Eriocheir sinensis feminization-1c (Fem-1c) and Its Predicted miRNAs Involved in Sexual Development and Regulation
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Collection of Animals and Samples
2.2. DNA, RNA, and miRNAs Preparation and cDNA Template Synthesis
2.3. Cloning and Analysis of Fem-1c 3′UTR Sequence from Eriocheir Sinensis
2.4. Synthesis of dsRNA for Silencing EsFem-1c Gene by RNA Interference In Vivo
2.5. Target-Silencing EsFem-1c Gene in Juvenile and Mature Crabs
2.6. The Morphological Observation of Juvenile Crab
2.7. Small RNA Libraries Construction and Sequencing
2.8. Bioinformatics Analysis of Sequencing Reads
2.9. Quantitative Real-Time PCR
2.10. Identification and Analysis of miRNAs Targeting EsFem-1c Gene
2.11. Luciferase 3′UTR Reporter Assay
2.12. Statistical Analysis
3. Results
3.1. The Bioinformatics Analysis of EsFem-1c mRNA Sequence
3.2. Expression Patterns Analysis of the EsFem-1c in Various Tissues of the Normal and Intersex Crabs
3.3. The Expression Profiles of Sex Genes and Sexual Characteristics Change after Targeted-Silencing EsFem-1c in E. sinensis
3.4. The Expression of EsFem-1c in the Reproduction Tissues
3.5. Overview of Small RNAs Sequencing in the Reproduction System of E. sinensis
3.6. The Interaction between the Identified miRNAs and EsFem-1c Gene by Dual-Luciferase Reporter Assay
3.7. The Analysis of the Alternative Splicing Region in 3′UTR of EsFem-1c
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Starostina, N.G.; Lim, J.M.; Schvarzstein, M.; Wells, L.; Spence, A.M.; Kipreos, E.T. A CUL-2 ubiquitin ligase containing three FEM proteins degrades TRA-1 to regulate C. elegans sex determination. Dev. Cell. 2007, 13, 127–139. [Google Scholar] [CrossRef] [Scilit]
- Wang, Y.; Wu, C.; Guo, P.; Wang, G.; Li, J. Molecular characterization and expression of the feminization-1c (fem-1c) in the freshwater mussel (Hyriopsis cumingii). Aquac. Fish. 2018, 3, 6–13. [Google Scholar] [CrossRef] [Scilit]
- Zanetti, S.; Puoti, A. Sex Determination in the Caenorhabditis elegans Germline. In Germ Cell Development in C. elegans; Advances in Experimental Medicine and Biology; Springer: New York, NY, USA, 2013; pp. 41–69. [Google Scholar] [CrossRef] [Scilit]
- Chen, X.; Liao, S.; Makaros, Y.; Guo, Q.; Zhu, Z.; Krizelman, R.; Dahan, K.; Tu, X.; Yao, X.; Koren, I.; et al. Molecular basis for arginine C-terminal degron recognition by Cul2(FEM1) E3 ligase. Nat. Chem. Biol. 2021, 17, 254–262. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kimble, J.; Edgar, L.; Hirsh, D. Specification of male development in Caenorhabditis elegans the fem genes. Dev. Biol. 1984, 105, 234–239. [Google Scholar] [CrossRef] [Scilit]
- Doniach, T.; Hodgkin, J. A sex-determining gene, fem-1, required for both male and hermaphrodite development in Caenorhabditis elegans. Dev. Biol. 1984, 106, 223–235. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Thies, M.; Berke, B. A role for the Fem-1 gene of Drosophila melanogaster in adult courtship. bioRxiv 2020, 19, 911693. [Google Scholar] [CrossRef] [Scilit]
