animal Picobirnavirus. VirusDisease 2014, 25, 223–238. [Google Scholar] [CrossRef]
  22. Masachessi, G.; Martínez, L.C.; Giordano, M.O.; Barril, P.A.; Isa, B.M.; Ferreyra, L.; Villareal, D.; Carello, M.; Asis, C.; Nates, S.V. Picobirnavirus (PBV) Natural Hosts in Captivity and Virus Excretion Pattern in Infected Animals. Arch. Virol. 2007, 152, 989–998. [Google Scholar] [CrossRef] [PubMed]
  23. McInnes, J.C.; Alderman, R.; Deagle, B.E.; Lea, M.; Raymond, B.; Jarman, S.N. Optimised Scat Collection Protocols for Dietary DNA Metabarcoding in Vertebrates. Methods Ecol. Evol. 2017, 8, 192–202. [Google Scholar] [CrossRef]
  24. Whittaker, G.; Stout, A. Coronaviruses in Wild Canids: A Review of the Literature; Qeios: London, UK, 2022. [Google Scholar]
  25. Allison, A.B.; Kohler, D.J.; Fox, K.A.; Brown, J.D.; Gerhold, R.W.; Shearn-Bochsler, V.I.; Dubovi, E.J.; Parrish, C.R.; Holmes, E.C. Frequent Cross-Species Transmission of Parvoviruses among Diverse Carnivore Hosts. J. Virol. 2013, 87, 2342–2347. [Google Scholar] [CrossRef]
  26. Stallknecht, D.E. Impediments to Wildlife Disease Surveillance, Research, and Diagnostics. In Wildlife and Emerging Zoonotic Diseases: The Biology, Circumstances and Consequences of Cross-Species Transmission; Childs, J.E., Mackenzie, J.S., Richt, J.A., Eds.; Current Topics in Microbiology and Immunology; Springer: Berlin/Heidelberg, Germany, 2007; Volume 315, pp. 445–461. ISBN 978-3-540-70961-9. [Google Scholar]
  27. Ochola, G.O.; Li, B.; Obanda, V.; Ommeh, S.; Ochieng, H.; Yang, X.-L.; Onyuok, S.O.; Shi, Z.-L.; Agwanda, B.; Hu, B. Discovery of Novel DNA Viruses in Small Mammals from Kenya. Virol. Sin. 2022, 37, 491–502. [Google Scholar] [CrossRef]
  28. Wellehan, J.F.X.; Johnson, A.J.; Harrach, B.; Benkö, M.; Pessier, A.P.; Johnson, C.M.; Garner, M.M.; Childress, A.; Jacobson, E.R. Detection and Analysis of Six Lizard Adenoviruses by Consensus Primer PCR Provides Further Evidence of a Reptilian Origin for the Atadenoviruses. J. Virol. 2004, 78, 13366–13369. [Google Scholar] [CrossRef]
  29. Hu, R.L.; Huang, G.; Qiu, W.; Zhong, Z.H.; Xia, X.Z.; Yin, Z. Detection and Differentiation of CAV-1 and CAV-2 by Polymerase Chain Reaction. Vet. Res. Commun. 2001, 25, 77–84. [Google Scholar] [CrossRef]
  30. Schatzberg, S.J.; Haley, N.J.; Barr, S.C.; Parrish, C.; Steingold, S.; Summers, B.A.; Delahunta, A.; Kornegay, J.N.; Sharp, N.J.H. Polymerase Chain Reaction (PCR) Amplification of Parvoviral DNA from the Brains of Dogs and Cats with Cerebellar Hypoplasia. Wiley Online Libr. 2003, 17, 538–544. [Google Scholar] [CrossRef]
  31. Ndiana, L.A.; Lanave, G.; Desario, C.; Berjaoui, S.; Alfano, F.; Puglia, I.; Fusco, G.; Colaianni, M.L.; Vincifori, G.; Camarda, A.; et al. Circulation of Diverse Protoparvoviruses in Wild Carnivores, Italy. Transbound. Emerg. Dis. 2021, 68, 2489–2502. [Google Scholar] [CrossRef]
  32. Lau, S.K.P.; Woo, P.C.Y.; Yeung, H.C.; Teng, J.L.L.; Wu, Y.; Bai, R.; Fan, R.Y.Y.; Chan, K.H.; Yuen, K.Y. Identification and Characterization of Bocaviruses in Cats and Dogs Reveals a Novel Feline Bocavirus and a Novel Genetic Group of Canine Bocavirus. J. Gen. Virol. 2012, 93, 1573–1582. [Google Scholar] [CrossRef] [PubMed]
  33. Kapoor, A.; Mehta, N.; Dubovi, E.J.; Simmonds, P.; Govindasamy, L.; Medina, J.L.; Street, C.; Shields, S.; Ian Lipkin, W. Characterization of Novel Canine Bocaviruses and Their Association with Respiratory Disease. J. General. Virol. 2012, 93, 341–346. [Google Scholar] [CrossRef] [PubMed]
  34. Li, L.; Pesavento, P.A.; Leutenegger, C.M.; Estrada, M.; Coffey, L.L.; Naccache, S.N.; Samayoa, E.; Chiu, C.; Qiu, J.; Wang, C.; et al. A Novel Bocavirus in Canine Liver. Virol. J. 2013, 10, 54. [Google Scholar] [CrossRef] [PubMed]
