Next Article in Journal
Identification and Functional Characterization of the FATP1 Gene from Mud Crab, Scylla paramamosain
Previous Article in Journal
Exploring Sound Frequency Detection in the Golden Rabbitfish, Siganus guttatus: A Behavioral Study
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Genome Survey of Male Rana dybowskii to Further Understand the Sex Determination Mechanism

College of Animal Science and Technology, Northeast Agricultural University, No. 600 Changjiang Road, Xiangfang District, Harbin 150030, China
*
Authors to whom correspondence should be addressed.
These authors contributed equally to this work.
Animals 2024, 14(20), 2968; https://doi.org/10.3390/ani14202968
Submission received: 14 August 2024 / Revised: 8 October 2024 / Accepted: 11 October 2024 / Published: 14 October 2024
(This article belongs to the Section Animal Genetics and Genomics)

Abstract

:

Simple Summary

To obtain more female individuals in the breeding population of R. dybowskii, it is important to explore the sex determination mechanism based on whole genome analysis. In this study, we analyzed the genome survey of male individuals of R. dybowskii using next-generation sequencing technology. The estimated genome size of R. dybowskii was approximately 3585.05 M. The total size of contigs and scaffolds was 3,748,543,415 and 3,765,862,278 bp, respectively. The N50 length of contigs and scaffolds was 31,988 and 336,385,783, respectively. The Dmrt1 gene with an 18,893 bp length was obtained from the scaffolding genomes of R. dybowskii. Sequence alignment to Dmrt1 revealed that the two male-specific DNA markers (MSM-222 and MSM-261) were not located on Dmrt1. This indicated that Dmrt1 may not be the only key gene for sex determination in R. dybowskii.

Abstract

Rana dybowskii is one of the important aquaculture species in Northeast China. The fallopian tubes of female R. dybowskii are used to prepare oviductus ranae (an important traditional Chinese medicine). Therefore, R. dybowskii females have higher economical value than males. An increasing female R. dybowskii population can increase the benefits from R. dybowskii culture. However, the genome of amphibians is complex, making it difficult to investigate their sex determination mechanism. In this study, we analyzed the genome of male R. dybowskii using next-generation sequencing technology. A total of 200,046,452,400 bp of clean data were obtained, and the K-mer analysis indicated that the depth was 50×. The genome size of R. dybowskii was approximately 3585.05 M, with a heterozygosity rate, repeat sequence ratio, and genome GC content of 1.15%, 68.96%, and approximately 43.0%, respectively. In total, 270,785 contigs and 498 scaffolds were generated. The size of the contigs and scaffolds was 3,748,543,415 and 3,765,862,278 bp, respectively, with the N50 length of 31,988 and 336,385,783. The longest contig and scaffold were of the size 137,967,485 and 1,808,367,828 bp, respectively. The number of contigs and scaffolds > 10K nt was 99,620 and 451, respectively. Through annotation, 40,913 genes were obtained, including 156,609 CDS (i.e., 3.83 CDS per gene). Sequence alignment was performed with the assembled scaffolding genome in this study. Two and one fragment had high homology with two male-specific DNA molecular markers of R. dybowskii discovered previously (namely, MSM-222 and MSM-261, respectively). In addition, the Dmrt1 gene of R. dybowskii was obtained with a length of 18,893 bp by comparison and splicing. The forward primers amplifying MSM-222 and MSM-261 were located at 322–343 and 14,501–14,526 bp of Dmrt1, respectively. However, sequence alignment revealed that MSM-222 and MSM-261 were not located on Dmrt1, and only some homologous parts were observed. This indicated that in addition to Dmrt1, other important genes may play a crucial role in the sex determination mechanism of R. dybowskii. Our study provided a foundation for the subsequent high-quality genome construction and provided important genomic resources for future studies on R. dybowskii.

1. Introduction

Amphibians form an important group of vertebrates, playing a significant role in the evolution of vertebrates [1]. Amphibians from a transitional group between marine and terrestrial organisms. In the evolutionary history of vertebrates, the transition from aquatic to terrestrial habitats was a huge leap [2]. Before the emergence of amphibians, all vertebrates lived in water. The living conditions on land were much more complex and diverse than those in water. Therefore, amphibians evolved toward higher and more varied and complex directions [3]. Moreover, the larvae of most amphibians live in water, appearing like fish with tails, and breathe through gills. However, the adults live on land and breathe through lungs, indicating their metamorphosis [4]. In such a complex evolutionary position, it was a challenge for the amphibian genome to evolve and help in adapting to such an environment [5,6].
Compared with the genomes of mammals, birds, and fishes, our understanding of amphibian genomes is not sufficient [7]. Currently, AmphibiaWeb (https://amphibiaweb.org/index.html, accessed on 14 January 2024) includes 8717 amphibian species. Although amphibian sex chromosomes have rich diversity [8], only 95 amphibian genomes have been studied, and only 28 of them have been annotated to the chromosome level according to the information provided by the NCBI GenBank database (https://www.ncbi.nlm.nih.gov/genome/?term=amphibians, accessed on 14 January 2024). Many amphibians do not exhibit a high degree of differentiation in sexual chromosomes and have homotypic chromosomes [9,10]. Some studies reported that different amphibians have XY- and ZW-type sex chromosomes [8,11]. More interestingly, XY- and ZW-type sex chromosomes also appear in different geographic populations of the same amphibian species [12].
Rana dybowskii is an amphibian belonging to the family Ranidae and the genus Rana, which is widely distributed in Northeast China [13]. R. dybowskii generally lives on hills near the seaside and mountainous areas up to 1500 m above sea level. They require rich vegetation growing in a humid climate. R. dybowskii adults live in water only during winter and breeding seasons. After breeding, they enter the forest after a short period of reproductive dormancy [14,15]. R. dybowskii has important ecological and economic value [16]. As an important component of forest ecosystems, R. dybowskii feeds on various insects and is also a food source for various birds and small mammals [17]. Second, the fallopian tubes of female R. dybowskii are used to prepare a precious traditional Chinese medicine: oviductus ranae [18]. Increasing the female population of R. dybowskii can help in maximizing the benefits from its culture. For this, understanding the sex determination mechanism is necessary. However, the genome of R. dybowskii has not been thoroughly explored, and only its mitochondrial genome has been assembled (accession number in NCBI: NC-023528). Regarding sex determination, the heteromorphic sex chromosomes of R. dybowskii from different places in the Northeast China have not been observed using cytometric methods such as chromosomal karyotype analysis and Ag-band [19]. Xu et al. [20] used DNA molecular marker technology to screen male-specific DNA markers of R. dybowskii and reported that the sex chromosome of R. dybowskii is of the XY-type. However, further exploration of the genome is needed to reveal the sex determination mechanism of R. dybowskii.
Considering the extreme lack of genomic information of R. dybowskii and research on the sex determination mechanism of R. dybowskii, in this study, we analyzed the genome of R. dybowskii, preliminarily exploring the sex determination mechanism. Using DNA molecular marker technology and phenotypic analysis, adult male individuals of R. dybowskii were selected, and the genome was studied using the high-throughput sequencing technology. The purpose of this study was to provide a reference for the subsequent sequencing and construction of the chromosome-level genome of R. dybowskii and to provide foundational data for studying the sex determination mechanism of R. dybowskii.