- Ventura-Holman, T.; Lu, D.; Si, X.; Izevbigie, E.B.; Maher, J.F. The Fem1c genes: Conserved members of the Fem1 gene family in vertebrates. Gene 2003, 314, 133–139. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hong, S.; You-Jin, H.; Bin, C.; Feng-Ling, S.; Peng, W.; Zheng-Bo, H. Cloning and expression analysis of fem-1 genes from the oriental migratory locust, Locusta migratoria manilensis (Orthoptera: Locustidae). Acta Entomol. Sin. 2013, 56, 729–737. [Google Scholar] [CrossRef]
- Shi, J.-T.; Li, Z.; Gui, J.-F.; Zhou, L. The cloning and expression analysis of zebrafish Fem-1c, a member of Fem-1 family. Ata Hydrobiol. Sin. 2015, 39, 459–467. [Google Scholar] [CrossRef]
- Du, H.-N.; Hu, H.-Y. Ankyrin Repeat Mediated Protein-protein Interaction. Prog. Biochem. Biophys. 2002, 29, 6–9. [Google Scholar] [CrossRef]
- Rahman, N.M.; Fu, H.; Qiao, H.; Jin, S.; Bai, H.; Zhang, W.; Jiang, F.W.; Liang, G.; Sun, S.; Gong, Y.; et al. Molecular cloning and expression analysis of Fem1b from oriental river prawn Macrobrachium nipponense. Genet. Mol. Res. 2016, 15, 12–15. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ma, K.-Y.; Liu, Z.-Q.; Lin, J.-Y.; Li, J.-L.; Qiu, G.-F. Molecular characterization of a novel ovary-specific gene fem-1 homolog from the oriental river prawn, Macrobrachium nipponense. Gene 2016, 575, 244–252. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhou, L.-X.; Liu, X.; Ye, B.-Q.; Liu, Y.; Tan, S.-P.; Ma, K.-Y.; Qiu, G.-F. Molecular characterization of ovary-specific gene Mrfem-1 and siRNA-mediated regulation on targeting Mrfem-1 in the giant freshwater prawn, Macrobrachium rosenbergii. Gene 2020, 754, 144891. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Song, C.; Cui, Z.; Hui, M.; Liu, Y.; Li, Y. Molecular characterization and expression profile of three Fem-1 genes in Eriocheir sinensis provide a new insight into crab sex-determining mechanism. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 2015, 189, 6–14. [Google Scholar] [CrossRef] [Scilit]
- Mayr, C. Regulation by 3′-Untranslated Regions. Annu. Rev. Genet. 2017, 51, 171–194. [Google Scholar] [CrossRef] [Scilit]
- Schneider, A.B.; Wolfinger, M.T. Musashi binding elements in Zika and related Flavivirus 3′UTRs: A comparative study in silico. Sci. Rep. 2019, 9, 6911. [Google Scholar] [CrossRef] [Scilit]
- Lai, E.C.; Burks, C.; Posakony, J.W. The K box, a conserved 3′ UTR sequence motif, negatively regulates accumulation of enhancer of split complex transcripts. Development 1998, 125, 4077–4088. [Google Scholar] [CrossRef] [Scilit]
- Bae, B.; Miura, P. Emerging Roles for 3′ UTRs in Neurons. Int. J. Mol. Sci. 2020, 21, 3413. [Google Scholar] [CrossRef] [Scilit]
- Frederick, P.M.; Simard, M.J. Regulation and different functions of the animal microRNA-induced silencing complex. Wiley Interdiscip. Rev. RNA 2022, 13, e1701. [Google Scholar] [CrossRef] [Scilit]
- Mayr, C. What Are 3′ UTRs Doing? Cold Spring Harb. Perspect. Biol. 2019, 11, a034728. [Google Scholar] [CrossRef] [Scilit]
- Sadek, J.; Omer, A.; Hall, D.; Ashour, K.; Gallouzi, I.E. Alternative polyadenylation and the stress response. Wiley Interdiscip. Rev. RNA 2019, 10, e1540. [Google Scholar] [CrossRef] [Scilit]
- Garaulet, D.L.; Zhang, B.; Wei, L.; Li, E.; Lai, E.C. miRNAs and Neural Alternative Polyadenylation Specify the Virgin Behavioral State. Dev. Cell. 2020, 54, 410–423. [Google Scholar] [CrossRef] [Scilit]