  35. Conceição-Neto, N.; Godinho, R.; Álvares, F.; Yinda, C.K.; Deboutte, W.; Zeller, M.; Laenen, L.; Heylen, E.; Roque, S.; Petrucci-Fonseca, F.; et al. Viral Gut Metagenomics of Sympatric Wild and Domestic Canids, and Monitoring of Viruses: Insights from an Endangered Wolf Population. Ecol. Evol. 2017, 7, 4135–4146. [Google Scholar] [CrossRef]
  36. Balboni, A.; Urbani, L.; Delogu, M.; Musto, C.; Fontana, M.C.; Merialdi, G.; Lucifora, G.; Terrusi, A.; Dondi, F.; Battilani, M. Integrated Use of Molecular Techniques to Detect and Genetically Characterise Dna Viruses in Italian Wolves (Canis lupus italicus). Animals 2021, 11, 2198. [Google Scholar] [CrossRef]
  37. Segalés, J.; Martínez-Guinó, L.; Cortey, M.; Navarro, N.; Huerta, E.; Sibila, M.; Pujols, J.; Kekarainen, T. Retrospective Study on Swine Torque Teno Virus Genogroups 1 and 2 Infection from 1985 to 2005 in Spain. Vet. Microbiol. 2009, 134, 199–207. [Google Scholar] [CrossRef]
  38. Reuter, G.; Boldizsár, Á.; Pankovics, P. Complete Nucleotide and Amino Acid Sequences and Genetic Organization of Porcine Kobuvirus, a Member of a New Species in the Genus Kobuvirus, Family Picornaviridae. Arch. Virol. 2009, 154, 101–108. [Google Scholar] [CrossRef] [PubMed]
  39. Chu, D.K.W.; Poon, L.L.M.; Guan, Y.; Peiris, J.S.M. Novel Astroviruses in Insectivorous Bats. J. Virol. 2008, 82, 9107. [Google Scholar] [CrossRef] [PubMed]
  40. Chu, D.K.W.; Leung, C.Y.H.; Gilbert, M.; Joyner, P.H.; Ng, E.M.; Tse, T.M.; Guan, Y.; Peiris, J.S.M.; Poon, L.L.M. Avian Coronavirus in Wild Aquatic Birds. J. Virol. 2011, 85, 12815–12820. [Google Scholar] [CrossRef] [PubMed]
  41. Vilček, S.; Herring, A.J.; Herring, J.A.; Nettleton, P.F.; Lowings, J.P.; Paton, D.J. Pestiviruses Isolated from Pigs, Cattle and Sheep Can Be Allocated into at Least Three Genogroups Using Polymerase Chain Reaction and Restriction Endonuclease Analysis. Arch. Virol. 1994, 136, 309–323. [Google Scholar] [CrossRef]
  42. László, Z.; Pankovics, P.; Reuter, G.; Cságola, A.; Bálint, Á.; Albert, M.; Boros, Á. Multiple Types of Novel Enteric Bopiviruses (Picornaviridae) with the Possibility of Interspecies Transmission Identified from Cloven-Hoofed Domestic Livestock (Ovine, Caprine and Bovine) in Hungary. Viruses 2021, 13, 66. [Google Scholar] [CrossRef]
  43. Reyes, G.R.; Kim, J.P. Sequence-Independent, Single-Primer Amplification (SISPA) of Complex DNA Populations. Mol. Cell. Probes 1991, 5, 473–481. [Google Scholar] [CrossRef]
  44. Chrzastek, K.; Lee, D.; Smith, D.; Sharma, P.; Suarez, D.L.; Pantin-Jackwood, M.; Kapczynski, D.R. Use of Sequence-Independent, Single-Primer-Amplification (SISPA) for Rapid Detection, Identification, and Characterization of Avian RNA Viruses. Virology 2017, 509, 159–166. [Google Scholar] [CrossRef]
  45. Wood, D.E.; Lu, J.; Langmead, B. Improved Metagenomic Analysis with Kraken 2. Genome Biol. 2019, 20, 257. [Google Scholar] [CrossRef]
  46. Pacini, M.I.; Forzan, M.; Sgorbini, M.; Cingottini, D.; Mazzei, M. Metagenomic Analysis of the Fecal Virome in Wild Mammals Hospitalized in Pisa, Italy. Vet. Sci. 2025, 12, 820. [Google Scholar] [CrossRef] [PubMed]
  47. Saitou, N.; Nei, M. The Neighbor-Joining Method: A New Method for Reconstructing Phylogenetic Trees. Mol. Biol. Evol. 1987, 4, 406–425. [Google Scholar] [CrossRef]
  48. Tamura, K.; Nei, M. Estimation of the Number of Nucleotide Substitutions in the Control Region of Mitochondrial DNA in Humans and Chimpanzees. Mol. Biol. Evol. 1993, 10, 512–526. [Google Scholar] [CrossRef] [PubMed]
  49. Kumar, S.; Stecher, G.; Suleski, M.; Sanderford, M.; Sharma, S.; Tamura, K. MEGA12: Molecular Evolutionary Genetic Analysis Version 12 for Adaptive and Green Computing. Mol. Biol. Evol. 2024, 41, msae263. [Google Scholar] [CrossRef]
