Screening of Genes Related to Fat Deposition of Pekin Ducks Based on Transcriptome Analysis
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Animals
2.2. Sample Collection
2.3. RNA Isolation, cDNA Library Construction and RNA-Seq
2.4. Differential Expression, and Functional Analysis
2.5. Quantitative Real-Time PCR Validation
2.6. Statistical Analysis
3. Results
3.1. Body Weight and Slaughtering Performance
3.2. Overview of Sequencing Data
3.3. Screening DEGs
3.4. Functional Enrichment Analysis of DEGs
3.5. KEGG Pathway Analysis of DEGs
3.6. Validation of DEGs
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Zheng, A.; Chang, W.; Hou, S.; Zhang, S.; Cai, H.; Chen, G.; Lou, R.; Liu, G. Unraveling molecular mechanistic differences in liver metabolism between lean and fat lines of Pekin duck (Anas platyrhynchos domestica): A proteomic study. J. Proteom. 2014, 98, 271–288. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- He, J.; Zheng, H.; Pan, D.; Liu, T.; Sun, Y.; Cao, J.; Wu, Z.; Zeng, X. Effects of aging on fat deposition and meat quality in Sheldrake duck. Poult. Sci. 2018, 97, 2005–2010. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ding, S.R.; Li, G.S.; Chen, S.R.; Zhu, F.; Hao, J.P.; Yang, F.X.; Hou, Z.C. Comparison of carcass and meat quality traits between lean and fat Pekin ducks. Anim. Biosci. 2021, 34, 1193–1201. [Google Scholar] [CrossRef] [Scilit]
- Wang, S.; Liu, J.; Zhao, W.; Wang, G.; Gao, S. Selection of candidate genes for differences in fat metabolism between cattle subcutaneous and perirenal adipose tissue based on RNA-seq. Anim. Biotechnol. 2023, 34, 633–644. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, X.; Zhang, H.; Wang, Y.; Li, Y.; He, C.; Zhu, J.; Xiong, Y.; Lin, Y. RNA-seq analysis reveals the positive role of KLF5 in the differentiation of subcutaneous adipocyte in goats. Gene 2022, 808, 145969. [Google Scholar] [CrossRef] [Scilit]
- Ahn, B.; Choi, M.K.; Yum, J.; Cho, I.C.; Kim, J.H.; Park, C. Analysis of allele-specific expression using RNA-seq of the Korean native pig and Landrace reciprocal cross. Asian-Australas J. Anim. Sci. 2019, 32, 1816–1825. [Google Scholar] [CrossRef] [Scilit]
- Guo, L.; Wei, C.; Yi, L.; Yang, W.; Geng, Z.; Chen, X. Transcriptional Insights into Key Genes and Pathways Underlying Muscovy Duck Subcutaneous Fat Deposition at Different Developmental Stages. Animals 2021, 11, 2099. [Google Scholar] [CrossRef] [Scilit]
- Rosenkranz, R.; Borodina, T.; Lehrach, H.; Himmelbauer, H. Characterizing the mouse ES cell transcriptome with Illumina sequencing. Genomics 2008, 92, 187–194. [Google Scholar] [CrossRef] [Scilit]
- Ansorge, W.J. Next-generation DNA sequencing techniques. New Biotechnol. 2009, 25, 195–203. [Google Scholar] [CrossRef] [Scilit]
- Huang, Y.; Li, Y.; Burt, D.W.; Chen, H.; Zhang, Y.; Qian, W.; Kim, H.; Gan, S.; Zhao, Y.; Li, J.; et al. The duck genome and transcriptome provide insight into an avian influenza virus reservoir species. Nat. Genet. 2013, 45, 776–783. [Google Scholar] [CrossRef] [Scilit]