- Ren, F.; Zhang, N.; Zhang, L.; Miller, E.; Pu, J.J. Alternative Polyadenylation: A new frontier in post transcriptional regulation. Biomark. Res. 2020, 8, 67. [Google Scholar] [CrossRef] [Scilit]
- Faghihi, M.A.; Wahlestedt, C. Regulatory roles of natural antisense transcripts. Nat. Rev. Mol. Cell. Biol. 2009, 10, 637–643. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Galindo-Torres, P.; Ventura-Lopez, C.; Llera-Herrera, R.; Ibarra, A.M. A natural antisense transcript of the fem-1 gene was found expressed in female gonads during the characterization, expression profile, and cellular localization of the fem-1 gene in Pacific white shrimp Penaeus vannamei. Gene 2019, 706, 19–31. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Song, Y.-N.; Shi, L.-L.; Liu, Z.-Q.; Qiu, G.-F. Global analysis of the ovarian microRNA transcriptome: Implication for miR-2 and miR-133 regulation of oocyte meiosis in the Chinese mitten crab, Eriocheir sinensis (Crustacea: Decapoda). BMC Genom. 2014, 15, 547. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Luo, L.; Tang, Y.; Sun, L.; Li, S.; Liu, H.; Chen, Z.; Li, G. SAP30 targeted by miR-133b was involved in the process of nuclear decondensation in Chinese mitten crab (Eriocheir sinensis) sperm. Aquac. Rep. 2023, 29, 101540. [Google Scholar] [CrossRef] [Scilit]
- Huang, Y.; Wang, W.; Xu, Z.; Pan, J.; Zhao, Z.; Ren, Q. Eriocheir Sinensis microRNA-7 targets crab Myd88 to enhance white spot syndrome virus replication. Fish Shellfish Immunol. 2018, 79, 274–283. [Google Scholar] [CrossRef] [Scilit]
- He, L.; Wang, Y.-L.; Li, Q.; Yang, H.-D.; Duan, Z.-L.; Wang, Q. Profiling microRNAs in the testis during sexual maturation stages in Eriocheir sinensis. Anim. Reprod. Sci. 2015, 162, 52–61. [Google Scholar] [CrossRef] [Scilit]
- Chen, M.; Yue, Y.; He, J.; Li, P.; Yan, J.; Wang, F.; Cai, F.; Zhou, K. Screening and identification of microRNAs during larval metamorphic development of Chinese mitten crab Eriocheir sinensis. Aquac. Res. 2020, 51, 2322–2335. [Google Scholar] [CrossRef] [Scilit]
- Luo, B.-Y.; Xiong, X.-Y.; Liu, X.; He, X.Y.; Qiu, G.-F. Identification and characterization of sex-biased and differentially expressed miRNAs in gonadal developments of the Chinese mitten crab, Eriocheir sinensis. Mol. Reprod. Dev. 2021, 88, 217–227. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gu, Z.; He, L. Histological and cytological observation on the development cycle of crab (Eriocheir sinensis) ovary. Oceanol. Et Limnol. Sin. 1997, 28, 138–145. [Google Scholar] [CrossRef]
- Wang, Y.L.; Sun, W.J.; He, L.; Li, Q.; Wang, Q. Morphological alterations of all stages of spermatogenesis and acrosome reaction in Chinese mitten crab Eriocheir sinensis. Cell Tissue Res. 2015, 360, 401–412. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Qiu, G.; Wu, P.; Yundong, L. Structure and function of the androgenic gland in Eriocheir sinensis. J. Fish. China 2000, 24, 99–104. [Google Scholar] [CrossRef]
- Ye, J.; Coulouris, G.; Zaretskaya, I.; Cutcutache, I.; Rozen, S.; Madden, T.L. Primer-BLAST A tool to design target-specific. BMC Bioinform. 2012, 13, 134. [Google Scholar] [CrossRef] [Scilit]
- Alzohairy, A.M. BioEdit: An important software for molecular biology. GERF Bull. Biosci. 2011, 2, 60–61. [Google Scholar] [CrossRef] [Scilit]