  50. Corsolini, S.; Burrini, L.; Focardi, S.; Lovari, S. How Can We Use the Red Fox as a Bioindicator of Organochlorines? Arch. Environ. Contam. Toxicol. 2000, 39, 547–556. [Google Scholar] [CrossRef] [PubMed]
  51. Campbell, S.J.; Ashley, W.; Gil-Fernandez, M.; Newsome, T.M.; Di Giallonardo, F.; Ortiz-Baez, A.S.; Mahar, J.E.; Towerton, A.L.; Gillings, M.; Holmes, E.C.; et al. Red Fox Viromes in Urban and Rural Landscapes. Virus Evol. 2020, 6, veaa065. [Google Scholar] [CrossRef]
  52. Moser, L.A.; Schultz-Cherry, S. Pathogenesis of Astrovirus Infection. Viral Immunol. 2005, 18, 4–10. [Google Scholar] [CrossRef]
  53. Smits, S.L.; Van Leeuwen, M.; Kuiken, T.; Hammer, A.S.; Simon, J.H.; Osterhaus, A.D.M.E. Identification and Characterization of Deer Astroviruses. J. Gen. Virol. 2010, 91, 2719–2722. [Google Scholar] [CrossRef]
  54. Hu, B.; Chmura, A.A.; Li, J.; Zhu, G.; Desmond, J.S.; Zhang, Y.; Zhang, W.; Epstein, J.H.; Daszak, P.; Shi, Z. Detection of Diverse Novel Astroviruses from Small Mammals in China. J. General. Virol. 2014, 95, 2442–2449. [Google Scholar] [CrossRef]
  55. Jakubczak, A.; Kowalczyk, M.; Mazurkiewicz, I.; Kondracki, M. Detection of Mink Astrovirus in Poland and Further Phylogenetic Comparison with Other European and Canadian Astroviruses. Virus Genes 2021, 57, 258–265. [Google Scholar] [CrossRef]
  56. Di Martino, B.; Di Profio, F.; Melegari, I.; Di Felice, E.; Robetto, S.; Guidetti, C.; Orusa, R.; Martella, V.; Marsilio, F. Molecular Detection of Kobuviruses in European Roe Deer (Capreolus capreolus) in Italy. Arch. Virol. 2015, 160, 2083–2086. [Google Scholar] [CrossRef] [PubMed]
  57. Di Martino, B.; Di Profio, F.; Melegari, I.; Robetto, S.; Di Felice, E.; Orusa, R.; Marsilio, F. Molecular Evidence of Kobuviruses in Free-Ranging Red Foxes (Vulpes vulpes). Arch. Virol. 2014, 159, 1803–1806. [Google Scholar] [CrossRef] [PubMed]
  58. Melegari, I.; Sarchese, V.; Di Profio, F.; Robetto, S.; Carella, E.; Bermudez Sanchez, S.; Orusa, R.; Martella, V.; Marsilio, F.; Di Martino, B. First Molecular Identification of Kobuviruses in Wolves (Canis lupus) in Italy. Arch. Virol. 2018, 163, 509–513. [Google Scholar] [CrossRef]
  59. Reuter, G.; Egyed, L. Bovine Kobuvirus in Europe. Emerg. Infect. Dis. 2009, 15, 822–823. [Google Scholar] [CrossRef] [PubMed]
  60. Reuter, G.; Boros, Á.; Pankovics, P. Kobuviruses—A Comprehensive Review. Rev. Med. Virol. 2011, 21, 32–41. [Google Scholar] [CrossRef]
  61. Everest, D.J.; Shuttleworth, C.M.; Stidworthy, M.F.; Grierson, S.S.; Duff, J.P.; Kenward, R.E. Adenovirus: An Emerging Factor in Red Squirrel Sciurus vulgaris Conservation. Mammal Rev. 2014, 44, 225–233. [Google Scholar] [CrossRef]
  62. Martínez-Jiménez, D.; Graham, D.; Couper, D.; Benkö, M.; Schöniger, S.; Gurnell, J.; Sainsbury, A.W. Epizootiology and Pathologic Findings Associated with A Newly Described Adenovirus in the Red Squirrel, Sciurus vulgaris. J. Wildl. Dis. 2011, 47, 442–454. [Google Scholar] [CrossRef]
  63. Romeo, C.; Ferrari, N.; Rossi, C.; Everest, D.J.; Grierson, S.S.; Lanfranchi, P.; Martinoli, A.; Saino, N.; Wauters, L.A.; Hauffe, H.C. Ljungan Virus and an Adenovirus in Italian Squirrel Populations. J. Wildl. Dis. 2014, 50, 409–411. [Google Scholar] [CrossRef]
  64. Côrte-Real, J.V.; Lopes, A.M.; Rebelo, H.; Paulo Lopes, J.; Amorim, F.; Pita, R.; Correia, J.; Melo, P.; Beja, P.; José Esteves, P.; et al. Adenovirus Emergence in a Red Squirrel (Sciurus vulgaris) in Iberian Peninsula. Transbound. Emerg. Dis. 2020, 67, 2300–2306. [Google Scholar] [CrossRef]