2. Materials and Methods

2.1. Phenotypic Sex Determination and DNA Extraction from Tissue Samples

In total, 12 adult R. dybowskii individuals were collected from Taoshan Forestry Bureau in Yichun City, Heilongjiang Province, including 6 male and 6 female individuals (phenotypic sex was identified as indicated in Figure 1). The phenotypic sex of R. dybowskii could be identified from external morphological characteristics, which were significantly different between adult males and females. Similar to many frog species, the adult males of R. dybowskii had a noticeable nuptial pad at the thumb joint of forelimbs. In autumn and winter, the abdominal fullness of adult females of R. dybowskii was higher than that of adult males. After anesthetizing, the thigh muscles of R. dybowskii were cut, soaked in 75% ethanol, and frozen at −80 °C. High-quality genomic DNA was extracted from the muscle using the phenol–chloroform method. The quality of extracted DNA was determined using 0.8% agarose gel electrophoresis. The quantity of extracted DNA was determined using a NanoDrop 2000 spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA) and Qubit dsDNA HS Assay Kit on a Qubit 3.0 Fluorometer (Life Technologies, Carlsbad, CA, USA).

2.2. Identification of Genotypic Sex

Sex reversal is observed in most amphibians. R. dybowskii exhibits sex reversal from genotypic females to phenotypic males [20]. The genotypic male carries the Y chromosome, and its genomic information can better represent all the genomic information of R. dybowskii. To ensure that the individuals used for the genome survey were genotypic male individuals, and not pseudo-male individuals with sex reversal, the genotypic sex of collected R. dybowskii individuals was determined.
In our previous study, we identified two male-specific DNA markers in R. dybowskii, namely, MSM-222 and MSM-261 (lengths of 222 and 261 bp, respectively) [20]. The genotypic sex of R. dybowskii was determined as described in our previous study [20]. PCR was performed using a reaction mixture of 20 µL containing 2 µL 10× Taq Buffer, 0.4 µL of 10 mM dNTPs, 1.0 U DNA polymerase (Vazyme, Nanjing, China), 0.8 µL forward primer (10 pm/µL), 0.8 µL reverse primer (10 pm/µL), 2.5 µL of extracted DNA (50 ng/µL), and ddH2O to make the volume 20 µL. The primers used are shown in Table 1. PCR was conducted as follows: 5 min of Taq polymerase activation at 95 °C, 5 cycles of denaturation at 94 °C for 1 min, annealing at 35 °C for 1 min, and elongation at 72 °C for 1 min; 35 cycles of denaturation at 94 °C for 1 min, annealing at 51 °C for 1 min and elongation at 72 °C for 1 min, and a final elongation of 7 min at 72 °C. The PCR products were analyzed using 14% polyacrylamide gel electrophoresis.

2.3. Library Construction and Sequencing

In total, 1 μg DNA from a male individual was used as the input material, and sequencing libraries were generated using the VAHTS Universal DNA Library Prep Kit for MGI (Vazyme, Nanjing, China), as per the manufacturer’s instructions. Index codes were added to attribute sequences to each sample. Library quantification and size measurements were performed using a Qubit 3.0 Fluorometer (Life Technologies, Carlsbad, CA, USA) and Bioanalyzer 2100 system (Agilent Technologies, Santa Clara, CA, USA). Subsequently, sequencing was performed on a DNBSEQ-T7 platform.

2.4. Quality Control

The short-reads from the Illumina platform were quality-filtered by SOAPnuke v 1.3.0 using the following method [21]. First, the adaptors were removed from the sequencing reads. Second, read pairs were excluded if any one end had an average quality < 20. Third, the ends of the reads were trimmed if the average quality was <20 in the sliding window size of 5 bp. Finally, read pairs with any end shorter than 75 bp were removed. The quality-filtered reads were used for genome size estimation.

2.5. NT Comparison and K-Mer Analysis

Overall, 10,000 pairs of read data were randomly selected from the filtered high-quality data. Using Blast software v 2.7.1, the sequences were compared with those in the NCBI nucleotide database (NT library), and the top five species with the highest number of comparisons were obtained [22]. To estimate the genome size, heterozygosity rate, and repeat sequence information, the 17-mer distribution of sequencing reads was generated from short libraries using the k-mer method and GCE (version) [23].

2.6. Sequence Assembly and Gene Prediction

The assembly software ABySS v 2.0 was used to preliminarily assemble the second-generation data, align the reads to the assembled genome sequence, and summarize the GC bias and repeat sequence of the genome by statistically analyzing the GC content and read coverage depth of the assembled sequence [24]. Finally, the assembly results were assessed using BUSCO software v 5.2.2 [25]. Platanus v1.2.4 was used to concatenate the clean data. The parameters for scaffolding were -t 120 -s 23 -v 23 -l 2 -u 0.2. The parameters for gap closing were -s 23, -k 23, -vo 23, -vd 23, -ed 0.1, -ro 0.6, and -rs 0.8. GlimmerHMM software (v.3.01) was used for the de novo prediction of genes using default parameters. Next, the predicted genes were used for BLAST analysis on the NR and SwissProt databases using BLASTx (DIAMOND v0.8.36 software) (E-value < 1 × 10−5).

