Occurrence of Bacterial and Protozoan Pathogens in Red Foxes (Vulpes vulpes) in Central Italy
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Sampling
2.2. Bacteriological Analyses
- Salmonella spp.
- Yersinia spp.
- Listeria monocytogenes
2.3. Molecular Analyses
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Ebani, V.V.; Rocchigiani, G.; Nardoni, S.; Bertelloni, F.; Vasta, V.; Papini, R.A.; Verin, R.; Poli, A.; Mancianti, F. Molecular detection of tick-borne pathogens in wild red foxes (Vulpes vulpes) from Central Italy. Acta Trop. 2017, 172, 197–200. [Google Scholar] [CrossRef] [PubMed]
- Nowakiewicz, A.; Zięba, P.; Ziółkowska, G.; Gnat, S.; Muszyńska, M.; Tomczuk, K.; Dziedzic, B.M.; Ulbrych, Ł.; Trościańczyk, A. Free-Living Species of Carnivorous Mammals in Poland: Red Fox, Beech Marten, and Raccoon as a Potential Reservoir of Salmonella, Yersinia, Listeria spp. and Coagulase-Positive Staphylococcus. PLoS ONE 2016, 11, e0155533. [Google Scholar] [CrossRef] [PubMed]
- Scholz, H.C.; Revilla-Fernández, S.; Al Dahouk, S.; Hammerl, J.A.; Zygmunt, M.; Cloeckaert, A.; Koylass, M.; Whatmore, A.; Blom, J.; Vergnaud, G.; et al. Brucella vulpis sp. nov., isolated from mandibular lymph nodes of red foxes (Vulpes vulpes). Int. J. Syst. Evol. Microbiol. 2016, 66, 2090–2098. [Google Scholar] [CrossRef] [PubMed]
- Tagliabue, S.; Figarolli, B.M.; D’Incau, M.; Foschi, G.; Gennero, M.S.; Giordani, R.; Giordani, R.; Natale, A.; Papa, P.; Ponti, N.; et al. Serological surveillance of Leptospirosis in Italy: Two-year national data (2010–2011). Vet. Ital. 2016, 52, 129–138. [Google Scholar] [CrossRef] [PubMed]
- Hodžić, A.; Alić, A.; Fuehrer, H.-P.; Harl, J.; Wille-Piazzai, W.; Duscher, G.G. A molecular survey of vector-borne pathogens in red foxes (Vulpes vulpes) from Bosnia and Herzegovina. Parasites Vectors 2015, 8, 88. [Google Scholar] [CrossRef]
- Hodžić, A.; Mrowietz, N.; Cézanne, R.; Bruckschwaiger, P.; Punz, S.; Habler, V.E.; Tomsik, V.; Lazar, J.; Duscher, G.G.; Glawischnig, W.; et al. Occurrence and diversity of arthropod-transmitted pathogens in red foxes (Vulpes vulpes) in western Austria, and possible vertical (transplacental) transmission of Hepatozoon canis. Parasitology 2017, 145, 335–344. [Google Scholar] [CrossRef]
- Mierzejewska, E.J.; Dwużnik, D.; Koczwarska, J.; Stańczak, Ł.; Opalińska, P.; Krokowska-Paluszak, M.; Wierzbicka, A.; Górecki, G.; Bajer, A. The red fox (Vulpes vulpes), a possible reservoir of Babesia vulpes, B. canis and Hepatozoon canis and its association with the tick Dermacentor reticulatus occurrence. Ticks Tick-Borne Dis. 2021, 12, 101551. [Google Scholar] [CrossRef]
- Meredith, A.L.; Cleaveland, S.C.; Brown, J.; Mahajan, A.; Shaw, D.J. Seroprevalence of Encephalitozoon cuniculi in wild rodents, foxes and domestic cats in three sites in the United Kingdom. Transbound Emerg Dis. 2015, 62, 148–156. [Google Scholar] [CrossRef]
