Roundup in the Reproduction of Crucian Carp (Carassius carassius): An In Vitro Effect on the Pituitary Gland and Ovary
Abstract
:Simple Summary
Abstract
1. Introduction
- the secretion of the luteinizing hormone (LH), mRNA transcript abundance of kisspeptin (kiss-1) and its receptor (gpr54), and estrogen receptors (erα, erβ1, erβ2) after 3-h incubation of the crucian carp whole pituitary glands in medium containing Roundup
- the final oocyte maturation and ovulation, structural changes in follicles, secretion of 17,20β-progesterone (17,20β-P) as well as mRNA transcript abundance of luteinizing hormone receptor (lhr), estrogen receptors (erα, erβ1, erβ2) and zona radiata (chorion) proteins (zp2 and zp3) after 24 h during in vitro incubation of crucian carp ovarian fragments in medium containing Roundup.
2. Materials and Methods
2.1. Pituitary Preparation and Incubation
2.2. Follicle Preparation and Oocytes Maturation
2.3. Total RNA Isolation and cDNA Synthesis
2.4. Hormone Analysis
2.5. Ovarian Morphology
2.6. Statistical Analysis
3. Results
3.1. The Effect of Roundup on the LH and 17,20β-P Levels
3.2. The Effect of Roundup on the mRNA Transcript Abundance of kiss-1, gpr54, lhr, erα, erβ1, erβ2, zp2, and zp3
3.3. The Effect of Roundup on Oocyte Maturation and Ovarian Morphology
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Suder, D.; Socha, M. Roundup in the aquatic environment and fish reproduction. Anim. Sci. Genet. 2022, 18, 1–10. [Google Scholar] [CrossRef]
- Uren Webster, T.M.; Laing, L.V.; Florance, H.; Santos, E.M. Effects of glyphosate and its formulation, roundup, on reproduction in zebrafish (Danio rerio). Environ. Sci. Technol. 2014, 48, 1271–1279. [Google Scholar] [CrossRef] [PubMed]
- Lopes, F.M.; Junior, A.S.V.; Corcini, C.D.; Silva, A.D.; Guazzelli, V.G.; Tavares, G.; da Rosa, C.E. Effect of glyphosate on the sperm quality of zebrafish Danio rerio. Aquat. Toxicol. 2014, 155, 322–326. [Google Scholar] [CrossRef]
- Ługowska, K. The effects of Roundup on gametes and early development of common carp (Cyprinus carpio L). Fish Physiol. Biochem. 2018, 44, 1109–1117. [Google Scholar] [CrossRef] [PubMed]
- Ługowska, K. The effect of Roundup on gametes of grass carp Ctenopharyngodon idella Val.—Preliminary research. Sci. Ann. Pol. Soc. Anim. Prod. 2020, 16, 59–64. [Google Scholar] [CrossRef]
- Yusof, S.; Ismail, A.; Alias, M.S. Effect of glyphosate-based herbicide on early life stages of Java medaka (Oryzias javanicus): A potential tropical test fish. Mar. Pollut. Bull. 2014, 85, 494–498. [Google Scholar] [CrossRef]
- Fiorino, E.; Sehonova, P.; Plhalova, L.; Blahova, J.; Svobodova, Z.; Faggio, C. Effects of glyphosate on early life stages: Comparison between Cyprinus carpio and Danio rerio. Environ. Sci. Pollut. Res. 2018, 25, 8542–8549. [Google Scholar] [CrossRef]
- Panetto, O.S.; Gomes, H.F.; Fraga Gomes, D.S.; Campos, E.; Romeiro, N.C.; Costa, E.P.; do Carmo, P.R.L.; Feitosa, N.M.; Moraes, J. The effects of Roundup® in embryodevelopment and energy metabolism of the zebrafish (Danio rerio). Comp. Biochem. Physiol. C Toxicol. Pharmacol. 2019, 222, 74–81. [Google Scholar] [CrossRef]