- Yalamanchili, H.K.; Alcott, C.E.; Ji, P.; Wagner, E.J.; Zoghbi, H.Y.; Liu, Z. PolyA-miner: Accurate assessment of differential alternative poly-adenylation from 3′ Seq data using vector projections and non-negative matrix factorization. Nucleic Acids Res. 2020, 48, e69. [Google Scholar] [CrossRef] [Scilit]
- Grillo, G.; Turi, A.; Licciulli, F.; Mignone, F.; Liuni, S.; Banfi, S.; Gennarino, V.A.; Horner, D.S.; Pavesi, G.; Picardi, E. UTRdb and UTRsite (RELEASE 2010): A collection of sequences and regulatory motifs of the untranslated regions of eukaryotic mRNAs. Nucleic Acids Res. 2010, 38, D75–D80. [Google Scholar] [CrossRef] [Scilit]
- Zhu, D.; Feng, T.; Mo, N.; Han, R.; Lu, W.; Shao, S.; Cui, Z. New insights for the regulatory feedback loop between type 1 crustacean female sex hormone (CFSH-1) and insulin-like androgenic gland hormone (IAG) in the Chinese mitten crab (Eriocheir sinensis). Front. Physiol. 2022, 13, 1054773. [Google Scholar] [CrossRef] [Scilit]
- Cui, Z.; Liu, Y.; Yuan, J.; Zhang, X.; Ventura, T.; Ma, K.-Y.; Sun, S.; Song, C.; Zhan, D.; Yang, Y.; et al. The Chinese mitten crab genome provides insights into adaptive plasticity and developmental regulation. Nat. Commun. 2021, 12, 2395. [Google Scholar] [CrossRef] [Scilit]
- Kozomara, A.; Birgaoanu, M.; Griffiths-Jones, S. miRBase: From microRNA sequences to function. Nucleic Acids Res. 2019, 47, D155–D162. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, X.; Shahid, M.Q.; Wu, J.; Wang, L.; Liu, X.; Lu, Y. Comparative Small RNA Analysis of Pollen Development in Autotetraploid and Diploid Rice. Int. J. Mol. Sci. 2016, 17, 499. [Google Scholar] [CrossRef] [Scilit]
- John, B.; Enright, A.J.; Aravin, A.; Tuschl, T.; Sander, C.; Marks, D.S. Human MicroRNA targets. PLoS Biol. 2004, 2, e363. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Agarwal, V.; Bell, G.W.; Nam, J.W.; Bartel, D.P. Predicting effective microRNA target sites in mammalian mRNAs. eLife 2015, 4, e05005. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ashburner, M.; Ball, C.A.; Blake, J.A.; Botstein, D.; Butler, H.; Cherry, J.M.; Davis, A.P.; Dolinski, K.; Dwight, S.S.; Eppig, J.T. Gene Ontology tool for the unification of biology. Nat. Genet. 2000, 25, 25–29. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kanehisa, M.; Goto, S.; Kawashima, S.; Okuno, Y.; Hattori, M. The KEGG resource for deciphering the genome. Nucleic Acids Res. 2004, 32, D277–D280. [Google Scholar] [CrossRef] [Scilit]
- Miranda, K.C.; Huynh, T.; Tay, Y.; Ang, Y.S.; Tam, W.L.; Thomson, A.M.; Lim, B.; Rigoutsos, I. A pattern-based method for the identification of MicroRNA binding sites and their corresponding heteroduplexes. Cell 2006, 126, 1203–1217. [Google Scholar] [CrossRef] [Scilit]
- Rehmsmeier, M.; Steffen, P.; Hochsmann, M.; Giegerich, R. Fast and effective prediction of microRNA/target duplexes. RNA 2004, 10, 1507–1517. [Google Scholar] [CrossRef] [Scilit]
- Zhang, D.; Shi, B.; Shao, P.; Shao, C.; Wang, C.; Li, J.; Liu, X.; Ma, X.; Zhao, X. The identification of miRNAs that regulate ovarian maturation in Cynoglossus semilaevis. Aquaculture 2022, 555, 738250. [Google Scholar] [CrossRef] [Scilit]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCt Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit]