- Zhu, F.; Yin, Z.T.; Wang, Z.; Smith, J.; Zhang, F.; Martin, F.; Ogeh, D.; Hincke, M.; Lin, F.B.; Burt, D.W.; et al. Three chromosome-level duck genome assemblies provide insights into genomic variation during domestication. Nat. Commun. 2021, 12, 5932. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Z.; Jia, Y.; Almeida, P.; Mank, J.E.; van Tuinen, M.; Wang, Q.; Jiang, Z.; Chen, Y.; Zhan, K.; Hou, S.; et al. Whole-genome resequencing reveals signatures of selection and timing of duck domestication. Gigascience 2018, 7, giy027. [Google Scholar] [CrossRef] [Scilit]
- Li, X.J.; Yang, H.; Li, G.X.; Zhang, G.H.; Cheng, J.; Guan, H.; Yang, G.S. Transcriptome profile analysis of porcine adipose tissue by high-throughput sequencing. Anim. Genet. 2012, 43, 144–152. [Google Scholar] [CrossRef] [Scilit]
- Huang, W.; Guo, Y.; Du, W.; Zhang, X.; Li, A.; Miao, X. Global transcriptome analysis identifies differentially expressed genes related to lipid metabolism in Wagyu and Holstein cattle. Sci. Rep. 2017, 7, 5278. [Google Scholar] [CrossRef] [Scilit]
- Miao, X.; Luo, Q.; Qin, X.; Guo, Y.; Zhao, H. Genome-wide mRNA-seq profiling reveals predominant down-regulation of lipid metabolic processes in adipose tissues of Small Tail Han than Dorset sheep. Biochem. Biophys. Res. Commun. 2015, 467, 413–420. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Huang, H.Y.; Liu, R.R.; Zhao, G.P.; Li, Q.H.; Zheng, M.Q.; Zhang, J.J.; Li, S.F.; Liang, Z.; Wen, J. Integrated analysis of microRNA and mRNA expression profiles in abdominal adipose tissues in chickens. Sci. Rep. 2015, 5, 16132. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- NY/T 823-2020. Performance Terminology and Measurements for Poultry. Ministry of Agriculture and Rural Affairs: Beijing, China, 2020.
- Lin, F.B.; Zhu, F.; Hao, J.P.; Yang, F.X.; Hou, Z.C. In vivo prediction of the carcass fatness using live body measurements in Pekin ducks. Poult. Sci. 2018, 97, 2365–2371. [Google Scholar] [CrossRef] [Scilit]
- Wu, X.; Zou, X.; Chang, Q.; Zhang, Y.; Li, Y.; Zhang, L.; Huang, J.; Liang, B. The evolutionary pattern and the regulation of stearoyl-CoA desaturase genes. Biomed. Res. Int. 2013, 2013, 856521. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- AM, A.L.; Syed, D.N.; Ntambi, J.M. Insights into Stearoyl-CoA Desaturase-1 Regulation of Systemic Metabolism. Trends Endocrinol. Metab. 2017, 28, 831–842. [Google Scholar] [CrossRef] [Scilit]
- Hyun, C.K.; Kim, E.D.; Flowers, M.T.; Liu, X.; Kim, E.; Strable, M.; Ntambi, J.M. Adipose-specific deletion of stearoyl-CoA desaturase 1 up-regulates the glucose transporter GLUT1 in adipose tissue. Biochem. Biophys. Res. Commun. 2010, 399, 480–486. [Google Scholar] [CrossRef] [Scilit]
- Strable, M.S.; Ntambi, J.M. Genetic control of de novo lipogenesis: Role in diet-induced obesity. Crit. Rev. Biochem. Mol. Biol. 2010, 45, 199–214. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pinteric, M.; Podgorski, I.I.; Popovic Hadzija, M.; Tartaro Bujak, I.; Tadijan, A.; Balog, T.; Sobocanec, S. Chronic High Fat Diet Intake Impairs Hepatic Metabolic Parameters in Ovariectomized Sirt3 KO Mice. Int. J. Mol. Sci. 2021, 22, 4277. [Google Scholar] [CrossRef] [Scilit]