- Smith, C.M.; Vera, M.K.M.; Bhandari, R.K. Developmental and epigenetic effects of Roundup and glyphosate exposure on Japanese medaka (Oryzias latipes). Aquat. Toxicol. 2019, 210, 215–226. [Google Scholar] [CrossRef]
- Socha, M.; Szczygieł, J.; Brzuska, E.; Sokołowska-Mikołajczyk, M.; Stonawski, B.; Grzesiak, M. The effect of Roundup on embryonic development, early foxr1 and hsp70 gene expression and hatching of common carp (Cyprinus carpio L.). Theriogenology 2021, 175, 163–169. [Google Scholar] [CrossRef]
- Annett, R.; Habibi, H.R.; Hontel, A. Impact of glyphosate and glyphosate-based herbicides on the freshwater environment. J. Appl. Toxicol. 2014, 34, 458–479. [Google Scholar] [CrossRef] [PubMed]
- Poiger, T.; Buerge, I.J.; Bachli, A.; Muller, M.D.; Balmer, M.E. Occurrence of the herbicide glyphosate and its metabolite AMPA in surface waters in Switzerland determined with on-line solid phase extraction LC-MS/MS. Environ. Sci. Pollut. Res. 2017, 24, 1588–1596. [Google Scholar] [CrossRef] [PubMed]
- Conrad, A.; Schroter-Kermani, C.; Hoppe, H.W.; Ruther, M.; Pieper, S.; Kolossa-Gehring, M. Glyphosate in German adults—Time trend (2001 to 2015) of humanexposure to a widely used herbicide. Int. J. Hyg. Environ. Health. 2017, 220, 8–16. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cai, W.; Yang, X.; Li, X.; Li, H.; Wang, S.; Wu, Z.; Yu, M.; Ma, S.; Tang, S. Low-dose Roundup induces developmental toxicity in bovine preimplantation embryos in vitro. Environ. Sci. Pollut. Res. 2020, 27, 16451–16459. [Google Scholar] [CrossRef] [PubMed]
- Xu, J.; Shayna, S.; Smith, G.; Want, W.; Li, Y. Glyphosate contamination in grains and foods: An overview. Food Control. 2019, 18, 106710. [Google Scholar] [CrossRef]
- Walsh, L.P.; McCormick, C.; Martin, C.; Stocco, D.M. Roundup inhibits steroidogenesis by disrupting steroidogenic acute regulatory (StAR) protein expression. Environ. Health Perspect. 2000, 108, 769–776. [Google Scholar] [CrossRef] [PubMed]
- Richard, S.; Moslemi, S.; Sipahutar, H.; Benachour, N.; Seralini, G.E. Differential effects of glyphosate and roundup on human placental cells and aromatase. Environ. Health Perspect. 2005, 113, 716–720. [Google Scholar] [CrossRef] [Green Version]
- Clair, E.; Mesnage, R.; Travert, C.; Séralini, G.É. A glyphosate-based herbicide induces necrosis and apoptosis in mature rat testicular cells in vitro, and testosterone decrease at lower levels. Toxicol. In Vitro 2012, 26, 269–279. [Google Scholar] [CrossRef]
- Romano, M.A.; Romano, R.M.; Santos, L.D.; Wisniewski, P.; Campos, D.A.; Souza, P.B.; Viau, P.; Bernardi, M.M.; Nunes, M.T.; de Oliveira, C.A. Glyphosate impairs male offspring reproductive development by disrupting gonadotropin expression. Reprod. Toxicol. 2012, 86, 663–673. [Google Scholar] [CrossRef]
- Owagboriaye, F.O.; Dedeke, G.A.; Ademolu, K.O.; Olujimi, O.O.; Ashidi, J.S.; Adeyinka, A.A. Reproductive toxicity of Roundup herbicide exposure in male albino rat. Exp. Toxicol. Pathol. 2017, 69, 461–468. [Google Scholar] [CrossRef]