  65. Everest, D.J.; Shuttleworth, C.M.; Grierson, S.S.; Dastjerdi, A.; Stidworthy, M.F.; Duff, J.P.; Higgins, R.J.; Mill, A.; Chantrey, J. The Implications of Significant Adenovirus Infection in UK Captive Red Squirrel (Sciurus vulgaris) Collections: How Histological Screening Can Aid Applied Conservation Management. Mamm. Biol. 2018, 88, 123–129. [Google Scholar] [CrossRef]
  66. Wernike, K.; Wylezich, C.; Höper, D.; Schneider, J.; Lurz, P.W.W.; Meredith, A.; Milne, E.; Beer, M.; Ulrich, R.G. Widespread Occurrence of Squirrel Adenovirus 1 in Red and Grey Squirrels in Scotland Detected by a Novel Real-Time PCR Assay. Virus Research 2018, 257, 113–118. [Google Scholar] [CrossRef]
  67. Walker, D.; Gregory, W.F.; Turnbull, D.; Rocchi, M.; Meredith, A.L.; Philbey, A.W.; Sharp, C.P. Novel Adenoviruses Detected in British Mustelids, Including a Unique Aviadenovirus in the Tissues of Pine Martens (Martes martes). J. Med. Microbiol. 2017, 66, 1177–1182. [Google Scholar] [CrossRef]
  68. Molnar, B.; Duchamp, C.; Möstl, K.; Diehl, P.-A.; Betschart, B. Comparative Survey of Canine Parvovirus, Canine Distemper Virus and Canine Enteric Coronavirus Infection in Free-Ranging Wolves of Central Italy and South-Eastern France. Eur. J. Wildl. Res. 2014, 60, 613–624. [Google Scholar] [CrossRef]
  69. Calatayud, O.; Esperón, F.; Velarde, R.; Oleaga, Á.; Llaneza, L.; Ribas, A.; Negre, N.; Torre, A.; Rodríguez, A.; Millán, J. Genetic Characterization of Carnivore Parvoviruses in Spanish Wildlife Reveals Domestic Dog and Cat-related Sequences. Transbound. Emerg. Dis. 2020, 67, 626–634. [Google Scholar] [CrossRef] [PubMed]
  70. Truyen, U.; Müller, T.; Heidrich, R.; Tackmann, K.; Carmichael, L.E. Survey on Viral Pathogens in Wild Red Foxes (Vulpes vulpes) in Germany with Emphasis on Parvoviruses and Analysis of a DNA Sequence from a Red Fox Parvovirus. Epidemiol. Infect. 1998, 121, 433–440. [Google Scholar] [CrossRef]
  71. Amoroso, M.G.; Di Concilio, D.; D’Alessio, N.; Veneziano, V.; Galiero, G.; Fusco, G. Canine Parvovirus and Pseudorabies Virus Coinfection as a Cause of Death in a Wolf (Canis lupus) from Southern Italy. Vet. Med. Sci. 2020, 6, 600–605. [Google Scholar] [CrossRef]
  72. Canuti, M.; Todd, M.; Monteiro, P.; Van Osch, K.; Weir, R.; Schwantje, H.; Britton, A.P.; Lang, A.S. Ecology and Infection Dynamics of Multi-Host Amdoparvoviral and Protoparvoviral Carnivore Pathogens. Pathogens 2020, 9, 124. [Google Scholar] [CrossRef]
  73. Hoelzer, K.; Parrish, C.R. The Emergence of Parvoviruses of Carnivores. Vet. Res. 2010, 41, 39. [Google Scholar] [CrossRef]
  74. Sobrino, R.; Arnal, M.C.; Luco, D.F.; Gortázar, C. Prevalence of Antibodies against Canine Distemper Virus and Canine Parvovirus among Foxes and Wolves from Spain. Vet. Microbiol. 2008, 126, 251–256. [Google Scholar] [CrossRef]
  75. Berns, K.I.; Giraud, C. Biology of Adeno-Associated Virus. In Adeno-Associated Virus (AAV) Vectors in Gene Therapy; Berns, K.I., Giraud, C., Eds.; Current Topics in Microbiology and Immunology; Springer: Berlin/Heidelberg, Germany, 1996; Volume 218, pp. 1–23. ISBN 978-3-642-80209-6. [Google Scholar]
  76. Van Den Brand, J.M.A.; Van Leeuwen, M.; Schapendonk, C.M.; Simon, J.H.; Haagmans, B.L.; Osterhaus, A.D.M.E.; Smits, S.L. Metagenomic Analysis of the Viral Flora of Pine Marten and European Badger Feces. J. Virol. 2012, 86, 2360–2365. [Google Scholar] [CrossRef] [PubMed]
  77. Zhou, F.; Sun, H.; Wang, Y. Porcine Bocavirus: Achievements in the Past Five Years. Viruses 2014, 6, 4946–4960. [Google Scholar] [CrossRef]
  78. Yang, S.; Wang, Y.; Li, W.; Fan, Z.; Jiang, L.; Lin, Y.; Fu, X.; Shen, Q.; Sun, Z.; Wang, X.; et al. A Novel Bocavirus from Domestic Mink, China. Virus Genes 2016, 52, 887–890. [Google Scholar] [CrossRef]
  79. Manteufel, J.; Truyen, U. Animal Bocaviruses: A Brief Review. Intervirology 2008, 51, 328–334. [Google Scholar] [CrossRef]