- Lempp, C.; Jungwirth, N.; Grilo, M.L.; Reckendorf, A.; Ulrich, A.; van Neer, A.; Bodewes, R.; Pfankuche, V.M.; Bauer, C.; Osterhaus, A.D.; et al. Pathological findings in the red fox (Vulpes vulpes), stone marten (Martes foina) and raccoon dog (Nyctereutes procyonoides), with special emphasis on infectious and zoonotic agents in Northern Germany. PLoS ONE 2017, 12, e0175469. [Google Scholar] [CrossRef]
- Ebani, V.V.; Verin, R.; Fratini, F.; Poli, A.; Cerri, D. Molecular survey of Anaplasma phagocytophilum and Ehrlichia canis in red foxes (Vulpes vulpes) frrom Central Italy. J. Wildl. Dis. 2011, 47, 699–703. [Google Scholar] [CrossRef]
- Verin, R.; Mugnaini, L.; Nardoni, S.; Papini, R.A.; Ariti, G.; Poli, A.; Mancianti, F. Serologic, molecular, and pathologic survey of Toxoplasma gondii infection in free-ranging red foxes (Vulpes vulpes) in central Italy. J. Wildl. Dis. 2013, 49, 545–551. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Chiari, M.; Ferrari, N.; Giardiello, D.; Lanfranchi, P.; Zanoni, M.; Lavazza, A.; Alborali, L.G. Isolation and identification of Salmonella spp. from red foxes (Vulpes vulpes) and badgers (Meles meles) in northern Italy. Acta Vet. Scand. 2014, 56, 86. [Google Scholar] [CrossRef] [PubMed]
- Santoro, M.; Veneziano, V.; D′Alessio, N.; Di Prisco, F.; Lucibelli, M.G.; Borriello, G.; Cerrone, A.; Dantas-Torres, F.; Latrofa, M.S.; Otranto, D.; et al. Molecular survey of Ehrlichia canis and Coxiella burnetii infections in wild mammals of southern Italy. Parasitol. Res. 2016, 115, 4427–4431. [Google Scholar] [CrossRef] [PubMed]
- Santoro, M.; Auriemma, C.; Lucibelli, M.G.; Borriello, G.; D’Alessio, N.; Sgroi, G.; Veneziano, V.; Galiero, G.; Fusco, G. Molecular Detection of Babesia spp. (Apicomplexa: Piroplasma) in Free-Ranging Canids and Mustelids From Southern Italy. Front. Vet Sci. 2019, 6, 269. [Google Scholar] [CrossRef]
- Battisti, E.; Zanet, S.; Khalili, S.; Trisciuoglio, A.; Hertel, B.; Ferroglio, E. Molecular Survey on Vector-Borne Pathogens in Alpine Wild Carnivorans. Front. Vet. Sci. 2020, 7, 1. [Google Scholar] [CrossRef]
- Sgroi, G.; Iatta, R.; Veneziano, V.; Bezerra-Santos, M.A.; Lesiczka, P.; Hrazdilová, K.; Annoscia, G.; D′Alessio, N.; Golovchenko, M.; Rudenko, N.; et al. Molecular survey on tick-borne pathogens and Leishmania infantum in red foxes (Vulpes vulpes) from southern Italy. Ticks Tick Borne Dis. 2021, 12, 101669. [Google Scholar] [CrossRef]
- Carella, E.; Romano, A.; Domenis, L.; Robetto, S.; Spedicato, R.; Guidetti, C.; Pitti, M.; Orusa, R. Characterisation of Yersinia enterocolitica strains isolated from wildlife in the northwestern Italian Alps. J. Vet. Res. 2022, 66, 141–149. [Google Scholar] [CrossRef]
- Bertelloni, F.; Chemaly, M.; Cerri, D.; LeGall, F.; Ebani, V.V. Salmonella infection in healthy pet reptiles: Bacteriological isolation and study of some pathogenic characters. Acta Microbiol. Immunol. Hung. 2016, 63, 203–216. [Google Scholar] [CrossRef]