2.7. Searching the Known Male-Specific DNA Markers in the Scaffolding Genome of R. dybowskii

Bowtie2 v2.3.2 (http://bowtie-bio.sourceforge.net/index.shtml, accessed on 13 January 2024) was used for sequence alignment to analyze the positions of the two male-specific DNA markers (MSM-222 and MSM-261) on the genome of R. dybowskii. Based on the sequence alignment results, three pairs of primers were designed to verify the accuracy of the localization of two male-specific DNA markers in the assembled genome (Table 2). PCR was performed as described in Section 2.2; the annealing temperature and extension time are shown in Table 3. The PCR product was recovered and sequenced. Further, DNAman was used to identify the upstream and downstream sequences of the two male-specific DNA markers according to the PCR product.

2.8. Assembly of the Dmrt1 Gene and Analysis of Its Relationship with Male-Specific DNA Markers

The Dmrt1 gene of R. dybowskii was identified by aligning the Dmrt1 gene of Nanorana parkeri (https://www.ncbi.nlm.nih.gov/nuccore/NW_017306666.1?report=genbank&from=193451&to=252823, accessed on 15 January 2024) to an RNAseq sequence using MMseq software v 0.9.18. and further aligning the Dmrt1 gene sequence with a matching RNAseq sequence to the assembled genome of R. dybowskii [26]. Further, the matching genomic region was extracted. Based on the sequence alignment results and manual correction of intron features (GT-AG principle), the complete Dmrt1 gene sequence and coding sequence (CDS) were obtained.
According to forward primer sequences for the amplification of the male-specific DNA markers (MSM-222 and MSM-261), the primers were designed (Table 3) for the amplification of the suspected region of the male-specific DNA markers on Dmrt1. PCR was performed as described in Section 2.2; the annealing temperature and extension time are shown in Table 3. The PCR product was recovered and sequenced. Further, the sequences of PCR products were compared with the two male-specific DNA markers and their homologous regions on the scaffolding genome to determine whether the two DNA markers are located on Dmrt1.

3. Results

3.1. Identification of the Genotypic Sex of R. dybowskii Individuals

The genotypic sex of R. dybowskii individuals was identified using male-specific DNA markers of R. dybowskii. Among the individuals with a male phenotype, the 222- and 261-bp male-specific DNA markers were amplified in individuals 1, 2, 4, and 5, indicating that these four individuals were males (Figure 2). These male-specific DNA markers were not amplified in individuals 3 and 6, indicating that they were pseudo-male individuals. Meanwhile, the individuals with a female phenotype did not exhibit amplification of the two male-specific DNA markers.

3.2. Sequencing Data Statistics and Quality Evaluation

From one R. dybowskii sample, a 300–500 bp library was constructed, and 208,387,930,200 bp of raw data were obtained. After filtering and correction, the clean data obtained from the sequencing were of 200,046,452,400 bp. Q20 (%) and Q30 (%) were ≥96.8% and ≥89.7%, respectively (Table 4). The sequencing quality and sequencing error rate were normal (Supplementary Figures S1–S3).

3.3. NT Comparison Statistics

The NT comparison results indicated that our sample library was aligned with the DNA of species closely related to R. dybowskii. The top five species with the highest matching degree were R. chensinensis, N. parkeri, R. rugosa, Coregonus sp., and R. temporaria, with the matching rates of 1.95%, 0.835%, 0.76%, 0.61%, and 0.555%, respectively (Table 5). This demonstrated that the library data did not contain significant exogenous contamination.

3.4. Genome Size, Heterozygosity Rate, and Repeat Sequence Ratio

The K-mer analysis indicated that the depth of R. dybowskii was 50× (Figure 3). The genome size of R. dybowskii was approximately 3585.05 M, with a heterozygosity rate of 1.15%, a repeat sequence ratio of 68.96%, and a genome GC content of 1.15%, 68.96%, and approximately 43.0%, respectively. The genome size of R. dybowskii was at a moderate level among amphibians with known genomes (Table 6).

3.5. Preliminary Scaffolding Genome and Gene Prediction

After splicing and assembly with Platanus v1.2.4, 270,785 contigs and 498 scaffolds were generated. The total size of the contigs and scaffolds was 374,8543,415 and 3,765,862,278 bp, respectively (Table 7). Among 270,785 contigs, 270,745 were confirmed in scaffolds, and 40 were not. The longest contig and scaffold were of 137,967,485 and 1,808,367,828 bp, respectively. The number of contigs and scaffolds > 10K nt was 99,620 and 451, respectively. In this study, the N50 length of contigs and scaffolds was 31,988 and 336,385,783, respectively, and the L50 length was 29,092 and 2, respectively. Through annotation, 40,913 genes were obtained, including 156,609 CDS (i.e., 3.83 CDS per gene). The length of the CDS was 52,923,470, and the CDS length per gene was 1294 bp.

3.6. Homologous Sequences of Male-Specific DNA Markers in the Scaffolding Genome

After comparing with our assembled scaffolding genome, two fragments (>RanDyb_scaf_498:645910742-645911053 and RanDyb_scaf_498:505645920-505646238) exhibited high homology to MSM-222, and one fragment (>RanDyb_scaf_3:159744804-159745236) exhibited high homology to MSM-261 (Figure 4).
Based on the three sequences on the scaffolding genome, three pairs of primers were designed to verify their authenticity (Table 2). Their homology was compared with MSM-222 and MSM-261. The amplified products of the primer pairs 289F/289R and 303F/303R were blurry bands of approximately 1700 and 500 bp in length, respectively, and the amplified product of primer pair 403F/403R was a bright band of approximately 400 bp in length (Figure 5). They were named R1700, R500, and R403, respectively. After recovering and sequencing the PCR products, the sequence of only R403 was obtained, which was highly similar to that of >RanDyb_scaf_3:159744804-159745236 (Figure 6). By comparing R403 with the corresponding male-specific DNA marker (MSM-261), it was observed that R403 contained the double-ended sequence of MSM-261 (Figure 7).

