Prospective Application of Nanoencapsulated Bacillus amyloliquefaciens on Broiler Chickens’ Performance and Gut Health with Efficacy against Campylobacter jejuni Colonization
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethical Statement
2.2. Bacillus amyloliquefaciens-Loaded Nanoparticles (BNPs)
2.3. Birds and Experimental Design Considerations
2.4. Growth Performance and Mortality Indicators
2.5. Sampling Procedure
2.6. Reverse Transcription Quantitative Polymerase Chain Reaction (RT-qPCR)
2.7. Campylobacter jejuni Challenge Model
2.8. Real-Time Quantitative Polymerase Chain Reaction (qPCR) for Evaluating C. jejuni Shedding and Colonization
2.9. Statistical Analysis
3. Results
3.1. Efficacy of B. amyloliquefaciens-Loaded Nanoparticles on Growth Performance and Mortality Percentage of Broiler Chickens
3.2. Efficacy of B. amyloliquefaciens-Loaded Nanoparticles on Expression of Digestive Genes Controlling Digestion
3.3. Efficacy of B. amyloliquefaciens-Loaded Nanoparticles on Broiler Chickens’ Intestinal Microbial Populations
3.4. Efficacy of B. amyloliquefaciens-Loaded Nanoparticles on Intestinal Barrier and Cytokines-Associated Genes
3.5. Efficacy of B. amyloliquefaciens-Loaded Nanoparticles on Shedding and Colonization of C. jejuni
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Ibrahim, D.; Ismail, T.A.; Khalifa, E.; El-Kader, A.; Shaimaa, A.; Mohamed, D.I.; Mohamed, D.T.; Shahin, S.E.; El-Hamid, A.; Marwa, I. Supplementing Garlic Nanohydrogel Optimized Growth, Gastrointestinal Integrity and Economics and Ameliorated Necrotic Enteritis in Broiler Chickens Using a Clostridium perfringens Challenge Model. Animals 2021, 11, 2027. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kishawy, A.T.; Al-Khalaifah, H.S.; Nada, H.S.; Roushdy, E.M.; Zaglool, A.W.; Ahmed Ismail, T.; Ibrahim, S.M.; Ibrahim, D. Black Pepper or Radish Seed Oils in a New Combination of Essential Oils Modulated Broiler Chickens’ Performance and Expression of Digestive Enzymes, Lipogenesis, Immunity, and Autophagy-Related Genes. Vet. Sci. 2022, 9, 43. [Google Scholar] [CrossRef] [Scilit]
- Poudel, S.; Li, T.; Chen, S.; Zhang, X.; Cheng, W.-H.; Sukumaran, A.T.; Kiess, A.S.; Zhang, L. Prevalence, Antimicrobial Resistance, and Molecular Characterization of Campylobacter Isolated from Broilers and Broiler Meat Raised without Antibiotics. Microbiol. Spectr. 2022, 10, e00251-22. [Google Scholar] [CrossRef] [Scilit]
- Aljazzar, A.; Abd El-Hamid, M.I.; El-Malt, R.M.; El-Gharreb, W.R.; Abdel-Raheem, S.M.; Ibrahim, A.M.; Abdelaziz, A.M.; Ibrahim, D. Prevalence and Antimicrobial Susceptibility of Campylobacter Species with Particular Focus on the Growth Promoting, Immunostimulant and Anti-Campylobacter jejuni Activities of Eugenol and Trans-Cinnamaldehyde Mixture in Broiler Chickens. Animals 2022, 12, 905. [Google Scholar] [CrossRef] [Scilit]
- El-Hamid, A.; Marwa, I.; Sewid, A.H.; Samir, M.; Hegazy, W.A.; Bahnass, M.M.; Mosbah, R.A.; Ghaith, D.M.; Khalifa, E.; Ramadan, H. Clonal diversity and epidemiological characteristics of ST239-MRSA strains. Front. Cell. Infect. Microbiol. 2022, 12, 241. [Google Scholar] [CrossRef] [Scilit]
- Ahmed, H.A.; Tahoun, A.B.; Abou Elez, R.M.; Abd El-Hamid, M.I.; Abd Ellatif, S.S. Prevalence of Yersinia enterocolitica in milk and dairy products and the effects of storage temperatures on survival and virulence gene expression. Int. Dairy J. 2019, 94, 16–21. [Google Scholar] [CrossRef] [Scilit]
- Abd El-Hamid, M.I.; Awad, N.F.; Hashem, Y.M.; Abdel-Rahman, M.A.; Abdelaziz, A.M.; Mohammed, I.A.; Abo-Shama, U.H. In vitro evaluation of various antimicrobials against field Mycoplasma gallisepticum and Mycoplasma synoviae isolates in Egypt. Poult. Sci. 2019, 98, 6281–6288. [Google Scholar] [CrossRef] [Scilit]