- Murphy, B.P.; Drummond, N.; Ringwood, T.; O’Sullivan, E.; Buckley, J.F.; Whyte, P.; Prentice, M.B.; Fanning, S. First report: Yersinia enterocolitica recovered from canine tonsils. Vet. Microbiol. 2010, 146, 336–339. [Google Scholar] [CrossRef]
- Bottone, E.J. Yersinia enterocolitica: The charisma continues. Clin. Microbiol. Rev. 1997, 10, 257–276. [Google Scholar] [CrossRef]
- Massung, R.F.; Slater, K.; Owens, J.H.; Nicholson, W.L.; Mather, T.N.; Solberg, V.B.; Olson, J.G. Nested PCR assay for detection of granulocytic Ehrlichiae. J. Clin. Microbiol. 1988, 36, 1090–1095. [Google Scholar] [CrossRef] [PubMed]
- Beck, R.; Vojta, L.; Mrljak, V.; Marinculic, A.; Beck, A.; Zivicnjak, T.; Cacciò, S.M. Diversity of Babesia and Theileria species in symptomatic and asymptomatic dogs in Croatia. Int. J. Parasitol. 2009, 39, 843–848. [Google Scholar] [CrossRef] [PubMed]
- Romero, C.; Gamazo, C.; Pardo, M.; Lopez-Goni, I. Specific detection of Brucella DNA by PCR. J. Clin. Microbiol. 1995, 33, 615–617. [Google Scholar] [CrossRef] [PubMed]
- Berri, M.; Rekiki, A.; Boumedini, A.; Rodolakis, A. Simultaneous differential detection of Chlamydia abortus, Chlamydia pecorum and Coxiella burnetii from aborted ruminant’s cclinical samples using multiplex PCR. BMC Microbiol. 2009, 9, 130. [Google Scholar] [CrossRef] [PubMed]
- Dawson, J.E.; Stallknecht, D.E.; Howerth, E.W.; Warner, C.; Biggie, K.; Davidson, W.R.; Lockhart, J.M.; Nettles, V.F.; Olsen, J.G.; Childs, J.E. Suscceptibility of white-tailed deer (Odocoileus virginianus) to infection with Ehrlichia chaffeensis, the etiologic agent of human ehrlichiosis. J. Clin. Microbiol. 1994, 32, 2725–2728. [Google Scholar] [CrossRef]
- Wen, B.; Rikihisa, Y.; Mott, J.M.; Greene, R.; Kim, H.Y.; Zhi, N.; Couto, G.C.; Unver, A.; Bartsch, R. Comparison of nested PCR with immunofluorescent-antibody assay for detection of Ehrlichia canis infection in dogs treated with doxycycline. J. Clin. Microbiol. 1997, 35, 1852–1855. [Google Scholar] [CrossRef]
- Inokuma, H.; Okuda, M.; Ohno, K.; Shimoda, K.; Onishi, T. Analysis of the 18S rRNA gene sequence of a Hepatozoon detected in two Japanese dogs. Vet. Parasitol. 2002, 106, 265–271. [Google Scholar] [CrossRef]
- Bedir, O.; Kilic, A.; Atabek, E.; Kuskucu, A.M.; Turhan, V.; Basustaoglu, A.C. Simultaneous detection and differentiation of pathogenic and non-pathogenic Leptospira spp. By multiplex real-time PCR (TaqMan) assay. Polish J. Microbiol. 2010, 59, 167–173. [Google Scholar] [CrossRef]
- Stoddard, R.A.; Gee, J.E.; Wilkins, P.P.; McCaustland, K.; Hoffmaster, A.R. Detection of pathogenic Leptospira spp. Through TaqMan polymerase chain reactionn targeting the LipL32 gene. Diagn. Microbiol. Infect. Dis. 2009, 64, 247–255. [Google Scholar] [CrossRef]
- Ahmed, A.; Thaipadungpanit, J.; Boonsilp, S.; Wuthiekanun, V.; Nalam, K.; Spratt, B.G.; Aanensen, D.M.; Smythe, L.D.; Ahmed, N.; Feil, E.J.; et al. Comparison of Two Multilocus Sequence Based Genotyping Schemes for Leptospira Species. PLOS Negl. Trop. Dis. 2011, 5, e1374. [Google Scholar] [CrossRef]
