RPA-CRISPR/Cas12a-Based Detection of Haemophilus parasuis
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Bacterial Strain and Growth Conditions
2.2. Bacterial Genome Extraction
2.3. Primer Design and RPA Reactions
2.4. crRNA and ssDNA Reporter Design
2.5. Optimized Cas12a Detection Reactions
2.6. Specificity Test
2.7. Sensitivity Test
2.8. Applications of RPA-CRISPR/Cas12a System
3. Results
3.1. Primer and crRNA Screening
3.2. Optimization Results of the Reaction System
3.3. Results of the Specificity Test
3.4. Results of the Sensitivity Test
3.5. Results of the Application of the RPA-CRISPR/Cas12a Assay System
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Dickerman, A.; Bandara, A.B.; Inzana, T.J. Phylogenomic analysis of Haemophilus parasuis and proposed reclassification to Glaesserella parasuis, gen. nov., comb. nov. Int. J. Syst. Evol. Microbiol. 2020, 70, 180–186. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, H.; Xue, Q.; Zeng, Q.; Zhao, Z. Haemophilus parasuis vaccines. Vet. Immunol. Immunopathol. 2016, 180, 53–58. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jiang, C.; Ren, J.; Zhang, X.; Li, C.; Hu, Y.; Cao, H.; Zeng, W.; Li, Z.; He, Q. Deletion of the crp gene affects the virulence and the activation of the NF-kappaB and MAPK signaling pathways in PK-15 and iPAM cells derived from G. parasuis serovar 5. Vet. Microbiol. 2021, 261, 109198. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jin, H.; Zhou, R.; Kang, M.; Luo, R.; Cai, X.; Chen, H. Biofilm formation by field isolates and reference strains of Haemophilus parasuis. Vet. Microbiol. 2006, 118, 117–123. [Google Scholar] [CrossRef] [Scilit]
- Cai, X.; Chen, H.; Blackall, P.; Yin, Z.; Wang, L.; Liu, Z.; Jin, M. Serological characterization of Haemophilus parasuis isolates from China. Vet. Microbiol. 2005, 111, 231–236. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Daher, R.K.; Stewart, G.; Boissinot, M.; Bergeron, M.G. Recombinase Polymerase Amplification for Diagnostic Applications. Clin. Chem. 2016, 62, 947–958. [Google Scholar] [CrossRef] [Scilit]
- James, A.; Macdonald, J. Recombinase polymerase amplification: Emergence as a critical molecular technology for rapid, low-resource diagnostics. Expert Rev. Mol. Diagn. 2015, 15, 1475–1489. [Google Scholar] [CrossRef] [Scilit]
- Lobato, I.M.; O’Sullivan, C.K. Recombinase polymerase amplification: Basics, applications and recent advances. Trends Anal. Chem. 2018, 98, 19–35. [Google Scholar] [CrossRef] [Scilit]
- Tan, M.; Liao, C.; Liang, L.; Yi, X.; Zhou, Z.; Wei, G. Recent advances in recombinase polymerase amplification: Principle, advantages, disadvantages and applications. Front. Cell. Infect. Microbiol. 2022, 12, 1019071. [Google Scholar] [CrossRef] [Scilit]
- Zhai, Y.; Ma, P.; Fu, X.; Zhang, L.; Cui, P.; Li, H.; Yan, W.; Wang, H.; Yang, X. A recombinase polymerase amplification combined with lateral flow dipstick for rapid and specific detection of African swine fever virus. J. Virol. Methods 2020, 285, 113885. [Google Scholar] [CrossRef] [Scilit]
- James, H.E.; Ebert, K.; McGonigle, R.; Reid, S.M.; Boonham, N.; Tomlinson, J.A.; Hutchings, G.H.; Denyer, M.; Oura, C.A.; Dukes, J.P.; et al. Detection of African swine fever virus by loop-mediated isothermal amplification. J. Virol. Methods 2010, 164, 68–74. [Google Scholar] [CrossRef] [Scilit]
