Molecular Characterization and Functional Analysis of Hypoxia-Responsive Factor Prolyl Hydroxylase Domain 2 in Mandarin Fish (Siniperca chuatsi)
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Fish and Cells
2.2. Molecular Cloning of Mandarin Fish PHD2 (scPHD2) cDNAs
2.3. Sequence Analysis
2.4. Three-Dimensional Structure Prediction
2.5. Dual-Luciferase Reporter Gene Assays
2.6. Real-Time Quantitative PCR (RT-qPCR)
2.7. Indirect Immunofluorescence Assay (IFA)
2.8. Co-Immunoprecipitation (Co-IP) and Western Blot Analysis
2.9. Protein-Degradation Experiment
2.10. Statistical Analysis
3. Results
3.1. Molecular Characteristics of scPHD2
3.2. scPHD2 Inhibited the HIF-1 Signaling Pathway
3.3. scPHD2 Interacted with scHIF-1α
3.4. scPHD2 Promoted the Degradation of scHIF-1α and Its Degradation Pathway
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Taylor, C.T.; Pouyssegur, J. Oxygen, Hypoxia, and Stress. Ann. N. Y. Acad. Sci. 2007, 1113, 87–94. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hochachka, P.W.; Lutz, P.L. Mechanism, origin, and evolution of anoxia tolerance in animals☆. Comp. Biochem. Physiol. Part B 2001, 130, 435–459. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Caldwell, C.A.; Hinshaw, J. Physiological and haematological responses in rainbow trout subjected to supplemental dissolved oxygen in fish culture. Aquaculture 1994, 126, 183–193. [Google Scholar] [CrossRef] [Scilit]
- Abdel-Tawwab, M.; Monier, M.N.; Hoseinifar, S.H.; Faggio, C. Fish response to hypoxia stress: Growth, physiological, and immunological biomarkers. Fish Physiol. Biochem. 2019, 45, 997–1013. [Google Scholar] [CrossRef] [Scilit]
- Kaelin, W.G., Jr.; Ratcliffe, P.J. Oxygen Sensing by Metazoans: The Central Role of the HIF Hydroxylase Pathway. Mol. Cell 2008, 30, 393–402. [Google Scholar] [CrossRef] [Scilit]
- Pouysségur, J.; Dayan, F.; Mazure, N.M. Hypoxia signalling in cancer and approaches to enforce tumour regression. Nature 2006, 441, 437–443. [Google Scholar] [CrossRef] [Scilit]
- Piontkivska, H.; Chung, J.S.; Ivanina, A.; Sokolov, E.; Techa, S.; Sokolova, I. Molecular characterization and mRNA expression of two key enzymes of hypoxia-sensing pathways in eastern oysters Crassostrea virginica (Gmelin): Hypoxia-inducible factor α (HIF-α) and HIF-prolyl hydroxylase (PHD). Comp. Biochem. Physiol. Part D Genom. Proteom. 2011, 6, 103–114. [Google Scholar] [CrossRef] [Scilit]
- Semenza, G.L. HIF-1, O2, and the 3 PHDs: How animal cells signal hypoxia to the nucleus. Cell 2001, 107, 1–20. [Google Scholar] [CrossRef] [Scilit]
- Bruick, R.K.; McKnight, S.L. A Conserved Family of Prolyl-4-Hydroxylases That Modify HIF. Science 2001, 294, 1337–1340. [Google Scholar] [CrossRef] [Scilit]
- McNeill, L.A.; Hewitson, K.S.; Gleadle, J.M.; Horsfall, L.E.; Oldham, N.J.; Maxwell, P.H.; Pugh, C.W.; Ratcliffe, P.J.; Schofield, C.J. The use of dioxygen by HIF prolyl hydroxylase (PHD1). Bioorganic Med. Chem. Lett. 2002, 12, 1547–1550. [Google Scholar] [CrossRef] [Scilit]