- Khater, S.I.; Lotfy, M.M.; Alandiyjany, M.N.; Alqahtani, L.S.; Zaglool, A.W.; Althobaiti, F.; Ismail, T.A.; Soliman, M.M.; Saad, S.; Ibrahim, D. Therapeutic Potential of Quercetin Loaded Nanoparticles: Novel Insights in Alleviating Colitis in an Experimental DSS Induced Colitis Model. Biomedicines 2022, 10, 1654. [Google Scholar] [CrossRef] [Scilit]
- Abd El-Hamid, M.I.; El-Sayed, M.; Ali, A.R.; Abdallah, H.; Arnaout, M.I.; El-mowalid, G.A. Marjoram extract down-regulates the expression of Pasteurella multocida adhesion, colonization and toxin genes: A potential mechanism for its antimicrobial activity. Comp. Immunol. Microbiol. Infect. Dis. 2019, 62, 101–108. [Google Scholar] [CrossRef] [Scilit]
- Elfaky, M.A.; Abdel-Hamid, M.I.; Khalifa, E.; Alshareef, W.A.; Mosbah, R.A.; Elazab, S.T.; Ghoneim, M.M.; Al-Sanea, M.M.; Bendary, M.M. Innovative next-generation therapies in combating multi-drug-resistant and multi-virulent Escherichia coli isolates: Insights from in vitro, in vivo, and molecular docking studies. Appl. Microbiol. Biotechnol. 2022, 106, 1691–1703. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Awad, N.F.; Hashem, Y.M.; Elshater, N.S.; Khalifa, E.; Hamed, R.I.; Nossieur, H.H.; Abd-Allah, E.M.; Elazab, S.T.; Nassan, M.A.; Abd El-Hamid, M.I. Therapeutic potentials of aivlosin and/or zinc oxide nanoparticles against Mycoplasma gallisepticum and/or Ornithobacterium rhinotracheale with a special reference to the effect of zinc oxide nanoparticles on aivlosin tissue residues: An in vivo approach. Poult. Sci. 2022, 101, 101884. [Google Scholar] [CrossRef] [Scilit]
- Dhama, K.; Verma, V.; Sawant, P.; Tiwari, R.; Vaid, R.; Chauhan, R. Applications of probiotics in poultry: Enhancing immunity and beneficial effects on production performances and health: A review. J. Immunol. Immunopathol. 2011, 13, 1–19. [Google Scholar]
- Farnell, M.; Donoghue, A.; De Los Santos, F.S.; Blore, P.; Hargis, B.; Tellez, G.; Donoghue, D. Upregulation of oxidative burst and degranulation in chicken heterophils stimulated with probiotic bacteria. Poult. Sci. 2006, 85, 1900–1906. [Google Scholar] [CrossRef] [Scilit]
- Suryadi, U.; Prasetyo, A. Probiotics based on Local Microorganism as a subtitute of Antibiotic Growth Promotor (AGP) on Broiler productivity. In IOP Conference Series: Earth and Environmental Science; IOP Publishing: Chiyoda City, Tokyo, Japan, 2018; p. 012019. [Google Scholar]
- Śmiałek, M.; Kowalczyk, J.; Koncicki, A. The use of probiotics in the reduction of Campylobacter spp. Prevalence in poultry. Animals 2021, 11, 1355. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Al-Khalaifah, H.S.; Shahin, S.E.; Omar, A.E.; Mohammed, H.A.; Mahmoud, H.I.; Ibrahim, D. Effects of graded levels of microbial fermented or enzymatically treated dried brewer’s grains on growth, digestive and nutrient transporter genes expression and cost effectiveness in broiler chickens. BMC Vet. Res. 2020, 16, 1–15. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ibrahim, D.; Abdelfattah-Hassan, A.; Arisha, A.H.; Abd El-Aziz, R.M.; Sherief, W.R.; Adli, S.H.; El Sayed, R.; Metwally, A.E. Impact of feeding anaerobically fermented feed supplemented with acidifiers on its quality and growth performance, intestinal villi and enteric pathogens of mulard ducks. Livest. Sci. 2020, 242, 104299. [Google Scholar] [CrossRef] [Scilit]
- Ibrahim, D.; Moustafa, A.; Shahin, S.; Sherief, W.; Farag, M.; Nassan, M. Impact of fermented or enzymatically fermented dried olive pomace on growth, expression of digestive enzymes and glucose transporters genes, oxidative stability of frozen meat and economic efficiency of broiler chickens. Front. Vet. Sci. 2021, 8, 442. [Google Scholar] [CrossRef] [Scilit]