  80. Niu, J.; Yi, S.; Wang, H.; Dong, G.; Zhao, Y.; Guo, Y.; Dong, H.; Wang, K.; Hu, G. Complete Genome Sequence Analysis of Canine Bocavirus 1 Identified for the First Time in Domestic Cats. Arch. Virol. 2019, 164, 601–605. [Google Scholar] [CrossRef]
  81. Pacini, M.I.; Mazzei, M.; Sgorbini, M.; D’Alfonso, R.; Papini, R.A. A One-Year Retrospective Analysis of Viral and Parasitological Agents in Wildlife Animals Admitted to a First Aid Hospital. Animals 2023, 13, 931. [Google Scholar] [CrossRef] [PubMed]
  82. Karlsson, O.E.; Belák, S.; Granberg, F. The Effect of Preprocessing by Sequence-Independent, Single-Primer Amplification (SISPA) on Metagenomic Detection of Viruses. Biosecur. Bioterror. Biodef. Strategy Pract. Sci. 2013, 11, S227–S234. [Google Scholar] [CrossRef] [PubMed]
  83. Tsunemitsu, H.; el-Kanawati, Z.R.; Smith, D.R.; Reed, H.H.; Saif, L.J. Isolation of Coronaviruses Antigenically Indistinguishable from Bovine Coronavirus from Wild Ruminants with Diarrhea. J. Clin. Microbiol. 1995, 33, 3264–3269. [Google Scholar] [CrossRef]
  84. Olde Riekerink, R.G.M.; Dominici, A.; Barkema, H.W.; De Smit, A.J. Seroprevalence of Pestivirus in Four Species of Alpine Wild Ungulates in the High Valley of Susa, Italy. Vet. Microbiol. 2005, 108, 297–303. [Google Scholar] [CrossRef]
  85. Huaman, J.L.; Pacioni, C.; Sarker, S.; Doyle, M.; Forsyth, D.M.; Pople, A.; Carvalho, T.G.; Helbig, K.J. Novel Picornavirus Detected in Wild Deer: Identification, Genomic Characterisation, and Prevalence in Australia. Viruses 2021, 13, 2412. [Google Scholar] [CrossRef]
  86. Palombieri, A.; Fruci, P.; Di Profio, F.; Sarchese, V.; Robetto, S.; Martella, V.; Di Martino, B. Detection and Characterization of Bopiviruses in Domestic and Wild Ruminants. Transbounding Emerg. Dis. 2022, 69, 3972–3978. [Google Scholar] [CrossRef]
  87. Woods, L.W.; Hanley, R.S.; Chiu, P.H.; Lehmkuhl, H.D.; Nordhausen, R.W.; Stillian, M.H.; Swift, P.K. Lesions and Transmission of Experimental Adenovirus Hemorrhagic Disease in Black-Tailed Deer Fawns. Vet. Pathol. 1999, 36, 100–110. [Google Scholar] [CrossRef]
  88. Ridpath, J.F.; Neill, J.D.; Palmer, M.V.; Bauermann, F.V.; Falkenberg, S.M.; Wolff, P.L. Isolation and Characterization of a Novel Cervid Adenovirus from White-Tailed Deer (Odocoileus virginianus) Fawns in a Captive Herd. Virus Res. 2017, 238, 198–203. [Google Scholar] [CrossRef]
  89. Dastjerdi, A.; Jeckel, S.; Davies, H.; Irving, J.; Longue, C.; Plummer, C.; Vidovszky, M.Z.; Harrach, B.; Chantrey, J.; Martineau, H.; et al. Novel Adenovirus Associated with Necrotizing Bronchiolitis in a Captive Reindeer (Rangifer tarandus). Transbounding Emerg. Dis. 2022, 69, 3097–3102. [Google Scholar] [CrossRef]
  90. Dai, Z.; Wang, H.; Yang, S.; Shen, Q.; Wang, X.; Zhou, T.; Feng, Z.; Zhang, W. Identification and Characterization of a Novel Bocaparvovirus in Tufted Deer (Elaphodus cephalophus) in China. Arch. Virol. 2022, 167, 201–206. [Google Scholar] [CrossRef]
  91. Casaubon, J.; Vogt, H.-R.; Stalder, H.; Hug, C.; Ryser-Degiorgis, M.-P. Bovine Viral Diarrhea Virus in Free-Ranging Wild Ruminants in Switzerland: Low Prevalence of Infection despite Regular Interactions with Domestic Livestock. BMC Vet. Res. 2012, 8, 204. [Google Scholar] [CrossRef]
  92. Bodewes, R.; Ruiz-Gonzalez, A.; Schapendonk, C.M.; Van Den Brand, J.M.; Osterhaus, A.D.; Smits, S.L. Viral Metagenomic Analysis of Feces of Wild Small Carnivores. Virol. J. 2014, 11, 89. [Google Scholar] [CrossRef]
  93. Olarte-Castillo, X.A.; Heeger, F.; Mazzoni, C.J.; Greenwood, A.D.; Fyumagwa, R.; Moehlman, P.D.; Hofer, H.; East, M.L. Molecular Characterization of Canine Kobuvirus in Wild Carnivores and the Domestic Dog in Africa. Virology 2015, 477, 89–97. [Google Scholar] [CrossRef]