- Parego, M.C.; Caloni, F.; Cortinovis, C.; Schutz, L.F.; Albonico, M.; Tsuzukibashi, D.; Spicer, L.J. Influence of a Roundup formulation on glyphosate effects on steroidogenesis and proliferation of bovine granulosa cells in vitro. Chemosphere 2017, 188, 274–279. [Google Scholar] [CrossRef] [PubMed]
- Hamdaoui, L.; Naifar, M.; Rahmouni, F.; Harrabi, B.; Ayadi, F.; Sahnoun, Z.; Rebai, T. Subchronic exposure to kalach 360 SL-induced endocrine disruption and ovary damage in female rats. Arch. Physiol. Biochem. 2018, 124, 27–34. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.W.; Xu, D.Q.; Feng, X.Z. The toxic effects and possible mechanisms of glyphosate on mouse oocytes. Chemosphere 2019, 237, 124435. [Google Scholar] [CrossRef] [PubMed]
- Spinaci, M.; Nerozzi, C.; Tamanini, C.; Bucci, D.; Galeati, G. Glyphosate and its formulation Roundup impair pig oocyte maturation. Sci. Rep. 2020, 10, 12007. [Google Scholar] [CrossRef]
- Levavi-Sivan, B.; Bogerd, J.; Mañanós, E.L.; Gómez, A.; Lareyre, J.J. Perspectives on fish gonadotropins and their receptors. Gen. Comp. Endocrinol. 2010, 165, 412–437. [Google Scholar] [CrossRef]
- Gárriz, Á.; del Fresno, P.; Miranda, L. Exposure to E2 and EE2 environmental concentrations affect different components of the Brain-Pituitary-Gonadal axis in pejerrey fish (Odontesthes bonariensis). Ecotoxicol. Environ. Saf. 2017, 144, 45–53. [Google Scholar] [CrossRef]
- Nakajo, M.; Kanda, S.; Karigo, T.; Takahashi, A.; Akazome, Y.; Uenoyama, Y.; Kobayashi, M.; Oka, Y. Evolutionally conserved function of kisspeptin neuronal system is non reproductive regulation as revealed by no mammalian study. Endocrinology 2018, 159, 163–183. [Google Scholar] [CrossRef]
- Zohar, Y. Fish reproductive biology—Reflecting on five decades of fundamental and translational research. Gen. Comp. Endocrinol. 2021, 300, 113544. [Google Scholar] [CrossRef]
- Nagahama, Y.; Yamashita, M. Regulation of oocyte maturation in fish. Dev. Growth Differ. 2008, 50, 195–219. [Google Scholar] [CrossRef]
- Biran, J.; Levavi-Sivan, B. Endocrine Control of Reproduction, Fish. Encyclopedia of Reproduction (Second Edition); Elsevier Inc.: Amsterdam, The Netherlands, 2018; pp. 362–368. [Google Scholar] [CrossRef]
- Lubzens, E.; Bobe, J.; Young, G.; Sullivan, C.V. Maternal investment in fish oocytes and eggs: The molecular cargo and its contributions to fertility and early development. Aquaculture 2017, 472, 107–143. [Google Scholar] [CrossRef] [Green Version]
- Tokumoto, T.; Tokumoto, M.; Nagahama, Y. Induction and inhibition of oocyte maturation by EDCs in zebrafish. Reprod. Biol. Endocrinol. 2005, 3, 69. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Maskey, E.; Crotty, H.; Wooten, T.; Khan, I.A. Disruption of oocyte maturation by selected environmental chemicals in zebrafish. Toxicol. In Vitro 2019, 54, 123–129. [Google Scholar] [CrossRef] [PubMed]