- Giaccia, A.J.; Simon, M.C.; Johnson, R. The biology of hypoxia: The role of oxygen sensing in development, normal function, and disease. Genes Dev. 2004, 18, 2183–2194. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Huang, J.; Zhao, Q.; Mooney, S.M.; Lee, F.S. Sequence determinants in hypoxia-inducible factor-1α for hydroxylation by the prolyl hydroxylases PHD1, PHD2, and PHD3. J. Biol. Chem. 2002, 277, 39792–39800. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Taylor, M.S. Characterization and comparative analysis of the EGLN gene family. Gene 2001, 275, 125–132. [Google Scholar] [CrossRef] [Scilit]
- Rytkönen, K.T.; Williams, T.A.; Renshaw, G.M.; Primmer, C.R.; Nikinmaa, M. Molecular Evolution of the Metazoan PHD–HIF Oxygen-Sensing System. Mol. Biol. Evol. 2011, 28, 1913–1926. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Maxwell, P.H.; Wiesener, M.S.; Chang, G.-W.; Clifford, S.C.; Vaux, E.C.; Cockman, M.E.; Wykoff, C.C.; Pugh, C.W.; Maher, E.R.; Ratcliffe, P.J. The tumour suppressor protein VHL targets hypoxia-inducible factors for oxygen-dependent proteolysis. Nature 1999, 399, 271–275. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ivan, M.; Kondo, K.; Yang, H.; Kim, W.; Valiando, J.; Ohh, M.; Salic, A.; Asara, J.M.; Lane, W.S.; Kaelin, W.G., Jr. HIFalpha targeted for VHL-mediated destruction by proline hydroxylation: Implications for O2 sensing. Science 2001, 292, 464–468. [Google Scholar] [CrossRef] [Scilit]
- Jaakkola, P.; Mole, D.R.; Tian, Y.M.; Wilson, M.I.; Gielbert, J.; Gaskell, S.J.; von Kriegsheim, A.; Hebestreit, H.F.; Mukherji, M.; Schofield, C.J.; et al. Targeting of HIF-alpha to the von Hippel–Lindau ubiquitylation complex by O2-regulated prolyl hydroxylation. Science 2001, 292, 468–472. [Google Scholar] [CrossRef] [Scilit]
- Yu, F.; White, S.B.; Zhao, Q.; Lee, F.S. HIF-1alpha binding to VHL is regulated by stimulus-sensitive proline hydroxylation. Proc. Natl. Acad. Sci. USA 2001, 98, 9630–9635. [Google Scholar] [CrossRef] [Scilit]
- Freeman, R.S.; Hasbani, D.M.; Lipscomb, E.A.; Straub, J.A.; Xie, L. SM-20, EGL-9, and the EGLN family of hypoxia-inducible factor prolyl hydroxylases. Mol. Cells 2003, 16, 1–12. [Google Scholar]
- Han, W.Q.; Zhu, Q.; Hu, J.; Li, P.L.; Zhang, F.; Li, N. Hypoxia-inducible factor prolyl-hydroxylase-2 mediates transforming growth factor beta 1-induced epithelial–mesenchymal transition in renal tubular cells. Biochim. Biophys. Acta 2013, 1833, 1454–1462. [Google Scholar] [CrossRef] [Scilit]
- Majmundar, A.J.; Wong, W.J.; Simon, M.C. Hypoxia-Inducible Factors and the Response to Hypoxic Stress. Mol. Cell 2010, 40, 294–309. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kong, P.; Yu, K.; Yang, M.; Almahi, W.A.; Nie, L.; Chen, G.; Han, W. Micheliolide Enhances Radiosensitivities of p53-Deficient Non-Small-Cell Lung Cancer via Promoting HIF-1α Degradation. Int. J. Mol. Sci. 2020, 21, 3392. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Freedman, S.J.; Sun, Z.-Y.J.; Poy, F.; Kung, A.L.; Livingston, D.M.; Wagner, G.; Eck, M.J. Structural basis for recruitment of CBP/p300 by hypoxia-inducible factor-1α. Proc. Natl. Acad. Sci. USA 2002, 99, 5367–5372. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wenger, R.; Stiehl, D.; Camenisch, G. Integration of Oxygen Signaling at the Consensus HRE. Sci. STKE 2005, 2005, re12. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- He, Y.; Munday, J.S.; Perrott, M.; Wang, G.; Liu, X. Association of age with the expression of hypoxia-inducible factors HIF-1α, HIF-2α, HIF-3α and VEGF in lung and heart of tibetan sheep. Animals 2019, 9, 673. [Google Scholar] [CrossRef] [Scilit]
- Jones, N.M.; Bergeron, M. Hypoxic preconditioning induces changes in HIF-1 target genes in neonatal rat brain. J. Cereb. Blood Flow Metab. 2001, 21, 1105–1114. [Google Scholar] [CrossRef] [Scilit]
- Bernaudin, M.; Tang, Y.; Reilly, M.; Petit, E.; Sharp, F.R. Brain genomic responses following hypoxia and re-oxygenation in neonatal rat. J. Biol. Chem. 2002, 277, 39728–39738. [Google Scholar] [CrossRef] [Scilit]
- Aragonés, J.; Fraisl, P.; Baes, M.; Carmeliet, P. Oxygen Sensors at the Crossroad of Metabolism. Cell Metab. 2009, 9, 11–22. [Google Scholar] [CrossRef] [Scilit]
- McMahon, S.; Charbonneau, M.; Grandmont, S.; Richard, D.; Dubois, C. Transforming growth factor beta1 induces hypoxia-inducible factor-1 stabilization through selective inhibition of PHD2 expression. J. Biol. Chem. 2006, 281, 24171–24181. [Google Scholar] [CrossRef] [Scilit]
- Chen, D.; Guo, X.; Nie, P. Phylogenetic studies of sinipercid fish (Perciformes: Sinipercidae) based on multiple genes, with first application of an immune-related gene, the virus-induced protein (viperin) gene. Mol. Phylogenetics Evol. 2010, 55, 1167–1176. [Google Scholar] [CrossRef] [Scilit]
- Liu, J.; Cui, Y.; Liu, J. Food consumption and growth of two piscivorous fishes, the mandarin fish and the Chinese snakehead. J. Fish Biol. 1998, 53, 1071–1083. [Google Scholar] [CrossRef]
- Duan, Y.; Dong, X.; Zhang, X.; Miao, Z. Effects of dissolved oxygen concentration and stocking density on the growth, energy budget and body composition of juvenile Japanese flounder, Paralichthys olivaceus (Temminck et Schlegel). Aquac. Res. 2010, 42, 407–416. [Google Scholar] [CrossRef] [Scilit]
- Richards, J.G.; Farrell, A.P.; Brauner, C.J. Fish Physiology: Hypoxia; Academic Press: Cambridge, MA, USA, 2009. [Google Scholar]
- Geng, X.; Feng, J.; Liu, S.; Wang, Y.; Arias, C.; Liu, Z. Transcriptional regulation of hypoxia inducible factors alpha (HIF-α) and their inhibiting factor (FIH-1) of channel catfish (Ictalurus punctatus) under hypoxia. Comp. Biochem. Physiol. Part B Biochem. Mol. Biol. 2014, 169, 38–50. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dong, C.; Weng, S.; Shi, X.; Xu, X.; Shi, N.; He, J. Development of a mandarin fish Siniperca chuatsi fry cell line suitable for the study of infectious spleen and kidney necrosis virus (ISKNV). Virus Res. 2008, 135, 273–281. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jumper, J.; Evans, R.; Pritzel, A.; Green, T.; Figurnov, M.; Ronneberger, O.; Tunyasuvunakool, K.; Bates, R.; Žídek, A.; Potapenko, A.; et al. Highly accurate protein structure prediction with AlphaFold. Nature 2021, 596, 583–589. [Google Scholar] [CrossRef] [Scilit]