- Stoline, M.R. The Status of Multiple Comparisons Simultaneous Estimation of All Pairwise Comparisons in One-Way ANOVA Designs. Am. Stat. 1981, 35, 134–141. [Google Scholar] [CrossRef] [Scilit]
- Zhou, Z.-Y.; Qi, L.; Hong, Y.; Lingfeng, K. Cloning and Expression analysis of Fem-1 gene of Pacific Oyster (Crassostrea gigas). Period. Ocean Univ. China 2018, 48, 45–54. [Google Scholar] [CrossRef]
- Zheng, J.; Chen, L.; Jia, Y.; Chi, M.; Li, F.; Cheng, S.; Liu, S.; Liu, Y.; Gu, Z. Genomic structure, expression, and functional characterization of the Fem-1 gene family in the redclaw crayfish, Cherax quadricarinatus. Gen. Comp. Endocrinol. 2022, 316, 113961. [Google Scholar] [CrossRef] [Scilit]
- Qian, H.; Ma, K.; Feng, J.; Guo, Z.; Gong, J.; Chen, H.; Bai, H.; Qiu, G. Transcriptome analysis of the post-larvae of giant freshwater prawn (Macrobrachium rosenbergii) after IAG gene knockdown with microRNA interference. General Comp. Endocrinol. 2022, 325, 114054. [Google Scholar] [CrossRef] [Scilit]
- Fu, C.; Li, F.; Wang, L.; Wu, F.; Wang, J.; Fan, X.; Liu, T. Molecular characteristics and abundance of insulin-like androgenic gland hormone and effects of RNA interference in Eriocheir sinensis. Anim. Reprod. Sci. 2020, 215, 106332. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xiao, S.; Wang, B.; Li, K.; Xiong, S.; Ye, X.; Wang, J.; Zhang, J.; Yan, Z.; Wang, F.; Song, Q.; et al. Identification and characterization of miRNAs in an endoparasitoid wasp, Pteromalus puparum. Arch. Insect Biochem. Physiol. 2020, 103, e21633. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mohorianu, I.; Fowler, E.K.; Dalmay, T.; Chapman, T. Control of seminal fluid protein expression via regulatory hubs in Drosophila melanogaster. Proc. Biol. Sci. 2018, 285, 20181681. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Laudanski, K.; Soh, J.; DiMeglio, M.; Sullivan, K.E. Prolonged Transcriptional Consequences in Survivors of Sepsis. Int. J. Mol. Sci. 2021, 22, 5422. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xu, L.; Zhang, J.; Zhan, A.; Wang, Y.; Ma, X.; Jie, W.; Cao, Z.; Omar, M.A.A.; He, K.; Li, F. Identification and Analysis of MicroRNAs Associated with Wing Polyphenism in the Brown Planthopper, Nilaparvata lugens. Int. J. Mol. Sci. 2020, 21, 9754. [Google Scholar] [CrossRef] [Scilit]
- Faghihi, M.A.; Zhang, M.; Huang, J.; Modarresi, F.; Van der Brug, M.P.; Nalls, M.A.; Cookson, M.R.; St-Laurent, G., 3rd; Wahlestedt, C. Evidence for natural antisense transcript-mediated inhibition of microRNA function. Genome Biol. 2010, 11, R56. [Google Scholar] [CrossRef] [Scilit]
- Nagoshi, R.N.; Baker, B.S. Regulation of sex-specific RNA splicing at the Drosophila doublesex gene: Cis-acting mutations in exon sequences alter sex-specific RNA splicing patterns. Genes Dev. 1990, 4, 89–97. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kato, Y.; Kobayashi, K.; Watanabe, H.; Iguchi, T. Environmental Sex Determination in the Branchiopod Crustacean Daphnia magna: Deep Conservation of a Doublesex gene in the Sex-Determining Pathway. PLoS Genet. 2011, 7, e1001345. [Google Scholar] [CrossRef] [Scilit] [PubMed]








| Primer | Sequence (5′–3′) | Applications |
|---|---|---|