- Spargo, S.C.; Hope, R.M. Evolution and nomenclature of the zona pellucida gene family. Biol. Reprod. 2003, 68, 358–362. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sano, K.; Kawaguchi, M.; Yoshikawa, M.; Iuchi, I.; Yasumasu, S. Evolution of the teleostean zona pellucida gene inferred from the egg envelope protein genes of the Japanese eel, Anguilla japonica. FEBS J. 2010, 277, 4674–4684. [Google Scholar] [CrossRef]
- Qi, P.; Ren, S.; Tang, Z.; Guo, B.; Xia, H. Expression of zona pellucida 3 gene is regulated by 17α-ethinylestradiol in adult topmouth culter Culter alburnus. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 2018, 214, 43–51. [Google Scholar] [CrossRef]
- Chang, Y.S.; Wang, S.C.; Tsao, C.C.; Huang, F.L. Molecular cloning, structural analysis, and expression of carp ZP3 gene. Mol. Reprod. Dev. 1996, 44, 295–304. [Google Scholar] [CrossRef]
- Shi, J.W.; Sheng, J.Q.; Peng, K.; Wang, J.H.; Yi, W.J.; Wu, H.J.; Gu, Q.; Hong, Y.J. Expression pattern of the zona pellucida 3 (ZP3) gene during ovarian development and the location of ZP3 protein in oocytes in a natural, wild triploid crucian carp mutant, Carassius auratus var. Pingxiangnensis. Genet. Mol. Res. 2013, 12, 5640–5650. [Google Scholar] [CrossRef]
- Wu, T.; Cheng, Y.; Liu, Z.; Tao, W.; Zheng, S.; Wang, D. Bioinformatic analyses of zona pellucida genes in vertebrates and their expression in Nile tilapia. Fish. Physiol. Biochem. 2018, 44, 435–449. [Google Scholar] [CrossRef]
- Armiliato, N.; Ammar, D.; Nezzi, L.; Straliotto, M.; Muller, Y.M.; Nazari, E.M. Changes in ultrastructure and expression of steroidogenic factor-1 in ovaries of zebrafish Danio rerio exposed to glyphosate. J. Toxicol. Environ. Health A 2014, 7, 405–414. [Google Scholar] [CrossRef]
- Davico, C.E.; Pereira, A.G.; Nezzi, L.; Jaramillo, M.L.; de Melo, M.S.; Müller, Y.M.R.; Nazari, E.M. Reproductive toxicity of Roundup WG® herbicide: Impairments in ovarian follicles of model organism Danio rerio. Environ. Sci. Pollut. Res. 2021, 28, 15147–15159. [Google Scholar] [CrossRef]
- Lusk, S.; Lusková, V.; Hanel, L. Alien fish species in the Czech Republic and their impact on the native fish fauna. Folia Zool. 2010, 59, 57–72. [Google Scholar] [CrossRef]
- Witkowski, A.; Grabowska, J. The non-indigenous freshwater fishes of Poland. Threats to the native ichthyofauna and consequences for the fishery: A review. Acta Ichthyol. Et Piscat. 2012, 42, 77–87. [Google Scholar] [CrossRef] [Green Version]
- Tarkan, A.S.; Almeida, D.; Godard, M.J.; Gaygusuz, Ö.; Rylands, M.; Sayer, C.D.; Zięba, G.; Copp, G.H. A review and meta-analysis of growth and life-history traits of a declining European freshwater fish, crucian carp Carassius carassius. Aquat. Conserv. Mar. Freshw. Ecosyst. 2016, 26, 212–224. [Google Scholar] [CrossRef]
- Kah, O.; Pontet, A.; Rodriguez, J.N.; Calas, A.; Breton, B. Development of an enzyme-linked immunosorbent assay for goldfish gonadotropin. Biol. Reprod. 1989, 41, 68–73. [Google Scholar] [CrossRef] [Green Version]