  94. Balboni, A.; Verin, R.; Morandi, F.; Poli, A.; Prosperi, S.; Battilani, M. Molecular Epidemiology of Canine Adenovirus Type 1 and Type 2 in Free-Ranging Red Foxes (Vulpes vulpes) in Italy. Vet. Microbiol. 2013, 162, 551–557. [Google Scholar] [CrossRef]
  95. Rosa, G.M.; Santos, N.; Grøndahl-Rosado, R.; Fonseca, F.P.; Tavares, L.; Neto, I.; Cartaxeiro, C.; Duarte, A. Unveiling Patterns of Viral Pathogen Infection in Free-Ranging Carnivores of Northern Portugal Using a Complementary Methodological Approach. Comp. Immunol. Microbiol. Infect. Dis. 2020, 69, 101432. [Google Scholar] [CrossRef]
  96. Martella, V.; Pratelli, A.; Cirone, F.; Zizzo, N.; Decaro, N.; Tinelli, A.; Foti, M.; Buonavoglia, C. Detection and Genetic Characterization of Canine Distemper Virus (CDV) from Free-Ranging Red Foxes in Italy. Mol. Cell. Probes 2002, 16, 77–83. [Google Scholar] [CrossRef]
  97. Walker, D.; Abbondati, E.; Cox, A.L.; Mitchell, G.B.B.; Pizzi, R.; Sharp, C.P.; Philbey, A.W. Infectious Canine Hepatitis in Red Foxes (Vulpes vulpes) in Wildlife Rescue Centres in the UK. Vet. Rec. 2016, 178, 421. [Google Scholar] [CrossRef]
  98. Verin, R.; Forzan, M.; Schulze, C.; Rocchigiani, G.; Balboni, A.; Poli, A.; Mazzei, M. Multicentric Molecular and Pathologic Study on Canine Adenovirus Type 1 in Red Foxes (Vulpes vulpes) in Three European Countries. J. Wildl. Dis. 2019, 55, 935. [Google Scholar] [CrossRef]
  99. Åkerstedt, J.; Lillehaug, A.; Larsen, I.-L.; Eide, N.E.; Arnemo, J.M.; Handeland, K. Serosurvey for Canine Distemper Virus, Canine Adenovirus, Leptospira interrogans, And Toxoplasma gondii in Free-Ranging Canids in Scandinavia and Svalbard. J. Wildl. Dis. 2010, 46, 474–480. [Google Scholar] [CrossRef]
  100. Martinello, F.; Galuppo, F.; Ostanello, F.; Guberti, V.; Prosperi, S. Detection of Canine Parvovirus in Wolves from Italy. J. Wildl. Dis. 1997, 33, 628–631. [Google Scholar] [CrossRef] [PubMed]
  101. Millán, J.; López-Bao, J.V.; García, E.J.; Oleaga, Á.; Llaneza, L.; Palacios, V.; De La Torre, A.; Rodríguez, A.; Dubovi, E.J.; Esperón, F. Patterns of Exposure of Iberian Wolves (Canis lupus) to Canine Viruses in Human-Dominated Landscapes. EcoHealth 2016, 13, 123–134. [Google Scholar] [CrossRef] [PubMed]
  102. Smits, S.L.; Raj, V.S.; Oduber, M.D.; Schapendonk, C.M.E.; Bodewes, R.; Provacia, L.; Stittelaar, K.J.; Osterhaus, A.D.M.E.; Haagmans, B.L. Metagenomic Analysis of the Ferret Fecal Viral Flora. PLoS ONE 2013, 8, e71595. [Google Scholar] [CrossRef]
  103. Stout, A.E.; Guo, Q.; Millet, J.K.; De Matos, R.; Whittaker, G.R. Coronaviruses Associated with the Superfamily Musteloidea. mBio 2021, 12, e02873-20. [Google Scholar] [CrossRef]
  104. Bourque, L.; Nielsen, O.; Jager, M.; Ojkic, D.; Provost, C.; Gagnon, C.A.; Lockerbie, B.; Snyman, H.; Stevens, B.; Needle, D.; et al. In Situ Hybridization and Virus Characterization of Skunk Adenovirus in North American Wildlife Reveals Multisystemic Infections in A Broad Range of Hosts. J. Wildl. Dis. 2022, 58, 356–367. [Google Scholar] [CrossRef] [PubMed]
  105. Di Sabatino, D.; Di Francesco, G.; Zaccaria, G.; Malatesta, D.; Brugnola, L.; Marcacci, M.; Portanti, O.; De Massis, F.; Savini, G.; Teodori, L.; et al. Lethal Distemper in Badgers (Meles meles) Following Epidemic in Dogs and Wolves. Infect. Genet. Evol. 2016, 46, 130–137. [Google Scholar] [CrossRef]
  106. Birch, J.M.; Ullman, K.; Struve, T.; Agger, J.F.; Hammer, A.S.; Leijon, M.; Jensen, H.E. Investigation of the Viral and Bacterial Microbiota in Intestinal Samples from Mink (Neovison vison) with Pre-Weaning Diarrhea Syndrome Using next Generation Sequencing. PLoS ONE 2018, 13, e0205890. [Google Scholar] [CrossRef]