- Evans, R.; O’Neill, M.; Pritzel, A.; Antropova, N.; Senior, A.; Green, T.; Žídek, A.; Bates, P.; Blackwell, P.; Yim, P.; et al. Protein complex prediction with AlphaFold-Multimer. BioRxiv 2022. BioRxiv 2021–10. [Google Scholar]
- He, J.; Xie, T.-L.; Li, X.; Yu, Y.; Zhan, Z.-P.; Weng, S.-P.; Guo, C.-J. Molecular cloning of Y-Box binding protein-1 from mandarin fish and its roles in stress-response and antiviral immunity. Fish Shellfish. Immunol. 2019, 93, 406–415. [Google Scholar] [CrossRef] [Scilit]
- Xiao, W. The hypoxia signaling pathway and hypoxic adaptation in fishes. Sci. China Life Sci. 2015, 58, 148–155. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shen, C.; Powell-Coffman, J.A. Genetic analysis of hypoxia signaling and response in C. Elegans Ann. N. Y. Acad. Sci. 2003, 995, 191–199. [Google Scholar] [CrossRef] [Scilit]
- Webster, K.A. Evolution of the coordinate regulation of glycolytic enzyme genes by hypoxia. J. Exp. Biol. 2003, 206, 2911–2922. [Google Scholar] [CrossRef] [Scilit]
- Semenza, G.L. Hydroxylation of HIF-1: Oxygen Sensing at the Molecular Level. Physiology 2004, 19, 176–182. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shen, C.; Nettleton, D.; Jiang, M.; Kim, S.K.; Powell-Coffman, J.A. Roles of the HIF-1 Hypoxia-inducible Factor during Hypoxia Response in Caenorhabditis elegans. J. Biol. Chem. 2005, 280, 20580–20588. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lahiri, S.; Roy, A.; Baby, S.M.; Hoshi, T.; Semenza, G.L.; Prabhakar, N.R. Oxygen sensing in the body. Prog. Biophys. Mol. Biol. 2006, 91, 249–286. [Google Scholar] [CrossRef] [Scilit]
- Heise, K.; Puntarulo, S.; Nikinmaa, M.; Lucassen, M.; Pörtner, H.-O. Abele. Oxidative stress and HIF-1 DNA binding during stressful cold exposure and recovery in the North Sea eelpout (Zoarces viviparus). Comp. Biochem. Physiol. A 2006, 143, 494–503. [Google Scholar] [CrossRef] [Scilit]
- Rissanen, E.; Tranberg, H.K.; Nikinmaa, M. Oxygen availability regulates metabolism and gene expression in trout hepatocyte cultures. Am. J. Physiol. Regul. Integr. Comp. Physiol. 2006, 291, R1507–R1515. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rissanen, E.; Tranberg, H.K.; Sollid, J.; Nilsson, G.E.; Nikinmaa, M. Temperature regulates hypoxia-inducible factor-1 (HIF-1) in a poikilothermic vertebrate, crucian carp (Carassius carassius). J. Exp. Biol. 2006, 209, 994–1003. [Google Scholar] [CrossRef] [Scilit]
- Wang, H.; Huang, C.; Chen, N.; Zhu, K.; Chen, B.; Wang, W.; Wang, H. Molecular characterization and mRNA expression of HIF-prolyl hydroxylase-2 (phd2) in hypoxia-sensing pathways from Megalobrama amblycephala. Comp. Biochem. Physiol. Part B 2015, 186, 28–35. [Google Scholar] [CrossRef] [Scilit]