- Brzuska, E.; Bieniarz, K. Metoda Przyżyciowego Określania Dojrzałości Płciowej Samic Karpia w Związku z Iniekcjami Homogenatu Przysadki Mózgowej Karpia—Broszura Nr 105, Wyd; IRS: Olsztyn, Poland, 1977. [Google Scholar]
- Szczerbik, P.; Mikołajczyk, T.; Sokołowska-Mikołajczyk, M.; Socha, M.; Chyb, J.; Epler, P. The influence of cadmium on Prussian carp oocyte maturation, development of eggs and hatching. Czech J. Anim. Sci. 2008, 53, 36. [Google Scholar] [CrossRef] [Green Version]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Golshan, M.; Habibi, H.R.; Alavi, S.M. Transcripts of genes encoding reproductive neuroendocrine hormones and androgen receptor in the brain and testis of goldfish exposed to vinclozolin, flutamide, testosterone, and their combinations. Fish. Physiol. Biochem. 2016, 42, 1157–1165. [Google Scholar] [CrossRef] [PubMed]
- Ma, Y.; Ladisa, C.; Chang, J.P.; Habibi, H.R. Seasonal Related Multifactorial Control of Pituitary Gonadotropin and Growth Hormone in Female Goldfish: Influences of Neuropeptides and Thyroid Hormone. Front. Endocrinol. 2020, 11, 175. [Google Scholar] [CrossRef] [Green Version]
- Golshan, M.; Hatef, A.; Habibi, H.R.; Alavi, S.M. A rapid approach to assess estrogenic transcriptional activityof bisphenol A in the liver of goldfish. Iran. J. Fish. Sci. 2020, 19, 2877–2892. [Google Scholar] [CrossRef]
- Slaby, S.; Titran, P.; Marchand, G.; Hanotel, J.; Lescuyer, A.; Bodart, J.-F.; Marin, M. Effects of glyphosate and a commercial formulation Roundup® exposures on maturation of Xenopus laevis oocytes. Environ. Sci. Pollut. Res. 2020, 27, 3697–3705. [Google Scholar] [CrossRef]
- Kim, K.T.; Tanguay, R.L. The role of chorion on toxicity of silver nanoparticles in the embryonic zebrafish assay. Environ. Anal. Health Toxicol. 2014, 29, e2014021. [Google Scholar] [CrossRef] [PubMed]
- Mylroie, J.E.; Wilbanks, M.S.; Kimble, A.N.; To, K.T.; Cox, C.S.; McLeod, S.J.; Gust, K.A.; Moore, D.W.; Perkins, E.J.; Garcia-Reyero, N. Perfluorooctanesulfonic Acid–Induced Toxicity on Zebrafish Embryos in the Presence or Absence of the Chorion. Environ. Toxicol. Chem. 2021, 40, 780–791. [Google Scholar] [CrossRef] [PubMed]
- Tran, C.M.; Lee, H.; Lee, B.; Ra, J.S.; Kim, K.T. Effects of the chorion on the developmental toxicity of organophosphate esters in zebrafish embryos. J. Hazard. Mater. 2021, 401, 123389. [Google Scholar] [CrossRef] [PubMed]
- Keramaris, K.E.; Konstantopoulos, K.; Margaritis, L.H.; Velentzas, A.D.; Papassideri, I.S.; Stravopodis, D.J. Exploitation of drosophila choriogenesis process as a model cellular system for assessment of compound toxicity: The phloroglucinol paradigm. Sci. Rep. 2020, 10, 242. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Carnevali, O.; Santangeli, S.; Forner-Piquer, I.; Basili, D.; Maradonna, F. Endocrine-disrupting chemicals in aquatic environment: What are the risks for fish gametes? Fish Physiol. Biochem. 2018, 44, 1561–1576. [Google Scholar] [CrossRef]