- Deng, W.; Dittoe, D.K.; Pavilidis, H.O.; Chaney, W.E.; Yang, Y.; Ricke, S.C. Current perspectives and potential of probiotics to limit foodborne Campylobacter in poultry. Front. Microbiol. 2020, 11, 583429. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cutting, S.M. Bacillus probiotics. Food Microbiol. 2011, 28, 214–220. [Google Scholar] [CrossRef] [Scilit]
- Murshed, M.; Abudabos, A. Effects of the dietary inclusion of a probiotic, a prebiotic or their combinations on the growth performance of broiler chickens. Braz. J. Poult. Sci. 2015, 17, 99–103. [Google Scholar] [CrossRef] [Scilit]
- Korenblum, E.; von Der Weid, I.; Santos, A.; Rosado, L.; Sebastián, G.; Coutinho, C.; Magalhaes, F.; De Paiva, M.; Seldin, L. Production of antimicrobial substances by Bacillus subtilis LFE-1, B. firmus H2O-1 and B. licheniformis T6-5 isolated from an oil reservoir in Brazil. J. Appl. Microbiol. 2005, 98, 667–675. [Google Scholar] [CrossRef] [Scilit]
- Omar, A.E.; Al-Khalaifah, H.S.; Ismail, T.A.; El-Aziz, A.; Reda, M.; El-Mandrawy, S.A.; Shalaby, S.I.; Ibrahim, D. Performance, serum biochemical and immunological parameters, and digestive enzyme and intestinal barrier-related gene expression of broiler chickens fed fermented fava bean by-products as a substitute for conventional feed. Front. Vet. Sci. 2021, 8, 740. [Google Scholar] [CrossRef] [Scilit]
- Lee, Y.-J.; Kim, B.-K.; Lee, B.-H.; Jo, K.-I.; Lee, N.-K.; Chung, C.-H.; Lee, Y.-C.; Lee, J.-W. Purification and characterization of cellulase produced by Bacillus amyoliquefaciens DL-3 utilizing rice hull. Bioresour. Technol. 2008, 99, 378–386. [Google Scholar] [CrossRef] [Scilit]
- Alkushi, A.; Abdelfattah-Hassan, A.; Eldoumani, H.; Elazab, S.T.; Mohamed, S.A.; Metwally, A.S.; El-Shetry, E.S.; Saleh, A.A.; ElSawy, N.A.; Ibrahim, D. Probiotics-loaded nanoparticles attenuated colon inflammation, oxidative stress, and apoptosis in colitis. Sci. Rep. 2022, 12, 5116. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ulyanova, V.; Mahmud, R.S.; Dudkina, E.; Vershinina, V.; Domann, E.; Ilinskaya, O. Phylogenetic distribution of extracellular guanyl-preferring ribonucleases renews taxonomic status of two Bacillus strains. J. Gen. Appl. Microbiol. 2016, 62, 181–188. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tang, R.Y.; Wu, Z.L.; Wang, G.Z.; Liu, W.C. The effect of Bacillus amyloliquefaciens on productive performance of laying hens. Ital. J. Anim. Sci. 2018, 17, 436–441. [Google Scholar] [CrossRef] [Scilit]
- Lei, X.; Piao, X.; Ru, Y.; Zhang, H.; Péron, A.; Zhang, H. Effect of Bacillus amyloliquefaciens-based direct-fed microbial on performance, nutrient utilization, intestinal morphology and cecal microflora in broiler chickens. Asian-Australas. J. Anim. Sci. 2015, 28, 239. [Google Scholar] [CrossRef] [Scilit]
- Kalischuk, L.D.; Buret, A.G. A role for Campylobacter jejuni-induced enteritis in inflammatory bowel disease? Am. J. Physiol.-Gastrointest. Liver Physiol. 2010, 298, G1–G9. [Google Scholar] [CrossRef] [Scilit]
- Ibrahim, D.; Sewid, A.H.; Arisha, A.H.; Abd El-Fattah, A.H.; Abdelaziz, A.M.; Al-Jabr, O.A.; Kishawy, A.T. Influence of Glycyrrhiza glabra Extract on Growth, Gene Expression of Gut Integrity, and Campylobacter jejuni Colonization in Broiler Chickens. Front. Vet. Sci. 2020, 7, 612063. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hermans, D.; Pasmans, F.; Heyndrickx, M.; Van Immerseel, F.; Martel, A.; Van Deun, K.; Haesebrouck, F. A tolerogenic mucosal immune response leads to persistent Campylobacter jejuni colonization in the chicken gut. Crit. Rev. Microbiol. 2012, 38, 17–29. [Google Scholar] [CrossRef] [Scilit]