- Lin, X.H.; Ye, M.H.; Seatan, W.; Pan, Y.Y.; Chen, F.Y.; Huang, Y.; Zhu, C.H.; Li, G.L.; Tian, C.X. Sequence Characteristics and mRNA Expression Analysis of the phds Gene Family in Silver Sillago (Sillago sihama) under Hypoxia Stress. J. Guangdong Ocean. Univ. 2020, 40, 1–8. [Google Scholar]
- Li, X.; Zhang, M.; Ling, C.; Sha, H.; Zou, G.; Liang, H. Molecular Characterization and Response of Prolyl Hydroxylase Domain (PHD) Genes to Hypoxia Stress in Hypophthalmichthys molitrix. Animals 2022, 12, 131. [Google Scholar] [CrossRef] [Scilit]
- Pektas, S.; Knapp, M.J. Substrate preference of the HIF-prolyl hydroxylase-2 (PHD2) and substrate-induced conformational change. J. Inorg. Biochem. 2013, 126, 55–60. [Google Scholar] [CrossRef] [Scilit]
- Myllyharju, J. Prolyl 4-hydroxylases, key enzymes in the synthesis of collagens and regulation of the response to hypoxia, and their roles as treatment targets. Ann. Med. 2008, 40, 402–417. [Google Scholar] [CrossRef] [Scilit]
- Myllyharju, J. Prolyl 4-hydroxylases, master regulators of the hypoxia response. Acta Physiol. 2013, 208, 148–165. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Semenza, G.L.; Bels, D.D.; Corazza, F.; Kappler, M.; Eckert, A.W. Oxygen sensing, homeostasis, and disease. N. Engl. J. Med. 2011, 365, 537–547. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Minamishima, Y.A.; Moslehi, J.; Padera, R.F.; Bronson, R.T.; Liao, R.; Kaelin, W.G. A Feedback Loop Involving the Phd3 Prolyl Hydroxylase Tunes the Mammalian Hypoxic Response In Vivo. Mol. Cell. Biol. 2009, 29, 5729–5741. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Han, D.; Wen, L.; Chen, Y. Molecular Cloning of phd1 and Comparative Analysis of phd1, 2, and 3 Expression in Xenopus laevis. Sci. World J. 2012, 2012, 689287. [Google Scholar] [CrossRef] [Scilit]
- Moslehi, J.; Minamishima, Y.A.; Shi, J.; Neuberg, D.M.; Charytan, D.; Padera, R.F.; Signoretti, S.; Liao, R.; Kaelin, W.G. Loss of Hypoxia-Inducible Factor Prolyl Hydroxylase Activity in Cardiomyocytes Phenocopies Ischemic Cardiomyopathy. Circulation 2010, 122, 1004–1016. [Google Scholar] [CrossRef] [Scilit]
- Loenarz, C.; Coleman, M.L.; Boleininger, A.; Schierwater, B.; Holland, P.W.H.; Ratcliffe, P.J.; Schofield, C.J. The hypoxia-inducible transcription factor pathway regulates oxygen sensing in the simplest animal, Trichoplax adhaerens. EMBO Rep. 2011, 12, 63–70. [Google Scholar] [CrossRef] [Scilit]
- Matthews, J.M.; Bhati, M.; Lehtomaki, E.; Mansfield, R.E.; Cubeddu, L.; Mackay, J.P. It Takes Two to Tango: The Structure and Function of LIM, RING, PHD and MYND Domains. Curr. Pharm. Des. 2009, 15, 3681–3696. [Google Scholar] [CrossRef] [Scilit]
- Edurne, B.; Emmanuel, B.; Amandine, G.; Véronique, V.; Danièle, R.; Jacques, P. HIF prolyl-hydroxylase 2 is the key oxygen sensor setting low steady-state levels of HIF-1alpha in normoxia. EMBO J. 2003, 22, 4082–4090. [Google Scholar]
- Shen, R.J.; Jiang, X.Y.; Pu, J.W.; Zou, S.M. HIF-1α and -2α genes in a hypoxia-sensitive teleost species Megalobrama amblycephala: cDNA cloning, expression and different responses to hypoxia. Comp. Biochem. Physiol. Part B Biochem. Mol. Biol. 2010, 157, 273–280. [Google Scholar] [CrossRef] [Scilit]