| EsFem-1c-F1 | CCAGTCATGAAGAGCAGCC | Gene cloning |
| EsFem-1c-R1 | ATGGCCCAGAAGTGCTTG | |
| EsFem-1c-248-F2 | CAGACTGCTGGGGCTTACAA | |
| EsFem-1c-248-R2 | TTCATACATACCGGCCAGCC | |
| EsFem-1c-dsF | AGATCCAGACGAGATGCGAATG | Synthesis of dsRNA |
| EsFem-1c-dsR | CCGTCCTTCACCGCCAC | |
| EGFP-dsF | CACAAGTTCAGCGTGTCCG | |
| EGFP-dsR | AACCACTACCTGAGCACCCA | |
| Primer-T7 | TAATACGACTCACTATAGGG | |
| Primer-SP6 | ATTTAGGTGACACTATAG |
| Primer | Sequence (5′–3′) | Applications |
|---|---|---|
| EsFem-1c-qF | CTCAGTCCTGTTCCCTGCATT | qRT-PCR for mRNA |
| EsFem-1c-qR | AGGGCTGGCCGGTATGTAT | |
| Es-β-actin-qF | GCATCCACGAGACCACTTACA | |
| Es-β-actin-qR | CTCCTGCTTGCTGATCCACATC | |
| EsCFSH-1-qF | ATACGTTGAGCGCCAGATCC | |
| EsCFSH-1-qR | CAGAGCCACACATACGGAGC | |
| EsIAG-qF | GCTCCTACAAGCAGCACCC | |
| EsIAG-qR | AGGGTCTTCCAGATGGATCG | |
| tca-bantam-3p | TGAGATCATTGTGAAAGCTGATT | qRT-PCR for miRNAs |
| tcf-miR-281-3p | CTGTCATGGAGTTGCTCTCTTT | |
| tcf-miR-307 | TCACAACCTCCTTGAGTGAGT | |
| tcf-miR-7 | TGGAAGACTAGTGATTTTGTTGTT | |
| bmo-mir-6497-p5 | TCGGGATAAGGATTGGCTC | |
| tcf-miR-315-5p | TTTTGATTGTTGCTCAGAAGG | |
| tcf-let-7-5p | TGAGGTAGTAGGTTGTGTGGTT | |
| tcf-let-7-3p | CTGTACAACTTGCTAACTTTCC | |
| PC-3p-120711 | TGTGGTTGAGCAAAAAGGG | |
| PC-5p-16060 | TCGATCCCCGGCACCTCCA | |
| PC-3p-74 | TGACTAGAGATTCACACTCAT | |
| tcf-miR-278_R | TCGGTGGGATTCTCGTCCG | |
| mja-mir-6489-p5 | CGGACTGGCGCTCTTGGA | |
| tcf-miR-10-5p | TACCCTGTAGATCCGAATTTG | |
| PC-5p-21023 | GGTGGAAAGAGATTCAGTCG | |
| PC-5p-17859 | GATGGGTGTGTCTCTGGTGC | |
| PC-3p-1739 | TAGCACCATGTGAATTCAGTAC | |
| bmo-miR-306a-5p | TCAGGTACTGTGTGACTCTG | |
| tcf-miR-9a-5p | TCTTTGGTGATCTAGCTGTATG | |
| tcf-miR-279b | TGACTAGATCCATACTCATCT | |
| U6-R | AACGCTTCACGAATTTGCGT |
| Primer | Sequence (5′–3′) | Applications |
|---|---|---|
| Fem-1c-miF | GGAGCTCTAACCCTGGAGACAGGGATGAA | Wild plasmids |
| Fem-1c-miR | CTAGCTAGCCTCGCTGGACAGACAAGATGG | |
| Fem-1c-248-miF | GGAGCTCGTTGGACAGAGGTTGCTGTTTT | |
| Fem-1c-248-miR | CTAGCTAGCGGCCCAGAAGTGCTTGATGTT | |
| Fem-1c-MF1 | TGAGGGGGGACTAAATGTCATTTCAATTTTGTGTTGC | Mutant plasmids |
| Fem-1c-MR1 | CATTTAGTCCCCCCTCAAACCTCTCAACAATCACAT | |
| Fem-1c-MF2 | AAAAGTGCCGGGTGTGACGCTGGGGGGGGTCACG | |
| Fem-1c-MR2 | GTCACACCCGGCACTTTTCAAAATTTTTTTTTC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhu, D.; Feng, T.; Mo, N.; Han, R.; Lu, W.; Cui, Z. Eriocheir sinensis feminization-1c (Fem-1c) and Its Predicted miRNAs Involved in Sexual Development and Regulation. Animals 2023, 13, 1813. https://doi.org/10.3390/ani13111813
Zhu D, Feng T, Mo N, Han R, Lu W, Cui Z. Eriocheir sinensis feminization-1c (Fem-1c) and Its Predicted miRNAs Involved in Sexual Development and Regulation. Animals. 2023; 13(11):1813. https://doi.org/10.3390/ani13111813
Chicago/Turabian StyleZhu, Dandan, Tianyi Feng, Nan Mo, Rui Han, Wentao Lu, and Zhaoxia Cui. 2023. "Eriocheir sinensis feminization-1c (Fem-1c) and Its Predicted miRNAs Involved in Sexual Development and Regulation" Animals 13, no. 11: 1813. https://doi.org/10.3390/ani13111813
APA StyleZhu, D., Feng, T., Mo, N., Han, R., Lu, W., & Cui, Z. (2023). Eriocheir sinensis feminization-1c (Fem-1c) and Its Predicted miRNAs Involved in Sexual Development and Regulation. Animals, 13(11), 1813. https://doi.org/10.3390/ani13111813