3.7. The Dmrt1 Gene Sequence of R. dybowskii and Its Relationship with Male-Specific DNA Markers

Via comparing and splicing, the Dmrt1 gene of R. dybowskii with a length of 18,893 bp was obtained. The Forward1 (Dmrt1-1: primer for amplifying MSM-222) was located at 322–343 bp of Dmrt1, and the Forward2 (Dmrt1-2: primer for amplifying MSM-261) was located at 14,501–14,526 bp of Dmrt1.
Two pairs of primers 913F/1021R and 940F/940R, respectively, were designed for amplifying the 1–1020 and 13,828–14,767 bp sequences of the Dmrt1 gene of R. dybowskii, including Forward1 (Dmrt1-1) and Forward2 (Dmrt1-2). The amplified products shown in Figure 8 were recovered by agarose gel electrophoresis and sequenced, obtaining 1092 bp (including Forward1 Dmrt1-1) and 940 bp (including Forward2 Dmrt1-2) sequences.
The sequence of MSM-222 was compared with the 1092 bp fragment, and that of MSM-261 was compared with 940 bp fragments. It was observed that MSM-222 and MSM-261 were not located on Dmrt1, although some homologous parts were observed (Figure 9).

4. Discussion

From early Sanger sequencing to next-generation sequencing (NGS) technology and further to third-generation single-molecule sequencing technology, DNA sequencing technology has been driving the development of life science research [27,28]. A genome survey based on NGS is an effective means of evaluating the complexity of the genome. It is necessary to determine the genomic characteristics before assembling the third-generation sequencing of the genome [29,30]. Due to the direct impact of the genome size and heterozygosity on sequencing strategies, cycles, and other factors, low-depth NGS data based on small-fragment libraries are used to evaluate the size and complexity of the genome through bioinformatic methods [31,32]. In our study, the genome size of R. dybowskii was observed to be approximately 3585.05 M, with a heterozygosity rate, repeat sequence rate, and genome GC content of 1.15%, 68.96%, and approximately 43.0%, respectively. This study provided guidance for the development of subsequent strategies for whole genome de novo sequencing and assembly for this species.
The results of NT comparison analysis on NCBI indicated that the similarity between R. dybowskii and R. chensiniensis was the highest, indicating that R. dybowskii and R. chensiniensis had the closest genetic relationship. For a long time, the taxonomic status of R. dybowskii had been relatively chaotic and unclear [14]. From the morphometrics and external characteristics, R. dybowskii and R. chensinensis are very similar; therefore, R. dybowskii was considered a subspecies of R. chensinensis for some time [33]. However, after in-depth analysis, researchers observed slight differences in the body size and type of the seventh pair of chromosomes between R. dybowskii and R. chensinensis [14]. In our study, an analysis of the genome of R. dybowskii via NT data library comparison provided a theoretical basis for its taxonomical analysis.
Overall, 28 annotated amphibian genomes at the chromosome level were included in the NCBI GenBank (https://www.ncbi.nlm.nih.gov/genome/?term=amphibians, accessed on 14 January 2024) (the smallest genome: Spea bombifrons 0.96 G and the largest genome: Ambystoma mexicanum 28.20 G; Table 7). In our study, the genome of R. dybowskii was observed to be approximately 3.5 G, whereas that of R. temporaria (also belonging to the frog genus) is 4.1 G. In the NT comparison on NCBI, the genetic relationship between R. dybowskii and R. temporaria was relatively close. However, karyotype analysis revealed that the chromosome number of R. dybowskii and R. temporaria was 24 and 26, respectively [16,34]. At present, the entire genome of R. temporaria has been annotated at the large chromosome level [35]. To further analyze the genetic differences between R. dybowskii and R. temporaria, as well as the sex determination mechanism of R. dybowskii, the entire genome of R. dybowskii should be sequenced based on a genome analysis.
Genome sequencing is of significant help in revealing the mechanisms of sex determination [36,37]. The research on the sex determination mechanism of R. dybowskii is still at the preliminary stage. At the cellular level, heterosexual chromosomes were not observed in R. dybowskii [16]. At the molecular biology level, two male-specific DNA molecular markers of R. dybowskii were screened using target region amplified polymorphism technology, and it was preliminarily confirmed that the sex chromosome of R. dybowskii is of XY-type. However, due to the complex and diverse sex determination mechanisms of amphibians [10,38,39], our in-depth research on the sex determination mechanism of R. dybowskii has been greatly hindered. Based on the genome survey, in this study, we preliminarily spliced the genome of R. dybowskii and selected homologous fragments of male-specific DNA molecular markers in the scaffolding genome. This provided new clues for the further exploration of sex determination mechanisms in R. dybowskii. Meanwhile, the forward primers for amplifying the male-specific DNA molecular markers of R. dybowskii were anchored to Dmrt1 [19]. In addition, Dmrt1 is a differentially expressed gene in the testes of male and pseudo-male individuals [16]. Therefore, we previously speculated that the sequence of the male-specific DNA molecular marker of R. dybowskii would be present on Dmrt1 [19]. However, after comparing the male-specific DNA molecular marker sequences and Dmrt1 sequence, where the forward primers were located, we observed that these two molecular markers were not present on Dmrt1. They only shared the sequences of forward primers that led to the amplification of the two male-specific DNA molecular markers in PCR. Thus, the sex determination mechanism of R. dybowskii was observed to be very complex, not as simple as we previously thought [19]. In addition to Dmrt1, other key genes may play a role in sex determination in R. dybowskii.

5. Conclusions

In this study, the genome survey of male R. dybowskii was analyzed, which provided a foundation for the subsequent high-quality genome construction and important genomic resources for the research on the R. dybowskii. The genome size of male R. dybowskii was observed to be approximately 3585.05 M. Genomic comparative analysis revealed that R. dybowskii has the closest genetic relationship with R. chensinensis. The two male-specific DNA molecular markers of R. dybowskii (MSM-222 and MSM-261) were not present on Dmrt1, and their exact locations in the genome are still unknown, which should be explored in future studies. These two markers and Dmrt1 only shared the sequences of forward primers that amplified the two male-specific DNA molecular markers in PCR. In conclusion, further genomic research is needed to understand the sex determination mechanism of R. dybowskii.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ani14202968/s1.