- Müller, N.; Zimmermann, V.; Hentrich, B.; Gottstein, B. Diagnosis of Neospora caninum and Toxoplasma gondii infection by PCR and DNA hybridization immunoassay. J. Clin. Microbiol. 1996, 34, 2850–2852. [Google Scholar] [CrossRef] [PubMed]
- Fedorko, D.P.; Nelson, N.A.; Cartwright, C.P. Identification of microsporidia in stool specimens by using PCR and restriction endonucleases. J. Clin. Microbiol. 1995, 33, 1739–1741. [Google Scholar] [CrossRef] [PubMed]
- O’Hagan, M.J.H.; Pascual-Linaza, A.V.; Couzens, C.; Holmes, C.; Bell, C.; Spence, N.; Huey, R.J.; Murphy, J.A.; Devaney, R.; Lahuerta-Marin, A. Estimation of the Prevalence of Antimicrobial Resistance in Badgers (Meles meles) and Foxes (Vulpes vulpes) in Northern Ireland. Front. Microbiol. 2021, 12, 596891. [Google Scholar] [CrossRef] [PubMed]
- Scholz, H.C.; Hofer, E.; Vergnaud, G.; Le Fleche, P.; Whatmore, A.M.; Al Dahouk, S.; Pfeffer, M.; Krüger, M.; Cloeckaert, A.; Tomaso, H. Isolation of Brucella microti from Mandibular Lymph Nodes of Red Foxes, Vulpes vulpes, in Lower Austria. Vector-Borne Zoonotic Dis. 2009, 9, 153–156. [Google Scholar] [CrossRef] [PubMed]
- EFSA, (European Food Safety Authority); ECDC, (European Centre for Disease Prevention and Control). The European Union One Health 2019 Zoonoses Report. EFSA J. 2021, 19, e06406. [Google Scholar]
- Dumitrache, M.O.; Matei, I.A.; Ionică, A.M.; Kalmár, Z.; D’Amico, G.; Sikó-Barabási, S.; Ionescu, D.T.; Gherman, C.M.; Mihalca, A.D. Molecular detection of Anaplasma phagocytophilum and Borrelia burgdorferi sensu lato genospecies in red foxes (Vulpes vulpes) from Romania. Parasites Vectors 2015, 8, 514. [Google Scholar] [CrossRef]
- Cardoso, L.; Gilad, M.; Cortes, H.C.; Nachum-Biala, Y.; Lopes, A.P.; Vila-Viçosa, M.J.; Simoes, M.; Rodrigues, P.A.; Baneth, G. First report of Anaplasma platys infection in red foxes (Vulpes vulpes) and molecular detection of Ehrlichia canis and Leishmania infantum in foxes from Portugal. Parasites Vectors 2015, 8, 144. [Google Scholar] [CrossRef]
- Millán, J.; Proboste, T.; de Mera, I.G.F.; Chirife, A.D.; de la Fuente, J.; Altet, L. Molecular detection of vector-borne pathogens in wild and domestic carnivores and their ticks at the human–wildlife interface. Ticks Tick-Borne Dis. 2015, 7, 284–290. [Google Scholar] [CrossRef] [PubMed]
- Hulinská, D.; Langrová, K.; Pejcoch, M.; Pavlásek, I. Detection of Anaplasma phagocytophilum in animals by real-time polymerase chain reaction. APMIS 2004, 112, 239–247. [Google Scholar] [CrossRef]
- Medkour, H.; Laidoudi, Y.; Marié, J.-L.; Fenollar, F.; Davoust, B.; Mediannikov, O. Molecular Investigation of Vector-Borne pathogens in red foxes (Vulpes vulpes) from southern France. J. Wildl. Dis. 2020, 56, 837–850. [Google Scholar] [CrossRef]
- Goering, R.V.; Dockrell, H.M.; Zuckerman, M.; Chiodini, P.L. Multisystem zoonoses. Mims’ Med. Microbiol.Immunol. 2019, 29, 386–399. [Google Scholar]
- Alić, A.; Šupić, J.; Goletić, T.; Rešidbegović, E.; Lutvikadić, I.; Hodžić, A. A Unique Case of Fatal Coinfection Caused by Leptospira spp. and Hepatozoon canis in a Red Fox Cub (Vulpes vulpes). Pathogens 2021, 11, 11. [Google Scholar] [CrossRef] [PubMed]
- Slavica, A.; Deždek, D.; Konjević, D.; Cvetnić, Z.; Sindicic, M.; Stanin, D.; Habus, J.; Turk, N. Prevalence of leptospiral antibodies in the red fox (Vulpes vulpes) population of Croatia. Vet. Med. 2011, 56, 209–213. [Google Scholar] [CrossRef]
- Žele-Vengušt, D.; Lindtner-Knific, R.; Mlakar-Hrženjak, N.; Jerina, K.; Vengušt, G. Exposure of Free-Ranging Wild Animals to Zoonotic Leptospira interrogans Sensu Stricto in Slovenia. Animals 2021, 11, 2722. [Google Scholar] [CrossRef] [PubMed]
- Millán, J.; Candela, M.G.; López-Bao, J.V.; Pereira, M.; Jiménez, M.A.; León-Vizcaíno, L. Leptospirosis in wild and domestic carnivores in natural areas in Andalusia, Spain. Vector-Borne Zoonotic Dis. 2009, 9, 549–554. [Google Scholar] [CrossRef]
- Żmudzki, J.; Arent, Z.; Jabłoński, A.; Nowak, A.; Zębek, S.; Stolarek, A.; Bocian, Ł.; Brzana, A.; Pejsak, Z. Seroprevalence of 12 serovars of pathogenic Leptospira in red foxes (Vulpes vulpes) in Poland. Acta Vet. Scand. 2018, 60, 34. [Google Scholar] [CrossRef] [PubMed]
- Millán, J.; Velarde, R.; Chirife, A.D.; León-Vizcaíno, L. Carriage of pathogenic Leptospira in carnivores at the wild/domestic interface. Pol. J. Vet. Sci. 2019, 22, 589–598. [Google Scholar] [CrossRef] [PubMed]
- Ayral, F.; Djelouadji, Z.; Raton, V.; Zilber, A.L.; Gasqui, P.; Faure, E.; Baurier, F.; Vourc’h, G.; Kodjo, A.; Combes, B. Hedgehogs and Mustelid Species: Major Carriers of Pathogenic Leptospira, a Survey in 28 Animal Species in France (20122015). PLoS ONE 2016, 11, e0162549. [Google Scholar] [CrossRef]
- Baneth, G.; Florin-Christensen, M.; Cardoso, L.; Schnittger, L. Reclassification of Theileria annae as Babesia vulpes sp. nov. Parasites Vectors 2015, 8, 1–7. [Google Scholar] [CrossRef] [PubMed]
- Solano-Gallego, L.; Sainz, Á.; Roura, X.; Estrada-Peña, A.; Miró, G. A review of canine babesiosis: The European perspective. Parasites Vectors 2016, 9, 1–18. [Google Scholar] [CrossRef] [PubMed]
- Radyuk, E.; Karan, L. A case of Babesia vulpes infection in a dog in Russia. Vet. Parasitol. Reg. Stud. Rep. 2020, 22, 100467. [Google Scholar] [CrossRef] [PubMed]
- Baneth, G.; Cardoso, L.; Brilhante-Simões, P.; Schnittger, L. Establishment of Babesia vulpes n. sp. (Apicomplexa: Babesiidae), a piroplasmid species pathogenic for domestic dogs. Parasites Vectors 2019, 12, 1–8. [Google Scholar] [CrossRef] [PubMed]
- Lindsay, D.S.; Dubey, J.P. Neosporosis, Toxoplasmosis, and Sarcocystosis in Ruminants: An Update. Vet. Clin. N. Am. Food Anim. Pract. 2020, 36, 205–222. [Google Scholar] [CrossRef]
- Almería, S.; Ferrer, D.; Pabón, M.; Castellà, J.; Mañas, S. Red foxes (Vulpes vulpes) are a natural intermediate host of Neospora caninum. Vet. Parasitol. 2002, 107, 287–294. [Google Scholar] [CrossRef]
- Dubey, J.P.; Whitesell, L.E.; Culp, W.E.; Daye, S. Diagnosis and treatment of Neospora caninum-associated dermatitis in a red fox (Vulpes vulpes) with concurrent Toxoplasma gondii infection. J. Zoo Wildl. Med. 2014, 45, 454–457. [Google Scholar] [CrossRef] [PubMed]
- Jakubek, E.B.; Bröjer, C.; Regnersen, C.; Uggla, A.; Schares, G.; Björkman, C. Seroprevalences of Toxoplasma gondii and Neospora caninum in Swedish red foxes (Vulpes vulpes). Vet. Parasitol. 2001, 102, 167–172. [Google Scholar] [CrossRef]
- Wanha, K.; Edelhofer, R.; Gabler-Eduardo, C.; Prosl, H. Prevalence of antibodies against Neospora caninum and Toxoplasma gondii in dogs and foxes in Austria. Vet. Parasitol. 2005, 128, 189–193. [Google Scholar] [CrossRef]
- Reiterová, K.; Špilovská, S.; Čobádiová, A.; Hurníková, Z. Prevalence of Toxoplasma gondii and Neospora caninum in red foxes in Slovakia. Acta Parasitol. 2016, 61, 762–768. [Google Scholar] [CrossRef]
- Höche, J.; House, R.V.; Heinrich, A.; Schliephake, A.; Albrecht, K.; Pfeffer, M.; Ellenberger, C. Pathogen Screening for Possible Causes of Meningitis/Encephalitis in Wild Carnivores From Saxony-Anhalt. Front. Vet. Sci. 2022, 9, 826355. [Google Scholar] [CrossRef]
- Lukášová, R.; Marková, J.; Bártová, E.; Murat, J.B.; Sedlák, K. Molecular Evidence of Toxoplasma gondii, Neospora caninum, and Encephalitozoon cuniculi in Red Foxes (Vulpes vulpes). J. Wildl. Dis. 2018, 54, 825–828. [Google Scholar] [CrossRef]
- Hůrková, L.; Modrý, D. PCR detection of Neospora caninum, Toxoplasma gondii and Encephalitozoon cuniculi in brains of wild carnivores. Vet. Parasitol. 2006, 137, 150–154. [Google Scholar] [CrossRef] [PubMed]
- Bartley, P.M.; Wright, S.E.; Zimmer, I.A.; Roy, S.; Kitchener, A.C.; Meredith, A.; Innes, E.A.; Katzer, F. Detection of Neospora caninum in wild carnivorans in Great Britain. Vet. Parasitol. 2013, 192, 279–283. [Google Scholar] [CrossRef] [PubMed]
- Magalhães, T.R.; Pinto, F.F.; Queiroga, F.L. A multidisciplinary review about Encephalitozoon cuniculi in a One Health perspective. Parasitol. Res. 2022, 121, 2463–2479. [Google Scholar] [CrossRef] [PubMed]
- Murphy, T.M.; Walochnik, J.; Hassl, A.; Moriarty, J.; Mooney, J.; Toolan, D.; Sanchez-Miguel, C.; O’Loughlin, A.; McAuliffe, A. Study on the prevalence of Toxoplasma gondii and Neospora caninum and molecular evidence of Encephalitozoon cuniculi and Encephalitozoon (Septata) intestinalis infections in red foxes (Vulpes vulpes) in rural Ireland. Vet. Parasitol. 2007, 146, 227–234. [Google Scholar] [CrossRef] [PubMed]
| Pathogen | Amplicons (Target Gene) | Primers Sequence (5′–3′) | PCR Conditions | Reference |
|---|---|---|---|---|
| Anaplasma phagocytophilum * | 932 bp (16 S rRNA) [First PCR] | GE3a (CACATGCAAGTCGAACGGATTATTC) GE10r (TTCCGTTAAGAAGGATCTAATCTCC) | 95 °C–30 s 55 °C–30 s 72 °C–1 min | [21] |
| 546 bp (16S rRNA) [Second PCR] | GE9f (AACGGATTATTCTTTATAGCTTGCT) GE2 (GGCAGTATTAAAAGCAGCTCCAGG) | |||
| Babesia | 560 pb (ssrRNA) | Mic1 (GTCTTGTAATTGGAATGATGG) Mic2 (CCAAAGACTTTGATTTCTCTC) | 95 °C–30 s 50 °C–30 s 72 °C–1 min | [22] |
| Brucella spp. | 905 bp (16SrRNA) | F4 (TCGAGCGCCCGCAAGGGG) R2 (AACCATAGTGTCTCCACTAA) | 95 °C–30 s 54 °C–1 min 72 °C–1 min | [23] |
| Coxiella burnetii | 687 bp (IS1111a) | Trans-1 (TATGTATCCACCGTAGCCAGT) Trans-2 (CCCAACAACACCTCCTTATTC) | 95 °C–30 s 64 °C–1 min 72 °C–1 min | [24] |
| Ehrlichia canis * | 478 bp (16S rRNA) [First PCR] | ECCf (AGAACGAACGCTGGCGGCAAGC) ECBr (CGTATTACCGCGGCTGCTGGCA) | 95 °C–1 min 55 °C–2 min 72 °C–1.5 min | [25,26] |
| 389 bp (16S rRNA) [Second PCR] | ECA (CAATTATTTATAGCCTCTGGCTATAGGA) HE3r (TATAGGTACCGTCATTATCTTCCCTAT) | |||
| Hepatozoon spp. | 660 pb (18S rRNA) | HepF (ATACATGAGCAAAATCTCAAC) HepR (CTTATTATTCCATGCTGCAG) | 95 °C–30 s 57 °C–30 s 72 °C–1 min | [27] |
| Leptospira spp. | 103 bp (16S rRNA) [Leptospira genus] | 16S-P1 (TAGTGAACGGGATTAGATAC) 16S-P2 (GGTCTACTTAATCCGTTAGG) | 95 °C–30 s 60 °C–30 s 72 °C–1 min | [28] |
| 242 bp (lipL32) [pathogenic leptospirae] | LipL32–45F (AAGCATTACCGCTTGTGGTG) LipL32–286R (GAACTCCCATTTCAGCGA TT) | 95 °C–30 s 58 °C–30 s 72 °C–1 min | [29] | |
| 450 (rrs2) [for sequencing] | rrs2F (CATGCAAGTCAAGCGGAGTA) rrs2R (AGTTGAGCCCGCAGTTTTC) | 95 °C–30 s 58 °C–30 s 72 °C–1 min | [30] | |
| Neospora caninum | 337 pb (Region NC5) | Np6 + (TCGCCAGTCAACCTACGTCTTCT) Np21 (CCCAGTGCGTCCAATCCTGTAAC) | 95 °C–30 s 63 °C–30 s 72 °C–30 s | [31] |
| Microsporidia | 250–280 pb (18S rRNA) | V1 (CACCAGGTTGATTCTGCCTGAC) PMP2 (CCTCTCCGGAACCAAACCCTG) | 94 °C–30 s 60 °C–30 s 72 °C–30 s | [32] |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ebani, V.V.; Trebino, C.; Guardone, L.; Bertelloni, F.; Cagnoli, G.; Nardoni, S.; Sel, E.; Wilde, E.; Poli, A.; Mancianti, F. Occurrence of Bacterial and Protozoan Pathogens in Red Foxes (Vulpes vulpes) in Central Italy. Animals 2022, 12, 2891. https://doi.org/10.3390/ani12202891
Ebani VV, Trebino C, Guardone L, Bertelloni F, Cagnoli G, Nardoni S, Sel E, Wilde E, Poli A, Mancianti F. Occurrence of Bacterial and Protozoan Pathogens in Red Foxes (Vulpes vulpes) in Central Italy. Animals. 2022; 12(20):2891. https://doi.org/10.3390/ani12202891
Chicago/Turabian StyleEbani, Valentina Virginia, Chiara Trebino, Lisa Guardone, Fabrizio Bertelloni, Giulia Cagnoli, Simona Nardoni, Emily Sel, Emily Wilde, Alessandro Poli, and Francesca Mancianti. 2022. "Occurrence of Bacterial and Protozoan Pathogens in Red Foxes (Vulpes vulpes) in Central Italy" Animals 12, no. 20: 2891. https://doi.org/10.3390/ani12202891
APA StyleEbani, V. V., Trebino, C., Guardone, L., Bertelloni, F., Cagnoli, G., Nardoni, S., Sel, E., Wilde, E., Poli, A., & Mancianti, F. (2022). Occurrence of Bacterial and Protozoan Pathogens in Red Foxes (Vulpes vulpes) in Central Italy. Animals, 12(20), 2891. https://doi.org/10.3390/ani12202891