- Lieb, M.E.; Menzies, K.; Moschella, M.C.; Ni, R.; Taubman, M.B. Mammalian EGLN genes have distinct patterns of mRNA expression and regulation. Biochem. Cell Biol. 2002, 80, 421–426. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Appelhoff, R.J.; Tian, Y.-M.; Raval, R.R.; Turley, H.; Harris, A.L.; Pugh, C.W.; Ratcliffe, P.J.; Gleadle, J.M. Differential Function of the Prolyl Hydroxylases PHD1, PHD2, and PHD3 in the Regulation of Hypoxia-inducible Factor. J. Biol. Chem. 2004, 279, 38458–38465. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Groulx, I.; Lee, S. Oxygen-dependent ubiquitination and degradation of hypoxia-inducible factor requires nuclear-cytoplasmic trafficking of the von Hippel-Lindau tumor suppressor protein. Mol. Cell. Biol. 2002, 22, 5319–5336. [Google Scholar] [CrossRef] [Scilit] [PubMed]




| Name (For Initial PCR) | Sequences |
|---|---|
| 5′ RACE for scPHD2-F | 5′–CTAATAGCACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT–3′ |
| 5′ RACE for scPHD2-R | 5′–ACACTGTGATGGCATACCTGGTGGC–3′ |
| 3′ RACE for scPHD2-F | 5′–GGACTACGAGGCACCGGAGATAA–3′ |
| 3′ RACE for scPHD2-R | 5′–ACTCTGCGTTGATACCACTGCTTGCCCTATAGTGAGTGCTATTAG–3′ |
| scPHD2-F1 | 5′–ATGGAGAAGCAGCAGAGCGATTTGGAC–3′ |
| scPHD2-R1 | 5′–CTAGCTGGGATCTGATGGTTTGCCGA–3′ |
| Genes | Primers | Sequences | Primer Efficiency |
|---|---|---|---|
| scvegf | Forward Reverse | 5′–ACCGAAGGAAACAGAAAGAGG–3′ 5′–CAGGACGGGATGAAGATGTG–3′ | 0.98 |
| scldha | Forward Reverse | 5′–GGTCTTCCTGAGCATCCCTT–3′ 5′–TTCTCCTCTTCGGGCTTCA–3′ | 0.98 |
| scglut 1 | Forward Reverse | 5′–GGTTTATTGTGGCAGAGTTGTT–3′ 5′–CCCACTATGAAGTTGGCAGTC–3′ | 0.97 |
| β-actin | Forward Reverse | 5′–CCCTCTGAACCCCAAAGCCA–3′ 5′–CAGCCTGGATGGCAACGTACA–3′ | 0.96 |
| scphd2 | Forward Reverse | 5′–ACACCGCCACATCTAACG–3′ 5′–GTGCAGGGATTTGACATTCT–3′ | 0.98 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yu, Y.; He, J.; Liu, W.; Li, Z.; Weng, S.; He, J.; Guo, C. Molecular Characterization and Functional Analysis of Hypoxia-Responsive Factor Prolyl Hydroxylase Domain 2 in Mandarin Fish (Siniperca chuatsi). Animals 2023, 13, 1556. https://doi.org/10.3390/ani13091556
Yu Y, He J, Liu W, Li Z, Weng S, He J, Guo C. Molecular Characterization and Functional Analysis of Hypoxia-Responsive Factor Prolyl Hydroxylase Domain 2 in Mandarin Fish (Siniperca chuatsi). Animals. 2023; 13(9):1556. https://doi.org/10.3390/ani13091556
Chicago/Turabian StyleYu, Yang, Jian He, Wenhui Liu, Zhimin Li, Shaoping Weng, Jianguo He, and Changjun Guo. 2023. "Molecular Characterization and Functional Analysis of Hypoxia-Responsive Factor Prolyl Hydroxylase Domain 2 in Mandarin Fish (Siniperca chuatsi)" Animals 13, no. 9: 1556. https://doi.org/10.3390/ani13091556
APA StyleYu, Y., He, J., Liu, W., Li, Z., Weng, S., He, J., & Guo, C. (2023). Molecular Characterization and Functional Analysis of Hypoxia-Responsive Factor Prolyl Hydroxylase Domain 2 in Mandarin Fish (Siniperca chuatsi). Animals, 13(9), 1556. https://doi.org/10.3390/ani13091556