- Abd El-Hamid, M.I.; Abd El-Aziz, N.K.; Samir, M.; El-Naenaeey, E.-s.Y.; Abo Remela, E.M.; Mosbah, R.A.; Bendary, M.M. Genetic diversity of Campylobacter jejuni isolated from avian and human sources in Egypt. Front. Microbiol. 2019, 10, 2353. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fernandes, M.R.; Aggarwal, P.; Costa, R.G.; Cole, A.M.; Trinchieri, G. Targeting the gut microbiota for cancer therapy. Nat. Rev. Cancer 2022, 22, 703–722. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gharib-Naseri, K.; Dorigam, J.C.; Doranalli, K.; Morgan, N.; Swick, R.A.; Choct, M.; Wu, S.-B. Bacillus amyloliquefaciens CECT 5940 improves performance and gut function in broilers fed different levels of protein and/or under necrotic enteritis challenge. Anim. Nutr. 2021, 7, 185–197. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jampilek, J.; Kos, J.; Kralova, K. Potential of nanomaterial applications in dietary supplements and foods for special medical purposes. Nanomaterials 2019, 9, 296. [Google Scholar] [CrossRef] [Scilit]
- Zhou, J.; Li, M.; Chen, Q.; Li, X.; Chen, L.; Dong, Z.; Zhu, W.; Yang, Y.; Liu, Z.; Chen, Q. Programmable probiotics modulate inflammation and gut microbiota for inflammatory bowel disease treatment after effective oral delivery. Nat. Commun. 2022, 13, 3432. [Google Scholar] [CrossRef] [Scilit]
- Hegazy, W.A.; Salem, I.M.; Alotaibi, H.F.; Khafagy, E.-S.; Ibrahim, D. Terazosin Interferes with Quorum Sensing and Type Three Secretion System and Diminishes the Bacterial Espionage to Mitigate the Salmonella Typhimurium Pathogenesis. Antibiotics 2022, 11, 465. [Google Scholar] [CrossRef] [Scilit]
- Alandiyjany, M.N.; Abdelaziz, A.S.; Abdelfattah-Hassan, A.; Hegazy, W.A.; Hassan, A.A.; Elazab, S.T.; Mohamed, E.A.; El-Shetry, E.S.; Saleh, A.A.; ElSawy, N.A. Novel In Vivo Assessment of Antimicrobial Efficacy of Ciprofloxacin Loaded Mesoporous Silica Nanoparticles against Salmonella typhimurium Infection. Pharmaceuticals 2022, 15, 357. [Google Scholar] [CrossRef] [Scilit]
- Anselmo, A.C.; McHugh, K.J.; Webster, J.; Langer, R.; Jaklenec, A. Biomaterials: Layer-by-Layer Encapsulation of Probiotics for Delivery to the Microbiome (Adv. Mater. 43/2016). Adv. Mater. 2016, 28, 9442. [Google Scholar] [CrossRef] [Scilit]
- Ibrahim, D.; Arisha, A.H.; Khater, S.I.; Gad, W.M.; Hassan, Z.; Abou-Khadra, S.H.; Mohamed, D.I.; Ahmed Ismail, T.; Gad, S.A.; Eid, S.A. Impact of Omega-3 Fatty Acids Nano-Formulation on Growth, Antioxidant Potential, Fillet Quality, Immunity, Autophagy-Related Genes and Aeromonas hydrophila Resistance in Nile Tilapia (Oreochromis niloticus). Antioxidants 2022, 11, 1523. [Google Scholar] [CrossRef] [Scilit]
- Ibrahim, D.; Shahin, S.E.; Alqahtani, L.S.; Hassan, Z.; Althobaiti, F.; Albogami, S.; Soliman, M.M.; El-Malt, R.M.; Al-Harthi, H.F.; Alqadri, N. Exploring the Interactive Effects of Thymol and Thymoquinone: Moving towards an Enhanced Performance, Gross Margin, Immunity and Aeromonas sobria Resistance of Nile Tilapia (Oreochromis niloticus). Animals 2022, 12, 3034. [Google Scholar] [CrossRef] [Scilit]
- Lin, S.; Mukherjee, S.; Li, J.; Hou, W.; Pan, C.; Liu, J. Mucosal immunity–mediated modulation of the gut microbiome by oral delivery of probiotics into Peyer’s patches. Sci. Adv. 2021, 7, eabf0677. [Google Scholar] [CrossRef] [Scilit]
- Rawson, T.; Colles, F.M.; Terry, J.C.D.; Bonsall, M.B. Mechanisms of biodiversity between Campylobacter sequence types in a flock of broiler–breeder chickens. Ecol. Evol. 2022, 12, e8651. [Google Scholar] [CrossRef] [Scilit]
- Alkushi, A.G.; Elazab, S.T.; Abdelfattah-Hassan, A.; Mahfouz, H.; Salem, G.A.; Sheraiba, N.I.; Mohamed, E.A.; Attia, M.S.; El-Shetry, E.S.; Saleh, A.A. Multi-Strain-Probiotic-Loaded Nanoparticles Reduced Colon Inflammation and Orchestrated the Expressions of Tight Junction, NLRP3 Inflammasome and Caspase-1 Genes in DSS-Induced Colitis Model. Pharmaceutics 2022, 14, 1183. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Aviagen, W. Ross 308: Broiler’s management and nutrition specification. 2018.