Author Contributions

Conceptualization, Y.X., S.C. and X.B.; methodology, H.L., X.J. and Y.X.; software, X.J.; validation, J.L., Y.T. and X.B.; formal analysis, H.L. and Y.X.; investigation, S.C.; resources, S.D.; data curation, Y.X.; writing—original draft preparation, S.C. and Y.X.; writing—review and editing, S.D., X.Z. and X.B.; visualization, Y.X.; supervision, S.C. and Y.X.; project administration, Y.X.; funding acquisition, Y.X. All authors have read and agreed to the published version of the manuscript.

Funding

This work was funded by China Postdoctoral Science Foundation (No. 2021M690577) and the Post-Doctoral Fund of Heilongjiang Province (No. LBH-Z20113).

Institutional Review Board Statement

Our research was conducted in accordance with the guidelines of the Animal Welfare and Ethics Committee of Northeast Agricultural University (NEAUEC20200221).

Informed Consent Statement

Informed consent was obtained from all subjects involved in the study.

Data Availability Statement

The data presented in this study are available on request.

Acknowledgments

The authors state that all ethical regulations and considerations concerning the treatment of captured animals comply with the animal welfare and ethical review of Northeast Agricultural University.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Ringler, E.; Rojas, B.; Stynoski, J.L.; Schulte, L.M. What amphibians can teach us about the evolution of parental care. Annu. Rev. Ecol. Evol. Syst. 2023, 54, 43–62. [Google Scholar] [CrossRef] [PubMed]
  2. Stebbins, R.C.; Cohen, N.W. A Natural History of Amphibians; Princeton University Press: Princeton, NJ, USA, 2021. [Google Scholar]
  3. Liedtke, H.C.; Wiens, J.J.; Gomez-Mestre, I. The evolution of reproductive modes and life cycles in amphibians. Nat. Commun. 2022, 13, 7039. [Google Scholar] [CrossRef] [PubMed]
  4. Kemp, T.S. Amphibians: A Very Short Introduction; Oxford University Press: Oxford, UK, 2021; Volume 670. [Google Scholar]
  5. Kyono, Y.; Raj, S.; Sifuentes, C.J.; Buisine, N.; Sachs, L.; Denver, R.J. DNA methylation dynamics underlie metamorphic gene regulation programs in Xenopus tadpole brain. Dev. Biol. 2020, 462, 180–196. [Google Scholar] [CrossRef]
  6. Mueller, R.L.; Cressler, C.E.; Schwartz, R.S.; Chong, R.A.; Butler, M.A. Metamorphosis Imposes Variable Constraints on Genome Expansion through Effects on Development. Integr. Org. Biol. 2023, 5, obad015. [Google Scholar] [CrossRef]
  7. Mondal, S.; Singh, R.L. (Eds.) Advances in Animal Genomics; Academic Press: Cambridge, MA, USA, 2020. [Google Scholar]
  8. Ma, W.J.; Veltsos, P. The diversity and evolution of sex chromosomes in frogs. Genes 2021, 124, 483. [Google Scholar] [CrossRef] [PubMed]
  9. Hillis, D.M.; Green, D.M. Evolutionary changes of heterogametic sex in the phylogenetic history of amphibians. J. Evol. Biol. 1990, 3, 49–64. [Google Scholar] [CrossRef]
  10. Dufresnes, C.; Crochet, P.A. Sex chromosomes as supergenes of speciation: Why amphibians defy the rules? Philos. Trans. R. Soc. B 2022, 377, 20210202. [Google Scholar] [CrossRef]
  11. Targueta, C.P.; Krylov, V.; Nondilo, T.E.; Lima, J.; Lourenço, L.B. Sex chromosome evolution in frogs—Helpful insights from chromosome painting in the genus Engystomops. Heredity 2021, 126, 396–409. [Google Scholar] [CrossRef]
  12. Miura, I. Sex determination and sex chromosomes in Amphibia. Sex. Dev. 2018, 11, 298–306. [Google Scholar] [CrossRef]
  13. Amphibia Web. Rana dybowskii: Dybovsky’s Frog; University of California: Berkeley, CA, USA, 2007; Available online: https://amphibiaweb.org/species/5024 (accessed on 8 January 2024).
  14. Xie, F.; Ye, C.; Fei, L.; Jiang, J.; Zeng, X.; Matsui, M. Taxonomical studies on Brown frogs (Rana) from Noertheastern China (amphibian: Ranidae). Acta Zootaxonomica Sin. 1999, 24, 224–231. [Google Scholar]
  15. Wang, W.; Ma, J. The Investigation and Analysis of Effect on Natural Ecology of Northeast Forest Frog Semi-breeding in the Northeast Forest Area. Sichuan J. Zool. 2011, 30, 456–459. [Google Scholar]
  16. Shao, Y.; Guo, R.; Xia, Q.; Wu, Q. Study on chromosome karyotype and Ag band of Rana chensinensis David from Liaoning Province. J. Fudan Univ. 1999, 38, 557–560. [Google Scholar]
  17. Tong, Q.; Liu, X.N.; Hu, Z.F.; Ding, J.F.; Bie, J.; Wang, H.B.; Zhang, J.T. Effects of captivity and season on the gut microbiota of the brown frog (Rana dybowskii). Front. Microbiol. 2019, 10, 1912. [Google Scholar] [CrossRef] [PubMed]
  18. Zhang, Y.; Wang, Y.; Li, M.; Liu, S.; Yu, J.; Yan, Z.; Zhou, H. Traditional uses, bioactive constituents, biological functions, and safety properties of Oviductus ranae as functional foods in China. Oxidative Med. Cell. Longev. 2019, 2019, 4739450. [Google Scholar] [CrossRef]
  19. Zeng, K.; Chen, F.; Xiao, X. The karyotype of Rana chensinensis in Xunke County. J. Northeast. For. Univ. 2001, 29, 47–49. [Google Scholar]