- Luo, N.; Shu, J.; Yuan, X.; Jin, Y.; Cui, H.; Zhao, G.; Wen, J. Differential regulation of intramuscular fat and abdominal fat deposition in chickens. BMC Genom. 2022, 23, 308. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- He, Z.; Yu, J.; Zhou, C.; Ren, G.; Cong, P.; Mo, D.; Chen, Y.; Liu, X. MiR-143 is not essential for adipose development as revealed by in vivo antisense targeting. Biotechnol. Lett. 2013, 35, 499–507. [Google Scholar] [CrossRef] [Scilit]
- Zillessen, P.; Celner, J.; Kretschmann, A.; Pfeifer, A.; Racke, K.; Mayer, P. Metabolic role of dipeptidyl peptidase 4 (DPP4) in primary human (pre)adipocytes. Sci. Rep. 2016, 6, 23074. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, H.; Shen, L.Y.; Xu, Z.C.; Kramer, L.M.; Yu, J.Q.; Zhang, X.Y.; Na, W.; Yang, L.L.; Cao, Z.P.; Luan, P.; et al. Haplotype-based genome-wide association studies for carcass and growth traits in chicken. Poult. Sci. 2020, 99, 2349–2361. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zamani, N.; Brown, C.W. Emerging roles for the transforming growth factor-beta superfamily in regulating adiposity and energy expenditure. Endocr. Rev. 2011, 32, 387–403. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Singh, K.; Sachan, N.; Ene, T.; Dabovic, B.; Rifkin, D. Latent transforming growth factor beta binding protein 3 controls adipogenesis. Matrix Biol. 2022, 112, 155–170. [Google Scholar] [CrossRef] [Scilit]
- Thompson, B.R.; Lobo, S.; Bernlohr, D.A. Fatty acid flux in adipocytes: The in’s and out’s of fat cell lipid trafficking. Mol. Cell. Endocrinol. 2010, 318, 24–33. [Google Scholar] [CrossRef] [Scilit]
- Girousse, A.; Langin, D. Adipocyte lipases and lipid droplet-associated proteins: Insight from transgenic mouse models. Int. J. Obes. 2012, 36, 581–594. [Google Scholar] [CrossRef] [Scilit]
- Yang, A.; Mottillo, E.P. Adipocyte lipolysis: From molecular mechanisms of regulation to disease and therapeutics. Biochem. J. 2020, 477, 985–1008. [Google Scholar] [CrossRef] [Scilit]
- Chaves, V.E.; Frasson, D.; Kawashita, N.H. Several agents and pathways regulate lipolysis in adipocytes. Biochimie 2011, 93, 1631–1640. [Google Scholar] [CrossRef] [Scilit]
- Ahmadian, M.; Wang, Y.; Sul, H.S. Lipolysis in adipocytes. Int. J. Biochem. Cell. Biol. 2010, 42, 555–559. [Google Scholar] [CrossRef] [Scilit]
- Wang, Y.; Kory, N.; BasuRay, S.; Cohen, J.C.; Hobbs, H.H. PNPLA3, CGI-58, and Inhibition of Hepatic Triglyceride Hydrolysis in Mice. Hepatology 2019, 69, 2427–2441. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yang, A.; Mottillo, E.P.; Mladenovic-Lucas, L.; Zhou, L.; Granneman, J.G. Dynamic interactions of ABHD5 with PNPLA3 regulate triacylglycerol metabolism in brown adipocytes. Nat. Metab. 2019, 1, 560–569. [Google Scholar] [CrossRef] [Scilit]
- Sunami, Y.; Rebelo, A.; Kleeff, J. Lipid Droplet-Associated Factors, PNPLA3, TM6SF2, and HSD17B Proteins in Hepatopancreatobiliary Cancer. Cancers 2021, 13, 4391. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gao, X.; Zhao, N.; Dong, L.; Zheng, X.; Zhang, Y.; Ding, C.; Zhao, S.; Ma, Z.; Wang, Y. A Novel Lipid Prognostic Signature of ADCY2, LIPE, and OLR1 in Head and Neck Squamous Cell Carcinoma. Front. Oncol. 2021, 11, 735993. [Google Scholar] [CrossRef] [Scilit]