- AOAC. Official Methods of Analysis of AOAC International, Association of Official Analytical Chemists; AOAC: Washington, DC, USA, 2012. [Google Scholar]
- Ibrahim, D.; El Sayed, R.; Abdelfattah-Hassan, A.; Morshedy, A. Creatine or guanidinoacetic acid? Which is more effective at enhancing growth, tissue creatine stores, quality of meat, and genes controlling growth/myogenesis in Mulard ducks. J. Appl. Anim. Res. 2019, 47, 159–166. [Google Scholar] [CrossRef] [Scilit]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kumar, A.; Kheravii, S.K.; Ionescu, C.; Blanchard, A.; Barekatain, R.; Bajagai, Y.S.; Wu, S.-B. A microencapsulated mixture of eugenol and garlic tincture supplementation mitigates the effect of necrotic enteritis on intestinal integrity and increases goblet cells in broilers. Microorganisms 2021, 9, 1451. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mirhosseini, S.Z.; Seidavi, A.; Shivazad, M.; Chamani, M.; Sadeghi, A.A.; Pourseify, R. Detection of Clostridium sp. and its relation to different ages and gastrointestinal segments as measured by molecular analysis of 16S rRNA genes. Braz. Arch. Biol. Technol. 2010, 53, 69–76. [Google Scholar] [CrossRef] [Scilit]
- Ammar, A.M.; El-Naenaeey, E.-S.Y.; El-Malt, R.; El-Gedawy, A.A.; Khalifa, E.; Elnahriry, S.S.; El-Hamid, A.; Marwa, I. Prevalence, antimicrobial susceptibility, virulence and genotyping of Campylobacter jejuni with a special reference to the anti-virulence potential of Eugenol and beta-resorcylic acid on some multi-drug resistant isolates in Egypt. Animals 2021, 11, 3. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ammar, A.M.; El-Naenaeey, E.-S.Y.; Abd El-Hamid, M.I.; El-Gedawy, A.A.; Elmalt, R.M. Campylobacter as a Major Foodborne Pathogen: A Review of Its Characteristics, Pathogenesis, Antimicrobial Resistance and Control. J. Microbiol. Biotechnol. Food Sci. 2021, 10, 609–619. [Google Scholar] [CrossRef] [Scilit]
- Lutful Kabir, S. The role of probiotics in the poultry industry. Int. J. Mol. Sci. 2009, 10, 3531–3546. [Google Scholar] [CrossRef] [Scilit]
- Bai, S.; Wu, A.; Ding, X.; Lei, Y.; Bai, J.; Zhang, K.; Chio, J. Effects of probiotic-supplemented diets on growth performance and intestinal immune characteristics of broiler chickens. Poult. Sci. 2013, 92, 663–670. [Google Scholar] [CrossRef] [Scilit]
- Bomba, A.; Nemcova, R.; Gancarcikova, S.; Herich, R.; Guba, P.; Mudronova, D. Improvement of the probiotic effect of micro-organisms by their combination with maltodextrins, fructo-oligosaccharides and polyunsaturated fatty acids. Br. J. Nutr. 2002, 88, S95–S99. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fávaro-Trindade, C.S.; Heinemann, R.J.B.; Pedroso, D.d.L. Developments in probiotic encapsulation. CABI Rev. 2011, 2021, 1–8. [Google Scholar] [CrossRef] [Scilit]
- Soro, A.B.; Whyte, P.; Bolton, D.J.; Tiwari, B.K. Strategies and novel technologies to control Campylobacter in the poultry chain: A review. Compr. Rev. Food Sci. Food Saf. 2020, 19, 1353–1377. [Google Scholar] [CrossRef] [Scilit]
- Bendary, M.M.; Abd El-Hamid, M.I.; El-Tarabili, R.M.; Hefny, A.A.; Algendy, R.M.; Elzohairy, N.A.; Ghoneim, M.M.; Al-Sanea, M.M.; Nahari, M.H.; Moustafa, W.H. Clostridium perfringens Associated with Foodborne Infections of Animal Origins: Insights into Prevalence, Antimicrobial Resistance, Toxin Genes Profiles, and Toxinotypes. Biology 2022, 11, 551. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ammar, A.M.; Abd El-Hamid, M.I.; Mohamed, Y.H.; Mohamed, H.M.; Al-Khalifah, D.H.; Hozzein, W.N.; Selim, S.; El-Neshwy, W.M.; El-Malt, R.M. Prevalence and antimicrobial susceptibility of bovine Mycoplasma species in Egypt. Biology 2022, 11, 1083. [Google Scholar] [CrossRef] [Scilit]
- Ammar, A.M.; El-Hamid, A.; Marwa, I.; El-Malt, R.; Azab, D.S.; Albogami, S.; Al-Sanea, M.M.; Soliman, W.E.; Ghoneim, M.M.; Bendary, M.M. Molecular detection of fluoroquinolone resistance among multidrug-, extensively drug-, and pan-drug-resistant Campylobacter species in Egypt. Antibiotics 2021, 10, 1342. [Google Scholar] [CrossRef] [Scilit]