- Koonin, E.V.; Makarova, K.S. CRISPR-Cas: Evolution of an RNA-based adaptive immunity system in prokaryotes. RNA Biol. 2013, 10, 679–686. [Google Scholar] [CrossRef] [Scilit]
- Makarova, K.S.; Aravind, L.; Wolf, Y.I.; Koonin, E.V. Unification of Cas protein families and a simple scenario for the origin and evolution of CRISPR-Cas systems. Biol. Direct 2011, 6, 38. [Google Scholar] [CrossRef] [Scilit]
- Gootenberg, J.S.; Abudayyeh, O.O.; Kellner, M.J.; Joung, J.; Collins, J.J.; Zhang, F. Multiplexed and portable nucleic acid detection platform with Cas13, Cas12a, and Csm6. Science 2018, 360, 439–444. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, J.S.; Ma, E.; Harrington, L.B.; Da Costa, M.; Tian, X.; Palefsky, J.M.; Doudna, J.A. CRISPR-Cas12a target binding unleashes indiscriminate single-stranded DNase activity. Science 2018, 360, 436–439. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Swarts, D.C.; Jinek, M. Mechanistic Insights into the cis- and trans-Acting DNase Activities of Cas12a. Mol. Cell 2019, 73, 589–600.e4. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Swarts, D.C. Making the cut(s): How Cas12a cleaves target and non-target DNA. Biochem. Soc. Trans. 2019, 47, 1499–1510. [Google Scholar] [CrossRef] [Scilit]
- Zhang, A.; Sun, B.; Zhang, J.; Cheng, C.; Zhou, J.; Niu, F.; Luo, Z.; Yu, L.; Yu, C.; Dai, Y.; et al. CRISPR/Cas12a Coupled with Recombinase Polymerase Amplification for Sensitive and Specific Detection of Aphelenchoides besseyi. Front. Bioeng. Biotechnol. 2022, 10, 912959. [Google Scholar] [CrossRef] [Scilit]
- Broughton, J.P.; Deng, X.; Yu, G.; Fasching, C.L.; Servellita, V.; Singh, J.; Miao, X.; Streithorst, J.A.; Granados, A.; Sotomayor-Gonzalez, A.; et al. CRISPR-Cas12-based detection of SARS-CoV-2. Nat. Biotechnol. 2020, 38, 870–874. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yu, F.; Zhang, K.; Wang, Y.; Li, D.; Cui, Z.; Huang, J.; Zhang, S.; Li, X.; Zhang, L. CRISPR/Cas12a-based on-site diagnostics of Cryptosporidium parvum IId-subtype-family from human and cattle fecal samples. Parasites Vectors 2021, 14, 208. [Google Scholar] [CrossRef] [Scilit]
- Moller, K.; Fussing, V.; Grimont, P.A.D.; Paster, B.J.; Dewhirst, F.E.; Kilian, M. Actinobacillus minor sp. nov., Actinobacillus porcinus sp. nov., and Actinobacillus indolicus sp. nov., Three New V Factor-Dependent Species from the Respiratory Tract of Pigs. Int. J. Syst. Bacteriol. 1996, 46, 951–956. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pilchová, V.; Seinige, D.; Hennig-Pauka, I.; Büttner, K.; Abdulmawjood, A.; Kehrenberg, C. Development and Validation of a Loop-Mediated Isothermal Amplification (LAMP) Assay for Rapid Detection of Glaesserella (Haemophilus) parasuis. Microorganisms 2020, 9, 41. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, Y.; Du, Y.; Song, Y.; Tian, Y.; Qi, Y.; Zhang, Q.; He, Q.; Wang, X.; Chen, H.; Cai, X.; et al. Development and application of an antibody detection ELISA for Haemophilus parasuis based on a monomeric autotransporter passenger domain. BMC Vet. Res. 2019, 15, 436. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sunaga, F.; Tsuchiaka, S.; Kishimoto, M.; Aoki, H.; Kakinoki, M.; Kure, K.; Okumura, H.; Okumura, M.; Okumura, A.; Nagai, M.; et al. Development of a one-run real-time PCR detection system for pathogens associated with porcine respiratory diseases. J. Vet. Med. Sci. 2020, 82, 217–223. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fan, X.; Han, F.; Zhao, B.; Xu, Y.; Zhao, X.; Pu, X.; Du, Y.; Zhang, Q.; Zhang, X.; Zhang, W.; et al. Rapid, visual, and equipment-free point-of-care testing for Staphylococcus aureus by direct recombinase polymerase amplification with SYBR Green Iota. Acta Biochim. Biophys. Sin. 2021, 53, 1250–1253. [Google Scholar] [CrossRef] [Scilit]
- Li, S.; Wang, X.; Yu, Y.; Cao, S.; Liu, J.; Zhao, P.; Li, J.; Zhang, X.; Li, X.; Zhang, N.; et al. Establishment and application of a CRISPR-Cas12a-based RPA-LFS and fluorescence for the detection of Trichomonas vaginalis. Parasit Vectors 2022, 15, 350. [Google Scholar] [CrossRef] [Scilit]
- Sun, Y.; Yu, L.; Liu, C.; Ye, S.; Chen, W.; Li, D.; Huang, W. One-tube SARS-CoV-2 detection platform based on RT-RPA and CRISPR/Cas12a. J. Transl. Med. 2021, 19, 74. [Google Scholar] [CrossRef] [Scilit]
- Fu, J.; Zhang, Y.; Cai, G.; Meng, G.; Shi, S. Rapid and sensitive RPA-Cas12a-fluorescence assay for point-of-care detection of African swine fever virus. PLoS ONE 2021, 16, e0254815. [Google Scholar] [CrossRef] [Scilit]
- Tang, Y.; Gao, L.; Feng, W.; Guo, C.; Yang, Q.; Li, F.; Le, X.C. The CRISPR–Cas toolbox for analytical and diagnostic assay development. Chem. Soc. Rev. 2021, 50, 11844–11869. [Google Scholar] [CrossRef] [Scilit]
- Kadam, U.S.; Cho, Y.; Park, T.Y.; Hong, J.C. Aptamer-based CRISPR-Cas powered diagnostics of diverse biomarkers and small molecule targets. Appl. Biol. Chem. 2023, 66, 13. [Google Scholar] [CrossRef] [Scilit]
- Bhattacharjee, G.; Gohil, N.; Lam, N.L.; Singh, V. CRISPR-based diagnostics for detection of pathogens. Prog. Mol. Biol. Transl. Sci. 2021, 181, 45–57. [Google Scholar] [PubMed]






| Primer Name | Sequences 5′-3′ | Note |
|---|---|---|
| F1 | AATCTGTAACTGTGGCAGCAGGTTATACTCA | Selected primer pairs |
| R1 | AGTACCATAAGAGTAGTTTCCATACACGCCA | |
| F2 | GGTGTATACTTTGGTCTTAAATATGTCAACG | |
| F3 | TAAGAAAGACAAAGATGGTGTATACTTTGGT | |
| R3 | TGTCTTTGTTCTTGATTAAACGACCTTCAA | |
| F4 | GTAGCTGTTGATGGTGGTCATGGTGTTGTAAA | |
| R4 | CACCTAACATGAATTGATGAGCTGTTGCTT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, K.; Sun, Z.; Shi, K.; Yang, D.; Bian, Z.; Li, Y.; Gou, H.; Jiang, Z.; Yang, N.; Chu, P.; et al. RPA-CRISPR/Cas12a-Based Detection of Haemophilus parasuis. Animals 2023, 13, 3317. https://doi.org/10.3390/ani13213317
Zhang K, Sun Z, Shi K, Yang D, Bian Z, Li Y, Gou H, Jiang Z, Yang N, Chu P, et al. RPA-CRISPR/Cas12a-Based Detection of Haemophilus parasuis. Animals. 2023; 13(21):3317. https://doi.org/10.3390/ani13213317
Chicago/Turabian StyleZhang, Kunli, Zeyi Sun, Keda Shi, Dongxia Yang, Zhibiao Bian, Yan Li, Hongchao Gou, Zhiyong Jiang, Nanling Yang, Pinpin Chu, and et al. 2023. "RPA-CRISPR/Cas12a-Based Detection of Haemophilus parasuis" Animals 13, no. 21: 3317. https://doi.org/10.3390/ani13213317
APA StyleZhang, K., Sun, Z., Shi, K., Yang, D., Bian, Z., Li, Y., Gou, H., Jiang, Z., Yang, N., Chu, P., Zhai, S., Wei, Z., & Li, C. (2023). RPA-CRISPR/Cas12a-Based Detection of Haemophilus parasuis. Animals, 13(21), 3317. https://doi.org/10.3390/ani13213317