- Han, S.F.; Jiao, J.; Zhang, W.; Xu, J.Y.; Zhang, W.; Fu, C.L.; Qin, L.Q. Lipolysis and thermogenesis in adipose tissues as new potential mechanisms for metabolic benefits of dietary fiber. Nutrition 2017, 33, 118–124. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bae, J.Y.; Woo, J.; Roh, H.T.; Lee, Y.H.; Ko, K.; Kang, S.; Shin, K.O. The effects of detraining and training on adipose tissue lipid droplet in obese mice after chronic high-fat diet. Lipids Health Dis. 2017, 16, 13. [Google Scholar] [CrossRef] [Scilit]
- Nielsen, T.S.; Jessen, N.; Jorgensen, J.O.; Moller, N.; Lund, S. Dissecting adipose tissue lipolysis: Molecular regulation and implications for metabolic disease. J. Mol. Endocrinol. 2014, 52, R199–R222. [Google Scholar] [CrossRef] [Scilit]
- Daily, J.W.; Yang, H.J.; Liu, M.; Kim, M.J.; Park, S. Subcutaneous fat mass is associated with genetic risk scores related to proinflammatory cytokine signaling and interact with physical activity in middle-aged obese adults. Nutr. Metab. 2019, 16, 75. [Google Scholar] [CrossRef] [Scilit]
- Kirkby, B.; Roman, N.; Kobe, B.; Kellie, S.; Forwood, J.K. Functional and structural properties of mammalian acyl-coenzyme A thioesterases. Prog. Lipid Res. 2010, 49, 366–377. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hunt, M.C.; Siponen, M.I.; Alexson, S.E. The emerging role of acyl-CoA thioesterases and acyltransferases in regulating peroxisomal lipid metabolism. Biochim. Biophys. Acta 2012, 1822, 1397–1410. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Brocker, C.; Carpenter, C.; Nebert, D.W.; Vasiliou, V. Evolutionary divergence and functions of the human acyl-CoA thioesterase gene (ACOT) family. Hum. Genom. 2010, 4, 411–420. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Krause, K.; Weiner, J.; Hones, S.; Kloting, N.; Rijntjes, E.; Heiker, J.T.; Gebhardt, C.; Kohrle, J.; Fuhrer, D.; Steinhoff, K.; et al. The Effects of Thyroid Hormones on Gene Expression of Acyl-Coenzyme A Thioesterases in Adipose Tissue and Liver of Mice. Eur. Thyroid. J. 2015, 4, 59–66. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lv, Z.; Xing, K.; Li, G.; Liu, D.; Guo, Y. Dietary Genistein Alleviates Lipid Metabolism Disorder and Inflammatory Response in Laying Hens with Fatty Liver Syndrome. Front. Physiol. 2018, 9, 1493. [Google Scholar] [CrossRef] [Scilit] [PubMed]





| Gene | Primer Sequences (5′ to 3′) |
|---|---|
| ADCY2 | F: GCGAGCGGCGAGCAGTC |
| R: TGAGGAGCAGGAAGACGAGGAG | |
| ITGA11 | F: ACAACCGCAACCTCACCATCC |
| R: ACACCATCACCGTTCACATCCAG | |
| MINAR1 | F: GAGGCAGACAGGCAATACGAAATC |
| R: GCAGGGTAGGGATGAGGACTAAAG | |
| TNFSF10 | F: GCCGTCACCTTCCTCTACTTCAC |
| R: AAATCTCCAAGTTCCTCCCCAGTG | |
| DUSP11 | F: AGAATTTGGGCTTGGACCTCCTC |
| R: CTTGCTTGCGGTTCTTCTTGGTAG | |
| ENSAPLG00000007740 | F: GATGCGGGCGTGGGAGTG |
| R: GATGAGGAACTGTGGAAGCAAAGC | |
| GAPDH | F: AGTGAAGGCTGCTGCTGATGG |
| R: TCAAAGGTGGAGGAATGGCTGTC |
| Items | Nankou 1 | Jingdian | p-Value from ANOVA | ||||
|---|---|---|---|---|---|---|---|
| Female | Male | Female | Male | Strain | Sex | Strain × Sex | |
| Live weight (kg) | 3.94 ± 0.05 | 4.01 ± 0.05 | 3.84 ± 0.03 | 4.00 ± 0.05 | 0.252 | 0.020 | 0.360 |
| Eviscerated yield (%) | 74.68 ± 1.32 | 74.59 ± 1.26 | 74.17 ± 1.10 | 76.83 ± 0.68 | 0.447 | 0.259 | 0.228 |