- Emami, N.K.; Calik, A.; White, M.B.; Kimminau, E.A.; Dalloul, R.A. Effect of probiotics and multi-component feed additives on microbiota, gut barrier and immune responses in broiler chickens during subclinical necrotic enteritis. Front. Vet. Sci. 2020, 7, 572142. [Google Scholar] [CrossRef] [Scilit]
- Kabir, S.L. The dynamics of probiotics in enhancing poultry meat production and quality. Department of Microbiology and Hygiene, Faculty of Veterinary science, Bangladesh Agricultural University. Int. J. Poult. Sci. 2009, 3, 361–364. [Google Scholar]
- Rehman, A.; Arif, M.; Sajjad, N.; Al-Ghadi, M.; Alagawany, M.; Abd El-Hack, M.; Alhimaidi, A.; Elnesr, S.; Almutairi, B.; Amran, R. Dietary effect of probiotics and prebiotics on broiler performance, carcass, and immunity. Poult. Sci. 2020, 99, 6946–6953. [Google Scholar] [CrossRef] [Scilit]
- Khalili, A.; Tabeidian, S.A.; Toghyani, M.; Ghalamkari, G.; Bahrami, Y. Effect of different levels of brewer’s dried grains and enzyme on performance, protein digestibility, immune response and performance of broilers. Int. J. Acad. Res. 2011, 3, 1153–1157. [Google Scholar]
- Lin, P.; Shih, B.; Hsu, J. Effects of different sources of dietary non-starch polysaccharides on the growth performance, development of digestive tract and activities of pancreatic enzymes in goslings. Br. Poult. Sci. 2010, 51, 270–277. [Google Scholar] [CrossRef] [Scilit]
- Martin, A.M.; Sun, E.W.; Rogers, G.B.; Keating, D.J. The influence of the gut microbiome on host metabolism through the regulation of gut hormone release. Front. Physiol. 2019, 10, 428. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kheravii, S.K.; Swick, R.A.; Choct, M.; Wu, S.-B. Upregulation of genes encoding digestive enzymes and nutrient transporters in the digestive system of broiler chickens by dietary supplementation of fiber and inclusion of coarse particle size corn. BMC Genom. 2018, 19, 208. [Google Scholar] [CrossRef] [Scilit]
- Soumeh, E.; Mohebodini, H.; Toghyani, M.; Shabani, A.; Ashayerizadeh, A.; Jazi, V. Synergistic effects of fermented soybean meal and mannan-oligosaccharide on growth performance, digestive functions, and hepatic gene expression in broiler chickens. Poult. Sci. 2019, 98, 6797–6807. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hu, S.; Cao, X.; Wu, Y.; Mei, X.; Xu, H.; Wang, Y.; Zhang, X.; Gong, L.; Li, W. Effects of probiotic Bacillus as an alternative of antibiotics on digestive enzymes activity and intestinal integrity of piglets. Front. Microbiol. 2018, 9, 2427. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ahmad, R.; Yu, Y.-H.; Hsiao, F.S.-H.; Dybus, A.; Ali, I.; Hsu, H.-C.; Cheng, Y.-H. Probiotics as a Friendly Antibiotic Alternative: Assessment of Their Effects on the Health and Productive Performance of Poultry. Fermentation 2022, 8, 672. [Google Scholar] [CrossRef] [Scilit]
- Matur, E.; Ulker, C.; Arslan, M.; Elif, E.; Akyazi, I.; Evren, E. The effects of Enterococcus faecium NCIMB10415 on the development of pancreas and small intestine and on activity of pancreatic digestive enzymes in broiler chickens. Arch. Geflugelkd. 2007, 71, 162–168. [Google Scholar]
- Balta, I.; Butucel, E.; Stef, L.; Pet, I.; Gradisteanu-Pircalabioru, G.; Chifiriuc, C.; Gundogdu, O.; McCleery, D.; Corcionivoschi, N. Anti-Campylobacter probiotics: Latest mechanistic insights. Foodborne Pathog. Dis. 2022, 19, 693–703. [Google Scholar] [CrossRef] [Scilit]
- Bao, C.; Zhang, W.; Wang, J.; Liu, Y.; Cao, H.; Li, F.; Liu, S.; Shang, Z.; Cao, Y.; Dong, B. The Effects of Dietary Bacillus amyloliquefaciens TL106 Supplementation, as an Alternative to Antibiotics, on Growth Performance, Intestinal Immunity, Epithelial Barrier Integrity, and Intestinal Microbiota in Broilers. Animals 2022, 12, 3085. [Google Scholar] [CrossRef] [Scilit]