  20. Xu, Y.; Du, Z.; Liu, J.; Su, H.; Ning, F.; Cui, S.; Wang, L.; Liu, J.; Ren, C.; Di, S.; et al. Male heterogametic sex determination in Rana dybowskii based on sex-linked molecular markers. Integr. Zool. 2021, 17, 105–114. [Google Scholar] [CrossRef]
  21. Chen, Y.; Chen, Y.; Shi, C.; Huang, Z.; Zhang, Y.; Li, S.; Li, Y.; Ye, J.; Yu, C.; Li, Z.; et al. SOAPnuke: A MapReduce acceleration-supported software for integrated quality control and preprocessing of high-throughput sequencing data. Gigascience 2018, 7, 1–6. [Google Scholar] [CrossRef] [PubMed]
  22. Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W.; Lipman, D.J. Basic local alignment search tool. J. Mol. Biol. 1990, 215, 403–410. [Google Scholar] [CrossRef]
  23. Liu, B.; Shi, Y.; Yuan, J.; Hu, X.; Zhang, H.; Li, N.; Li, Z.; Chen, Y.; Mu, D.; Fan, W. Estimation of genomic characteristics by analyzing k-mer frequency in de novo genome projects. arXiv 2013, arXiv:1308.2012. [Google Scholar]
  24. Jackman, S.D.; Raymond, A.G.; Birol, I. Scaffolding a Genome Sequence Assembly Using ABySS. 2021. Available online: http://sjackman.ca/abyss-scaffold-paper/ (accessed on 13 January 2024).
  25. Simao, F.A.; Waterhouse, R.M.; Ioannidis, P.; Kriventseva, E.V.; Zdobnov, E.M. BUSCO: Assessing genome assembly and annotation completeness with single-copy orthologs. Bioinformatics 2015, 31, 3210–3212. [Google Scholar] [CrossRef]
  26. Xu, Y.; Cui, S.; Li, T.; Du, Z.; Ning, F.; Jiang, H.; Bai, X.; Wang, X.; Bao, J. Testicular Transcriptome of Males and Pseudo-Males Provides Important New Insight into Sex Reversal of Rana dybowskii. Animals 2022, 12, 2887. [Google Scholar] [CrossRef] [PubMed]
  27. Hu, T.; Chitnis, N.; Monos, D.; Dinh, A. Next-generation sequencing technologies: An overview. Hum. Immunol. 2021, 82, 801–811. [Google Scholar] [CrossRef]
  28. Satam, H.; Joshi, K.; Mangrolia, U.; Waghoo, S.; Zaidi, G.; Rawool, S.; Thakare, R.P.; Banday, S.; Mishra, A.K.; Das, G.; et al. Next-Generation Sequencing Technology: Current Trends and Advancements. Biology 2023, 12, 997. [Google Scholar] [CrossRef] [PubMed]
  29. Surachat, K.; Narkthewan, P.; Thotsagotphairee, C.; Wonglapsuwan, M.; Thongpradub, W. The First Genome Survey and De Novo Assembly of the Short Mackerel (Rastrelliger brachysoma) and Indian Mackerel (Rastrelliger kanagurta). Animals 2022, 12, 1769. [Google Scholar] [CrossRef]
  30. Choi, E.; Lee, S.J.; Jo, E.; Kim, J.; Parker, S.J.; Kim, J.H.; Park, H. Genomic Survey and Microsatellite Marker Investigation of Patagonian Moray Cod (Muraenolepis orangiensis). Animals 2022, 12, 1608. [Google Scholar] [CrossRef] [PubMed]
  31. Li, Z.; Tian, C.; Huang, Y.; Lin, X.; Wang, Y.; Jiang, D.; Zhu, C.; Chen, H.; Li, G. A first insight into a draft genome of silver sillago (Sillago sihama) via genome survey sequencing. Animals 2019, 9, 756. [Google Scholar] [CrossRef] [PubMed]
  32. Kim, J.; Lee, S.-J.; Jo, E.; Choi, E.; Cho, M.; Choi, S.; Kim, J.-H.; Park, H. Whole-Genome Survey and Microsatellite Marker Detection of Antarctic Crocodile Icefish, Chionobathyscus dewitti. Animals 2022, 12, 2598. [Google Scholar] [CrossRef]
  33. Zhao, Z. Studies on ecology of the Rana temporaria chensinensis. J. Northeast. Norm. Univ. 1982, 3, 89–96. [Google Scholar]
  34. Spasić-Bošković, O.; Tanić, N.; Blagojević, J.; Vujošević, M. Comparative cytogenetic analysis of European brown frogs: Rana temporaria, R. dalmatina and R. graeca. Caryologia 1997, 50, 139–149. [Google Scholar] [CrossRef]
  35. Streicher, J.W. Wellcome Sanger Institute Tree of Life programme; Wellcome Sanger Institute Scientific Operations: DNA Pipelines collective; Tree of Life Core Informatics collective; Darwin Tree of Life Consortium. The genome sequence of the common frog, Rana temporaria Linnaeus 1758. Wellcome Open Res. 2021, 6, 286. [Google Scholar]
  36. Li, Y.; Xing, T.; Liu, J. Genome-wide association analyses based on whole-genome sequencing of Protosalanx hyalocranius provide insights into sex determination of Salangid fishes. Mol. Ecol. Resour. 2020, 20, 1038–1049. [Google Scholar] [CrossRef] [PubMed]
  37. Cai, L.; Liu, G.; Wei, Y.; Zhu, Y.; Li, J.; Miao, Z.; Chen, M.; Yue, Z.; Yu, L.; Dong, Z.; et al. Whole-genome sequencing reveals sex determination and liver high-fat storage mechanisms of yellowstripe goby (Mugilogobius chulae). Commun. Biol. 2021, 4, 15. [Google Scholar] [CrossRef] [PubMed]
  38. Zhang, M.; Jia, X.; Ma, Y.; Ma, J. Genetic diversity and differentiation of the Dybowski’s frog (Rana dybowskii) in Northeast China. J. For. Res. 2010, 21, 239–245. [Google Scholar] [CrossRef]
  39. Ito, M. Sex Determination and Differentiation in Frogs. In Reproductive and Developmental Strategies; Springer: Tokyo, Japan, 2018. [Google Scholar]
Figure 1. Morphological characteristics of Rana dybowskii. (a) Phenotypic female of R. dybowskii; (b) Phenotypic male of R. dybowskii.