- Hirakawa, I.; Miyagawa, S.; Katsu, Y.; Kagami, Y.; Tatarazako, N.; Kobayashi, T.; Kusano, T.; Mizutani, T.; Ogino, Y.; Takeuchi, T.; et al. Gene expression profiles in the testis associated with testis–ova in adult Japanese medaka (Oryzias latipes) exposed to 17α-ethinylestradiol. Chemosphere 2012, 87, 668–674. [Google Scholar] [CrossRef]
- Thongprakaisang, S.; Thiantanawat, A.; Rangkadilok, N.; Suriyo, T.; Satayavivad, J. Glyphosate induces human breast cancer cells growth via estrogen receptors. Food Chem. Toxicol. 2013, 59, 129–136. [Google Scholar] [CrossRef]
- Socha, M.; Drąg-Kozak, E.; Sokołowska-Mikołajczyk, M.; Chyb, J. Effect of herbicide Roundup and tamoxifen on Prussian carp (Carassius gibelio B.) oocyte maturation and secretion of 17α20β-p in vitro. In Proceedings of the 5th Winter Workshop of the Society for Biology of Reproduction, Zakopane, Poland, 13–15 February 2019; p. 79, Unpublished Results. [Google Scholar]
- Marc, J.; Mulner-Lorillon, O.; Boulben, S.; Hureau, D.; Durand, G.; Bellé, R. Pesticide Roundup provokes cell division dysfunction at the level of CDK1/cyclin B activation. Chem. Res. Toxicol. 2002, 15, 326–331. [Google Scholar] [CrossRef]
Gene | Forward Primer (5′-3′) | Reverse Primer (5′-3′) | Reference |
kiss1 | CAGATCCTCAGCGAAACACA | GCAAGCATGTTCTGCTCTCT | [49] |
gpr54 | TTTGGGGACTTCATGTGTCG | ATCTGTGGTGTTCGATGACG | [49] |
lhr | CCTCTGCATCGGTGTGTATC | TAGACAGATAGTTCGCCGCC | [49] |
erα | GAGGAAGAGTAGCAGCACTG | GGCTGTGTTTCTGTCGTGAG | [50] |
erβ1 | GGCAGGATGAGAACAAGTGG | GTAAATCTCGGGTGGCTCTG | [51] |
erβ2 | GGATTATTCACCACCGCACG | TTCGGACACAGGAGGATGAG | [51] |
β-actin | GTTTTGCTGGAGATGATGCC | TTCTGTCCCATGCCAACCAT | [49] |
gapdh | TGATGCTGGTGCCCTGTATGTAGT | TGTCCTGGTTGACTCCCATCACAA | [49] |
zp2 | CTGAGTCTGGATTCGGTTCA | ATATCCTCCGTCCTCCATCA | |
zp3 | CCAGCCATCTGGTTTGTCTA | CACAGGGGTGTAGGTAAGAG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Socha, M.; Szczygieł, J.; Chyb, J.; Drąg-Kozak, E.; Sokołowska-Mikołajczyk, M.; Brzuska, E.; Pecio, A.; Grzesiak, M. Roundup in the Reproduction of Crucian Carp (Carassius carassius): An In Vitro Effect on the Pituitary Gland and Ovary. Animals 2023, 13, 105. https://doi.org/10.3390/ani13010105
Socha M, Szczygieł J, Chyb J, Drąg-Kozak E, Sokołowska-Mikołajczyk M, Brzuska E, Pecio A, Grzesiak M. Roundup in the Reproduction of Crucian Carp (Carassius carassius): An In Vitro Effect on the Pituitary Gland and Ovary. Animals. 2023; 13(1):105. https://doi.org/10.3390/ani13010105
Chicago/Turabian StyleSocha, Magdalena, Joanna Szczygieł, Jarosław Chyb, Ewa Drąg-Kozak, Mirosława Sokołowska-Mikołajczyk, Elżbieta Brzuska, Anna Pecio, and Małgorzata Grzesiak. 2023. "Roundup in the Reproduction of Crucian Carp (Carassius carassius): An In Vitro Effect on the Pituitary Gland and Ovary" Animals 13, no. 1: 105. https://doi.org/10.3390/ani13010105
APA StyleSocha, M., Szczygieł, J., Chyb, J., Drąg-Kozak, E., Sokołowska-Mikołajczyk, M., Brzuska, E., Pecio, A., & Grzesiak, M. (2023). Roundup in the Reproduction of Crucian Carp (Carassius carassius): An In Vitro Effect on the Pituitary Gland and Ovary. Animals, 13(1), 105. https://doi.org/10.3390/ani13010105