- Farhat-Khemakhem, A.; Blibech, M.; Boukhris, I.; Makni, M.; Chouayekh, H. Assessment of the potential of the multi-enzyme producer Bacillus amyloliquefaciens US573 as alternative feed additive. J. Sci. Food Agric. 2018, 98, 1208–1215. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhen, W.; Shao, Y.; Gong, X.; Wu, Y.; Geng, Y.; Wang, Z.; Guo, Y. Effect of dietary Bacillus coagulans supplementation on growth performance and immune responses of broiler chickens challenged by Salmonella enteritidis. Poult. Sci. 2018, 97, 2654–2666. [Google Scholar] [CrossRef] [Scilit]
- Sugiarto, H.; Yu, P.-L. Avian antimicrobial peptides: The defense role of β-defensins. Biochem. Biophys. Res. Commun. 2004, 323, 721–727. [Google Scholar] [CrossRef] [Scilit]
- Mohammed, E.S.; Igarashi, Y.; Isobe, N.; Yoshimura, Y. Effects of Probiotics on the Expression and Localization of Avian β-defensins in the Proventriculus of Broiler Chicks. J. Poult. Sci. 2015, 52, 57–67. [Google Scholar] [CrossRef] [Scilit]
- Rima, M.; Rima, M.; Fajloun, Z.; Sabatier, J.-M.; Bechinger, B.; Naas, T. Antimicrobial peptides: A potent alternative to antibiotics. Antibiotics 2021, 10, 1095. [Google Scholar] [CrossRef] [Scilit]
- Linden, S.; Sutton, P.; Karlsson, N.; Korolik, V.; McGuckin, M. Mucins in the mucosal barrier to infection. Mucosal Immunol. 2008, 1, 183–197. [Google Scholar] [CrossRef] [Scilit]
- Abd El-Hamid, M.I.; Ibrahim, D.; Hamed, R.I.; Nossieur, H.H.; Elbanna, M.H.; Baz, H.; Abd-Allah, E.M.; El Oksh, A.S.; Ibrahim, G.A.; Khalifa, E. Modulatory impacts of multi-strain probiotics on rabbits’ growth, nutrient transporters, tight junctions and immune system to fight against Listeria monocytogenes infection. Animals 2022, 12, 2082. [Google Scholar] [CrossRef] [Scilit]
- de LeBlanc, A.d.M.; Dogi, C.A.; Galdeano, C.M.; Carmuega, E.; Weill, R.; Perdigón, G. Effect of the administration of a fermented milk containing Lactobacillus casei DN-114001 on intestinal microbiota and gut associated immune cells of nursing mice and after weaning until immune maturity. BMC Immunol. 2008, 9, 27. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Aliakbarpour, H.; Chamani, M.; Rahimi, G.; Sadeghi, A.; Qujeq, D. The Bacillus subtilis and lactic acid bacteria probiotics influences intestinal mucin gene expression, histomorphology and growth performance in broilers. Asian-Australas. J. Anim. Sci. 2012, 25, 1285. [Google Scholar] [CrossRef] [Scilit]
- Chen, J.; Tellez, G.; Richards, J.D.; Escobar, J. Identification of potential biomarkers for gut barrier failure in broiler chickens. Front. Vet. Sci. 2015, 2, 14. [Google Scholar] [CrossRef] [Scilit]
- Hashem, Y.M.; Abd El-Hamid, M.I.; Awad, N.F.; Ibrahim, D.; Elshater, N.S.; El-Malt, R.M.; Hassan, W.H.; Abo-Shama, U.H.; Nassan, M.A.; El-Bahy, S.M. Insights into growth-promoting, anti-inflammatory, immunostimulant, and antibacterial activities of Toldin CRD as a novel phytobiotic in broiler chickens experimentally infected with Mycoplasma gallisepticum. Poult. Sci. 2022, 101, 102154. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Awad, N.F.; Abd El-Hamid, M.I.; Hashem, Y.; Erfan, A.; Abdelrahman, B.; Mahmoud, H.I. Impact of single and mixed infections with Escherichia coli and Mycoplasma gallisepticum on Newcastle disease virus vaccine performance in broiler chickens: An in vivo perspective. J. Appl. Microbiol. 2019, 127, 396–405. [Google Scholar] [CrossRef] [Scilit] [PubMed]





| Item | Starter (Days 1–10) | Grower (Days 11–20) | Finisher (Days 21–35) |
|---|---|---|---|
| Ingredient (%) Soybean meal (48) | 34.4 | 30.8 | 25.8 |
| Ground yellow corn | 59 | 61.5 | 65.5 |
| Soybean oil | 1.8 | 3 | 4 |
| Calcium carbonate | 1.2 | 1.2 | 1.2 |
| Dicalcium phosphate | 1.5 | 1.5 | 1.5 |
| Common salt | 0.3 | 0.3 | 0.3 |
| Choline chloride | 0.2 | 0.2 | 0.2 |
| Anti-mycotoxin | 0.1 | 0.1 | 0.1 |
| L-Lysine HCL (Lysin, 78%) | 0.35 | 0.3 | 0.3 |
| DL-Methionine (Methionine, 99%) | 0.25 | 0.2 | 0.2 |
| Premix * | 0.3 | 0.3 | 0.3 |
| Chemical composition | |||
| Lysine (%) | 1.5 | 1.3 | 1.2 |
| Methionine (%) | 0.6 | 0.5 | 0.5 |
| Available phosphorus (%) | 0.5 | 0.5 | 0.5 |