  107. Williams, B.H.; Burek Huntington, K.; Miller, M. Mustelids. In Pathology of Wildlife and Zoo Animals; Elsevier: Amsterdam, The Netherlands, 2018; pp. 287–304. ISBN 978-0-12-805306-5. [Google Scholar]
  108. Lempp, C.; Jungwirth, N.; Grilo, M.L.; Reckendorf, A.; Ulrich, A.; Van Neer, A.; Bodewes, R.; Pfankuche, V.M.; Bauer, C.; Osterhaus, A.D.M.E.; et al. Pathological Findings in the Red Fox (Vulpes vulpes), Stone Marten (Martes foina) and Raccoon Dog (Nyctereutes procyonoides), with Special Emphasis on Infectious and Zoonotic Agents in Northern Germany. PLoS ONE 2017, 12, e0175469. [Google Scholar] [CrossRef] [PubMed]
  109. Park, N.Y.; Lee, M.C.; Kurkure, N.V.; Cho, H.S. Canine Adenovirus Type 1 Infection of a Eurasian River Otter (Lutra lutra). Vet. Pathol. 2007, 44, 536–539. [Google Scholar] [CrossRef] [PubMed]
  110. Gao, Y.; He, W.; Fu, J.; Li, Y.; He, H.; Chen, Q. Epidemiological Evidence for Fecal-Oral Transmission of Murine Kobuvirus. Front. Public Health 2022, 10, 865605. [Google Scholar] [CrossRef] [PubMed]
  111. Balik, S.; Bunting, E.; Dubovi, E.; Renshaw, R.; Childs-Sanford, S. Detection of Skunk Adenovirus 1 in Two North American Porcupines (Erethizon dorsatum) with Respiratory Disease. J. Zoo Wildl. Med. 2020, 50, 1012. [Google Scholar] [CrossRef]
Animals 15 03378 g001
Figure 1. The PNFC sampling area, located in Tuscany and Emilia-Romagna (a) is shown in light yellow color (b).
Figure 1. The PNFC sampling area, located in Tuscany and Emilia-Romagna (a) is shown in light yellow color (b).
Animals 15 03378 g001
Animals 15 03378 g002
Figure 2. Evolutionary analysis by the Maximum Likelihood method.
Figure 2. Evolutionary analysis by the Maximum Likelihood method.
Animals 15 03378 g002
Table 1. 5′-3′ primer sequences used for PCR analysis. Abbreviations for each virus are listed at the end of the manuscript.
Table 1. 5′-3′ primer sequences used for PCR analysis. Abbreviations for each virus are listed at the end of the manuscript.
5′-3′ Primer Forward5′-3′ Primer ReverseReference
Adenovirus spp. 1° round:
TNMGNGGNGGNMGNTGYTAYCC
2° round:
GTDGCRAANSHNCCRTABARNGMRT		1° round:
GTDGCRAANSHNCCRTABARNGMRTT
2° round:
CCANCCBCDRTTRTGNARNGTRA		[28]
CAdV 1,2CGCGCTGAACATTACTACCTTGTCCCTAGAGCACTTCGTGTCCGCTT[29]
CPVACAAGATAAAAGACGTGGTGTAACTCAACAACCTCAGCTGGTCTCATAATAGT[30]
FPV/CPVACAAGATAAAAGACGTGGTGTAACTCAACAACCTCAGCTGGTCTCATAATAGT[31]
Bocavirus spp. GCCAGCACNGGNAARACMAACATNAGNCAYTCYTCCCACCA[32]
CBov 11° round:
CARTGGTAYGCTCCMATYTTTAA
2° round:
TGGTAYGCTCCMATYTTTAAYGG		1° round:
TGGCTCCCGTCACAAAAKATRTG
2° round:
GCTCCCGTCACAAAAKATRTGAAC		[33]
CBoV 2AGGTCGGCCACTGGCTGTCAGCTTAACGGCATTCACTA[32]
CBoV 31° round:
CAGATTTGGGGGTCCTGCAT
2° round:
ATGCCGTCACCAATCCACAT		1° round:
GCACTGTCTGCGCTGAAAAA
2° round:
AGCTTGTGGTGGACAGTAGC		[34]
LBoVAGACCAGATGCTCCACATGGTGCCTGCCACGGATTGTACC[35]
Canine CVCTGAAAGATAAAGGCCTCTCGCTAGGGGGGTGAACAGGTAAACG[36]
TTV1CGGGTTCAGGAGGCTCAATGCCATTCGGAACTGCACTTACT[37]
TTV2TCATGACAGGGTTCACCGGACGTCTGCGCACTTACTTATATACTCTA[37]
Kobuvirus spp. TGGAYTACAAGTGTTTTGATGCATGTTGTTRATGATGGTGTTGA[38]
Astrovirus spp. 1° round a:
GARTTYGATTGGRCKCGKTAYGA
1° round b:
GARTTYGATTGGRCKAGGTAYGA
2° round a:
CGKTAYGATGGKACKATHCC
2° round b:
AGGTAYGATGGKACKATHCC		GGYTTKACCCACATNCCRAA[39]
Coronavirus spp. 1° round:
GGKTGGGAYTAYCCKAARTG
2° round:
GGTTGGGACTATCCTAAGTGTGA		1° round:
TGYTGTSWRCARAAYTCRTG
2° round:
CCATCATCAGATAGAATCATCAT		[40]
BVDVATGCCCWTAGTAGGACTAGCATCAACTCCATGTGCCATGTAC[41]
Bopivirus spp. CTGRGCAAGTTCACCAACAAGTCCATGACAGGGTGAATCA[42]
CDVACTTCCGCGATCTCCACTGGGCTCCACTGCATCTGTATGG[35]
Table 2. Genbank accession numbers alongside BLAST results, including the closest match, nucleotide identity percentage, and E-value.