| Breast muscle yield (%) | 12.17 ± 0.39 A | 11.75 ± 0.28 Aa | 14.17 ± 0.36 B | 13.06 ± 0.24 b | <0.001 | 0.024 | 0.296 |
| Thigh muscle yield (%) | 9.35 ± 0.36 | 9.67 ± 0.14 | 9.58 ± 0.16 | 9.46 ± 0.34 | 0.976 | 0.710 | 0.412 |
| Abdominal fat yield (%) | 3.28 ± 0.14 A | 3.06 ± 0.13 | 3.25 ± 0.10 a | 2.60 ± 0.18 Bb | 0.100 | 0.005 | 0.141 |
| Subcutaneous fat yield (%) | 39.52 ± 1.14 | 40.61 ± 2.26 a | 38.42 ± 1.12 | 34.02 ± 1.29 b | 0.018 | 0.287 | 0.083 |
| Gene_id | Gene Name | Gene Description | Log2FC(A/C) | p-Adjust | Log2FC(B/D) | p-Adjust |
|---|---|---|---|---|---|---|
| ENSAPLG00000002172 | CH25H | Cholesterol 25-hydroxylase | 1.694446363 | 0.002958384 | —— | —— |
| ENSAPLG00000003497 | —— | —— | −1.78896802 | 2.31 × 10−23 | 1.451332565 | 2.70 × 10−12 |
| ENSAPLG00000003663 | ITGA11 | Integrin subunit alpha 11 | −1.74401932 | 3.14 × 10−32 | 1.368413056 | 3.71 × 10−7 |
| ENSAPLG00000004328 | FGF7 | Fibroblast growth factor 7 | 1.169631738 | 3.31 × 10−8 | 1.388239511 | 0.000132701 |
| ENSAPLG00000008644 | ADCY2 | Adenylate cyclase 2 | 1.136973915 | 0.023019894 | 1.471927986 | 0.004665066 |
| ENSAPLG00000010035 | LPAR1 | lysophosphatidic acid receptor 1 | 1.559385156 | 3.03 × 10−7 | 1.238075251 | 0.011128412 |
| ENSAPLG00000010423 | THSD4 | Thrombospondin type 1 domain containing 4 | 1.570837435 | 7.39 × 10−6 | −1.41148092 | 9.37 × 10−8 |
| ENSAPLG00000010434 | —— | —— | 5.565023239 | 0.009097501 | −3.39527429 | 0.004851312 |
| ENSAPLG00000010439 | WNT11 | Wnt family member 11 | 1.208117664 | 0.000584256 | 1.513587588 | 6.41 × 10−5 |
| ENSAPLG00000012621 | LTBP1 | Latent transforming growth factor beta binding protein 1 | 1.815485766 | 1.54 × 10−22 | 1.431284807 | 0.000190098 |
| ENSAPLG00000015737 | LGR5 | Leucine rich repeat containing G protein-coupled receptor 5 | 2.443874812 | 1.48 × 10−6 | 1.910981744 | 1.99 × 10−6 |
| ENSAPLG00000023048 | ACOT8 | Acyl-CoA thioesterase 8 | 5.889463356 | 0.004179155 | 7.347192617 | 0.003168815 |
| ENSAPLG00000030592 | —— | —— | 2.434530022 | 0.047749977 | 7.022715461 | 1.32 × 10−68 |
| ENSAPLG00000015665 | SCD | Stearoyl-CoA desaturase | —— | —— | 2.646755213 | 5.92 × 10−15 |
| ENSAPLG00000002630 | PNPLA3 | Patatin like phospholipase domain containing 3 | —— | —— | 1.651888747 | 1.38 × 10−15 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Shi, B.; Zhang, Z.; Lv, X.; An, K.; Li, L.; Xia, Z. Screening of Genes Related to Fat Deposition of Pekin Ducks Based on Transcriptome Analysis. Animals 2024, 14, 268. https://doi.org/10.3390/ani14020268
Shi B, Zhang Z, Lv X, An K, Li L, Xia Z. Screening of Genes Related to Fat Deposition of Pekin Ducks Based on Transcriptome Analysis. Animals. 2024; 14(2):268. https://doi.org/10.3390/ani14020268
Chicago/Turabian StyleShi, Bozhi, Ziyue Zhang, Xueze Lv, Keying An, Lei Li, and Zhaofei Xia. 2024. "Screening of Genes Related to Fat Deposition of Pekin Ducks Based on Transcriptome Analysis" Animals 14, no. 2: 268. https://doi.org/10.3390/ani14020268
APA StyleShi, B., Zhang, Z., Lv, X., An, K., Li, L., & Xia, Z. (2024). Screening of Genes Related to Fat Deposition of Pekin Ducks Based on Transcriptome Analysis. Animals, 14(2), 268. https://doi.org/10.3390/ani14020268