Figure 1. Morphological characteristics of Rana dybowskii. (a) Phenotypic female of R. dybowskii; (b) Phenotypic male of R. dybowskii.
Animals 14 02968 g001
Figure 2. Polyacrylamide gel electrophoresis images for the identification of genotypic males of R. dybowskii. (a) Amplification results of a male-specific molecular marker (222 bp) with primer Dmrt1-1/EM4; (b) Amplification results of a male-specific molecular marker (261 bp) with primer Dmrt1-2/EM7.
Figure 2. Polyacrylamide gel electrophoresis images for the identification of genotypic males of R. dybowskii. (a) Amplification results of a male-specific molecular marker (222 bp) with primer Dmrt1-1/EM4; (b) Amplification results of a male-specific molecular marker (261 bp) with primer Dmrt1-2/EM7.
Animals 14 02968 g002
Figure 3. Distribution map of K-mer depth.
Figure 3. Distribution map of K-mer depth.
Animals 14 02968 g003
Figure 4. Homologous sequences of MSM-222 and MSM-261 in the scaffolding genome of R. dybowskii. (a) Comparison between MSM-222 and RanDyc_scaf_498:645910742-645911053 (R scaf 498:1); the sequence shown in the red box is of the primer Forward1; (b) comparison between MSM-222 and RanDyb_scaf_498:505645920-505646238 (R scaf 498:1); the sequence shown in the red box is of the primer Forward1; (c) comparison between MSM-261 and RanDyb_scaf_3:159744804-159745236 (R scaf 3:2); the sequence shown in the green box is of the primer Forward2.
Figure 4. Homologous sequences of MSM-222 and MSM-261 in the scaffolding genome of R. dybowskii. (a) Comparison between MSM-222 and RanDyc_scaf_498:645910742-645911053 (R scaf 498:1); the sequence shown in the red box is of the primer Forward1; (b) comparison between MSM-222 and RanDyb_scaf_498:505645920-505646238 (R scaf 498:1); the sequence shown in the red box is of the primer Forward1; (c) comparison between MSM-261 and RanDyb_scaf_3:159744804-159745236 (R scaf 3:2); the sequence shown in the green box is of the primer Forward2.
Animals 14 02968 g004
Figure 5. Agarose gel electrophoresis of three pairs of primers for the amplification of scaffolds. M Lane: Marker; Lane 1: PCR products of 289F/289R; Lane 2: PCR products of 303F/303R; Lane 3: PCR products of 403F/403R.
Figure 5. Agarose gel electrophoresis of three pairs of primers for the amplification of scaffolds. M Lane: Marker; Lane 1: PCR products of 289F/289R; Lane 2: PCR products of 303F/303R; Lane 3: PCR products of 403F/403R.
Animals 14 02968 g005
Figure 6. Comparison between R scaf 3:2 and R403.
Figure 6. Comparison between R scaf 3:2 and R403.
Animals 14 02968 g006
Figure 7. Comparison between MSM-261 and R403. The sequence shown in the green box is of the primer Forward2.
Figure 7. Comparison between MSM-261 and R403. The sequence shown in the green box is of the primer Forward2.
Animals 14 02968 g007
Figure 8. Agarose gel electrophoresis of three pairs of primers for amplifying the partial sequence in Dmrt1. M Lane: Marker; Lane 1: PCR products of 913F/1021R; Lane 2: PCR products of 940F/940R.
Figure 8. Agarose gel electrophoresis of three pairs of primers for amplifying the partial sequence in Dmrt1. M Lane: Marker; Lane 1: PCR products of 913F/1021R; Lane 2: PCR products of 940F/940R.
Animals 14 02968 g008
Figure 9. Homologous sequences of MSM-222 and MSM-261 in Dmrt1 of R. dybowskii. (a) Comparison between MSM-222 and R1092; the sequence shown in the red box is of the primer Forward1; (b) comparison between MSM-261 and R940; the sequence shown in the green box is of the primer Forward2.
Figure 9. Homologous sequences of MSM-222 and MSM-261 in Dmrt1 of R. dybowskii. (a) Comparison between MSM-222 and R1092; the sequence shown in the red box is of the primer Forward1; (b) comparison between MSM-261 and R940; the sequence shown in the green box is of the primer Forward2.
Animals 14 02968 g009
Table 1. Primer sequences and pairs of primers used for the identification of the genotypic sex of Rana dybowskii.
Table 1. Primer sequences and pairs of primers used for the identification of the genotypic sex of Rana dybowskii.
MarkerPrimerSequence (5′→3′)
MSM-222Forward1Dmrt1-1GGCTATTCGTCGCTACTAAAGG
Reverse1EM4GACTGCGTACGAATTTGA
MSM-261Forward2Dmrt1-2GGTCATTCCTTGTCCTAATTATCAGT
Reverse2EM7GACTGCGTACGAATTGAG
Table 2. Primer sequences and primer pairs used for identifying the location of two male-specific DNA markers (MSM-222 and MSM-261) on the assembled genome of R. dybowskii.
Table 2. Primer sequences and primer pairs used for identifying the location of two male-specific DNA markers (MSM-222 and MSM-261) on the assembled genome of R. dybowskii.
Verify TargetPrimerSequence (5′→3′)Annealing Temperature (°C)Time of Extension (s)Position of Template
Upstream MSM-222 in scaffolding genomes289FTGCATAAGCCATGTCTGTG51.560>RanDyb_scaf_498:645910742-645911053
289RAGAACTTGCTTCAAAATTTAA
Downstream MSM-222 in scaffolding genomes303FTGATGCAACGCTGCTCTC47.560RanDyb_scaf_498:505645920-505646238