| Calcium (%) | 1.2 | 1.2 | 1.2 |
| Ether extract (%) | 4.3 | 5.6 | 6.6 |
| Crude fiber (%) | 2.6 | 2.6 | 2.5 |
| Crude protein (%) | 23 | 21.5 | 19.5 |
| Metabolizable energy (kcal/kg) | 3106 | 3103 | 3200 |
| Specificity/Target Gene | Primer Sequence (5′–3′) | Accession No./ Reference |
|---|---|---|
| Digestive enzymes | ||
| AMY2A | F: CGGAGTGGATGTTAACGACTGG R: ATGTTCGCAGACCCAGTCATTG | NM_001001473.2 |
| CELA1 | F-AGCGTAAGGAAATGGGGTGG R-GTGGAGACCCCATGCAAGTC | XM_015300368.1 |
| CCK | F: AGGTTCCACTGGGAGGTTCT R: CGCCTGCTGTTCTTTAGGAG | XM_015281332.1 |
| PNLIP | F: GCATCTGGGAAG↓GAACTAGGG R: TGAACCACAAGCATAGCCCA | NM_001277382.1 |
| Intestinal microbiota/16S rRNA | ||
| Lactobacillus species | F: CACCGCTACACATGGAG R: AGCAGTAGGGAATCTTCCA | [49] |
| Bifidobacterium species | F-GCGTCCGCTGTGGGC R-CTTCTCCGGCATGGTGTTG | [49] |
| Enterobacteriaceae | F: CATTGACGTTACCCGCAGAAGAAGC R: CTCTACGAGACTCAAGCTTGC | [49] |
| Clostridium species | F: AAAGGAAGATTAATACCGCATAA R: ATCTTGCGACCGTACTCCCC | [50] |
| Barrier functions and antimicrobial defense | ||
| MUC-2 | F-AAACAACGGCCATGTTTCAT R-GTGTGACACTGGTGTGCTGA | NM_001318434 |
| FABP-2 | F: AGGCTCTTGGAACCTGGAAG R: CTTGGCTTCAACTCCTTCGT | NM_001007923 |
| DEFB1 | F: AGCCTGTCTGCCTGGAGTAG R: GATGAGGAGAGGCTTCATGG | XM017337690.1 |
| Proinflammatory cytokines | ||
| IL-1β | F: GCTCTACATGTCGTGTGTGATGAG R: TGTCGATGTCCCGCATGA | NM_204524 |
| TNF-α | F: CGTTTGGGAGTGGGCTTTAA R: GCTGATGGCAGAGGCAGAA | NM_204267.1 |
| Campylobacter jejuni | ||
| mapA | F: CTATTTTATTTTTGAGTGCTTGTG R: GCTTTATTTGCCATTTGTTTTATTA | [4] |
| Internal control | ||
| GAPDH | F: GGTGGTGCTAAGCGTGTTA R: CCCTCCACAATGCCAA | X01578.1 |
| Parameter | Control | BNPs I | BNPs II | BNPs III | p Value | SEM |
|---|---|---|---|---|---|---|
| Initial body weight (g/bird) | 42.00 | 41.40 | 42.60 | 42.60 | 0.99 | 0.71 |
| Overall growth | ||||||
| Final body weight, g/bird | 2339 c | 2471 b | 2542 a | 2612 a | <0.001 | 21.54 |
| Body weight gain, g/bird | 2297 c | 2430 b | 2499 a | 2569 a | <0.001 | 18.63 |
| Feed intake, g/bird | 4163 a | 3925 b | 3740 c | 3800 bc | <0.001 | 29.78 |
| Feed conversion ratio | 1.82 a | 1.61 b | 1.50 bc | 1.48 c | <0.001 | 0.05 |
| Mortality % (1–35 d) | 3 a | 2 ab | 1 b | 1 b | 0.025 | 0.37 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ismail, H.; Ibrahim, D.; El Sayed, S.; Wahdan, A.; El-Tarabili, R.M.; Rizk El-Ghareeb, W.; Abdullah Alhawas, B.; Alahmad, B.A.-H.Y.; Abdel-Raheem, S.M.; El-Hamid, M.I.A. Prospective Application of Nanoencapsulated Bacillus amyloliquefaciens on Broiler Chickens’ Performance and Gut Health with Efficacy against Campylobacter jejuni Colonization. Animals 2023, 13, 775. https://doi.org/10.3390/ani13050775
Ismail H, Ibrahim D, El Sayed S, Wahdan A, El-Tarabili RM, Rizk El-Ghareeb W, Abdullah Alhawas B, Alahmad BA-HY, Abdel-Raheem SM, El-Hamid MIA. Prospective Application of Nanoencapsulated Bacillus amyloliquefaciens on Broiler Chickens’ Performance and Gut Health with Efficacy against Campylobacter jejuni Colonization. Animals. 2023; 13(5):775. https://doi.org/10.3390/ani13050775
Chicago/Turabian StyleIsmail, Hesham, Doaa Ibrahim, Shorouk El Sayed, Ali Wahdan, Reham M. El-Tarabili, Waleed Rizk El-Ghareeb, Bassam Abdullah Alhawas, Badr Abdul-Hakim Y. Alahmad, Sherief M. Abdel-Raheem, and Marwa I. Abd El-Hamid. 2023. "Prospective Application of Nanoencapsulated Bacillus amyloliquefaciens on Broiler Chickens’ Performance and Gut Health with Efficacy against Campylobacter jejuni Colonization" Animals 13, no. 5: 775. https://doi.org/10.3390/ani13050775
APA StyleIsmail, H., Ibrahim, D., El Sayed, S., Wahdan, A., El-Tarabili, R. M., Rizk El-Ghareeb, W., Abdullah Alhawas, B., Alahmad, B. A.-H. Y., Abdel-Raheem, S. M., & El-Hamid, M. I. A. (2023). Prospective Application of Nanoencapsulated Bacillus amyloliquefaciens on Broiler Chickens’ Performance and Gut Health with Efficacy against Campylobacter jejuni Colonization. Animals, 13(5), 775. https://doi.org/10.3390/ani13050775