Table 2. Genbank accession numbers alongside BLAST results, including the closest match, nucleotide identity percentage, and E-value.
VirusHostGenbankReference
Sequence		Ident %
(QueryCov%)		E Value
CPVRed Fox CPV/fox/169/IT
OQ079554		Canine parvovirus 2c
MF177262.1		84,83%
(97%)		6e-31
CCoVRed FoxCCoV/fox/208/IT
OQ079555		Canine coronavirus
ON834692.1		100.00%
(100%)		0.0
AdVSmall
mustelids		RAdV/mustelidae/878/IT
OQ079556		Rodent adenovirus
KY369960.1		75.91%
(100%)		1e-49
Small
mustelids		RAdV/mustelidae/888/IT
OQ079557		Rodent adenovirus
KY369960.1		74.74%
(99%)		1e-42
AstVRed FoxMastv/fox/46/IT
OQ079558		Bovine astrovirus
MW373720.1		90.82%
(100%)		7e-155
Porcupine Mastv/porcupine/484/IT
OQ079559		Mamastrovirus 3
MH399894.1		91,27%
(100%)		2e-156
Cervo Mastv/reddeer/707/IT
OQ079560		Murine astrovirus
JQ408746.1		88.49%
(99%)		9e-128
Small
mustelids		Mastv/mustelidae/883/IT
OQ079561		Murine astrovirus
JQ408746.1		87.95%
(100%)		3e-81
Red Deer Mastv/redeer/885/IT
OQ079562		Murine astrovirus
JQ408746.1		88.56%
(100%)		7e-129
WolfCAsV/wolf/481/IT
OQ079564		Canine astrovirus
OQ198039		88.80%
(100%)		3e-133
BoVRed FoxBoV/fox/171/IT
OQ079563		Bocaparvovirus carnivoran5
PP592987		88.55%
(99%)		3-e83
KoVWolf Kov/wolf/525/IT
OQ079565		Porcine kobuvirus
MH184668.1		93.30%
(99%)		8e-88
Red FoxKov/fox/88/IT
OQ079566		Fox kobuvirus
KF781172.1		92.49%
(100%)		5e-63
Table 3. Results of the taxonomic classification using Kraken 2.
Table 3. Results of the taxonomic classification using Kraken 2.
Pool NumberN° of
Sequences		Classified
Sequences *
(%)		Unclassified
Sequences * (%)		Bacteria
Sequences *
(%)		Viral
Sequences *
(%)
11.86 × 1072179762
21.79 × 1072972921
32.17 × 1072674890.7
42.18 × 1075941980.4
The percentage of sequences assigned to Bacteria and Viruses is calculated over the number of classified sequences (*).
Table 4. Post data analysis of NGS results.
Table 4. Post data analysis of NGS results.
Pool NumberGenbankRef-Seqn° Readsn° NucleotidePairwise IdentityE Value
1PX314117Porcine picobirnavirus
MW978536.1		213467100%0.0
PX314118Rodent circovirus
KY370041.1		748089.97%1e-145
PX314119Anelloviridae spp.
MF346362.1		242799.77%0.0
2PX314120Fox adeno-associated virus
KC878874		281288100%0.0
PX314121
PX314122
PX314123		Red squirrel adenovirus-1
NC_035207		27212969.66%
88.58%
100		1e-24
1e-177
0
PX314124Pigeon adenovirus
NC024474		17319100%2e-104
PX314125
PX314126
PX314127		Torqueteno felis virus
MT538010		2577992.21%
98.06%
70.71%		4e-51
7e-67
2e-30
3PX314128
PX314129		Porcine circo-like virus
JF713717		31175990.90%
98.15%		0.0
0.0
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Pacini, M.I.; Forzan, M.; Mazzei, M. Fecal Sample Surveillance of the Wildlife Virome in Central Italy: Insights from the Foreste Casentinesi National Park. Animals 2025, 15, 3378. https://doi.org/10.3390/ani15233378

AMA Style

Pacini MI, Forzan M, Mazzei M. Fecal Sample Surveillance of the Wildlife Virome in Central Italy: Insights from the Foreste Casentinesi National Park. Animals. 2025; 15(23):3378. https://doi.org/10.3390/ani15233378

Chicago/Turabian Style

Pacini, Maria Irene, Mario Forzan, and Maurizio Mazzei. 2025. "Fecal Sample Surveillance of the Wildlife Virome in Central Italy: Insights from the Foreste Casentinesi National Park" Animals 15, no. 23: 3378. https://doi.org/10.3390/ani15233378

APA Style

Pacini, M. I., Forzan, M., & Mazzei, M. (2025). Fecal Sample Surveillance of the Wildlife Virome in Central Italy: Insights from the Foreste Casentinesi National Park. Animals, 15(23), 3378. https://doi.org/10.3390/ani15233378

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Article metric data becomes available approximately 24 hours after publication online.
Back to TopTop