303RCTATTTGTTTTCTAATCTGGTTG
Double-ended MSM-261 in scaffolding genomes403FAAACTAACAATTATTCTTCC5160>RanDyb_scaf_3:159744804-159745236
403RGTGGTGCAATGTGAAGC
Table 3. Primer sequences and primer pairs used for identifying the suspected location of two male-specific DNA markers (MSM-222 and MSM-261) on the Dmrt1 gene of R. dybowskii.
Table 3. Primer sequences and primer pairs used for identifying the suspected location of two male-specific DNA markers (MSM-222 and MSM-261) on the Dmrt1 gene of R. dybowskii.
Verify TargetPrimerSequence (5′→3′)Annealing Temperature (°C)Time of Extension (s)Position of Template
Suspicious location of MSM-222 in Dmrt1913FTTGTGGAGGATTGTTACCCAAT61.490>RanDyb_Dmrt1:1-1020
1021RCTCTCCACCCAAAACAAAAATAAT
Suspicious location of MSM-261 in Dmrt1940FAAACTAACAATTATTCTTCC47.860>RanDyb_Dmrt1:13828-14767
940RGTGGTGCAATGTGAAGC
Table 4. Quality assessment of the sequencing data.
Table 4. Quality assessment of the sequencing data.
Data TypeReadNumBaseCount
(bp)
ReadLength
(bp)
Q20 (%)Q30 (%)GC Content (%)
raw data1,389,252,868208,387,930,200150;15099.0;96.895.2;89.943.2;43.1
clean data1,333,643,016200,046,452,400150;15099.0;96.895.2;89.743.1;43.0
Note: Q20, the ratio of data with an accuracy > 99% in total data. Q30, the ratio of data with an accuracy > 99.9% in total data.
Table 5. Result of NT library comparison.
Table 5. Result of NT library comparison.
SpeciesReads 1Reads 2Total (%)
Rana chensinensis2011891.95
Nanorana parkeri91760.835
Rana rugosa83690.76
Coregonus sp.65570.61
Rana temporaria54570.555
Table 6. Comparison of the genome size of amphibians.
Table 6. Comparison of the genome size of amphibians.
SpeciesGenome Size (G)
Spea bombifrons0.96
Xenopus tropicalis1.5
Pyxicephalus adspersus1.6
Leptodactylus fuscus2.2
Engystomops pustulosus2.6
Xenopus borealis2.7
Xenopus laevis2.7
Eleutherodactylus coqui2.8
Pelobates cultripes3.1
Hymenochirus boettgeri3.2
Leptobrachium ailaonicum3.5
Leptobrachium leishanense3.5
Rana dybowskii3.5
Monodelphis domestica3.6
Geotrypetes seraphini3.8
Bufotes viridis3.8
Discoglossus pictus3.9
Hyla sarda4.1
Rana temporaria4.1
Gastrophryne carolinensis4.3
Bufo gargarizans4.5
Microcaecilia unicolor4.7
Bufo bufo5
Rhinatrema bivittatum5.3
Ranitomeya imitator6
Pseudophryne corroboree8.9
Bombina bombina10
Ichthyophis bannanicus12.4
Ambystoma mexicanum28.2
Table 7. Preliminary scaffolding genome of R. dybowskii.
Table 7. Preliminary scaffolding genome of R. dybowskii.
ItemContigScaffold
Total Number270,785498
Total size contig/scaffolds (bp)374,8543,4153765,862,278
Longest contig/scaffolds (bp)137,967,4851,808,367,828
Shortest contig/scaffolds (bp)62881
Number of contig/scaffolds > 1K nt233,279497
Percentage of contig/scaffolds > 1K nt86.1099.80
Number of contig/scaffolds > 10K nt99,620451
Percentage of contig/scaffolds > 10K nt36.8090.60
Number of contig/scaffolds > 100K nt2274213
Percentage of contig/scaffolds > 100K nt0.8042.80
Number of contig/scaffolds > 1M nt1341
Percentage of contig/scaffolds > 1M nt0.008.20
Number of contig/scaffolds > 10M nt214
Percentage of contig/scaffolds > 10M nt0.002.80
Mean contig/scaffolds size13,8437,561,972
Median contig/scaffolds size583769,683
N50 contig/scaffolds length31,988336,385,783
L50 contig/scaffolds count29,0922
contig/scaffolds %A28.228.07
contig/scaffolds %C21.1321.03
contig/scaffolds %G21.1521.05
contig/scaffolds %T28.2228.09
contig/scaffolds %N1.31.75
contig/scaffolds %non-ACGTN00
Number of contig/scaffolds non-ACGTN nt00
Percentage of assembly in scaffolded contigs100
Percentage of assembly in unscaffolded contigs0
Average number of contigs per scaffold543.7
Average length of break (≥25 Ns) between contigs in scaffold64
Number of contigs in scaffolds270,745
Number of contigs not in scaffolds40
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Xu, Y.; Liu, H.; Jiang, X.; Zhang, X.; Liu, J.; Tian, Y.; Bai, X.; Cui, S.; Di, S. Genome Survey of Male Rana dybowskii to Further Understand the Sex Determination Mechanism. Animals 2024, 14, 2968. https://doi.org/10.3390/ani14202968

AMA Style

Xu Y, Liu H, Jiang X, Zhang X, Liu J, Tian Y, Bai X, Cui S, Di S. Genome Survey of Male Rana dybowskii to Further Understand the Sex Determination Mechanism. Animals. 2024; 14(20):2968. https://doi.org/10.3390/ani14202968

Chicago/Turabian Style

Xu, Yuan, Hanyu Liu, Xinshuai Jiang, Xinning Zhang, Jiayu Liu, Yaguang Tian, Xiujuan Bai, Shiquan Cui, and Shengwei Di. 2024. "Genome Survey of Male Rana dybowskii to Further Understand the Sex Determination Mechanism" Animals 14, no. 20: 2968. https://doi.org/10.3390/ani14202968

APA Style

Xu, Y., Liu, H., Jiang, X., Zhang, X., Liu, J., Tian, Y., Bai, X., Cui, S., & Di, S. (2024). Genome Survey of Male Rana dybowskii to Further Understand the Sex Determination Mechanism. Animals, 14(20), 2968. https://doi.org/10.3390/ani14202968

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop